(A, B) Enrichment ratio of selected non-redundant signatures of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways overrepresented in ductal cells after beta cells ablation (UP – A and DOWN – …
(1) Design of the experimental pipeline for transcriptomic experiment. (2) Expression of ppp3cca; ppp3ccb; nfatc3a; nfatc3b in acinar, alpha, beta, delta, or ductal cells population from the …
(A) Experimental design for regeneration test in larvae with CsA treatment. Briefly, after nifurpirinol treatment from 3 to 4 dpf, larvae were treated with CsA from 1 to 3 dpt and fixed and analyzed …
(1) Whole mount fluorescent immunohistochemistry (mCherry) of the pancreas of Tg(ins:NTR-P2A-mCherry) larvae at 4–7 and 14 dpt. 3D projection (stack) of ablated larvae treated with DMSO or CsA …
(A) Experimental design for regeneration test in larvae with heat-shocks. Briefly, after nifurpirinol treatment from 3 to 4 dpf, four heat-shock were performed from 1 to 3 dpt and larvae were fixed …
(A) Experimental design for Notch inhibition test in non-ablated condition. Larvae were treated concomitantly with LY411575 (Notch inhibitor) and Cyclosporin A (CsA) from 3 to 4 dpf and were fixed …
(1) Experimental design for Notch inhibition test in non-ablated condition. Larvae were treated concomitantly with LY411575 (Notch inhibitor) and FK506 from 3 to 4 dpf and were fixed and analyzed at …
(A) Experimental design for 5‐ethynyl‐2′‐deoxyuridine (EdU) assay in Notch test. Larvae were treated concomitantly with LY411575 (Notch inhibitor) and Cyclosporin A (CsA) from 3 to 4 dpf and then …
(1–3) Barplot representing the number of GFP+ ductal cells which in pancreatic tail of Tg(ins:NTR-P2A-mCherry); Tg(nkx6.1:GFP) larvae at 4 dpf for the Notch test. (1) Mild Notch inhibition with …
(A) Whole mount fluorescent immunohistochemistry (GFP and mCherry) of the pancreas of Tg(ins:NTR-P2A-mCherry); Tg(nkx6.1:GFP) 2-month-old zebrafish at 7 dpt. 3D projection (stack) of non-ablated and …
(1) Barplot representing the glycemia (mg/dl) of Tg(ins:NTR-P2A-mCherry); adult zebrafish at 14 dpt. The pink triangles represent the ablated condition; the inverted green triangles ablated + …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Genetic reagent (Danio rerio) | TgBAC(nkx6. 1:eGFP)ulg004 | PMID:26329351 | ZFIN: ZDB-ALT-160205-1 | |
Genetic reagent (Danio rerio) | Tg(ins:NTR-P2A-mCherry)ulg034 | PMID:29663654 | ZFIN: ZDB-ALT-171122-9 | |
Genetic reagent (Danio rerio) | Tg(cftr:gal4) | PMID:25592226 | ZFIN: ZDB-FISH-150901-25442 | |
Genetic reagent (Danio rerio) | Tg(tp1: VenusPest) | PMID:22492351 | ZFIN: ZDB-FISH-150901-8023 | |
Genetic reagent (Danio rerio) | Tg(hsp70:eGFP- P2A-ppp3ccaCA) ulg068 | This paper | See Zebrafish husbandry and generation of the Tg(hsp70:eGF P-P2A-ppp3ccaCA) zebrafish line | |
Genetic reagent (Danio rerio) | Tg(UAS:eGFP-P2A-ppp3ccaCA) ulg069 | This paper | See Zebrafish husbandry and generation of the Tg(UAS:eGFP- P2A-ppp3ccaCA) zebrafish line | |
Antibody | Anti-GFP (chicken polyclonal) | Aves Labs | GFP-1020 | 1:1000 |
Antibody | Anti-mCherry/ds Red (rabbit polyclonal) | Clontech | 632496 | 1:500 |
Antibody | Anti-glucagon (mouse polyclonal) | Sigma | G2654 | 1:300 |
Antibody | Goat polyclonal anti-Chicken IgY (H+L), Alexa Fluor 488 | Invitrogen | A-11039 | 1:750 |
Antibody | Goat polyclonal anti-dsred 568 | Invitrogen | 1:750 | |
Antibody | Goat polyclonal anti- Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 633 | Invitrogen | 1:750 | |
Chemical compound | Nifurpirinol (NFP) | Sigma-Aldrich | 32439 | |
Chemical compound | Metronidazole (MTZ) | Sigma-Aldrich | M1547 | |
Chemical compound | Cyclosporine A (CsA) | Selleckchem | S2286 | |
Chemical compound | LY411575 | Sigma-Aldrich | SML0506 | |
Chemical compound | CHIR990211 | Sellekchem | CT99021 | |
Commercial assay or kit | Gateway LR Clonase II Enzyme mix | Invitrogen | 11791020 | |
Commercial assay or kit | Gateway BP Clonase II Enzyme mix | Invitrogen | 11789020 | |
Sequence-based reagent | IM369 | This paper | PCR primer | gaagaaaaccccggtcctatgtcgacgaaagagccgaaag |
Sequence-based reagent | IM380 | This paper | PCR primer | ccttacacattcccgtcagtgc |
Sequence-based reagent | IM371 | This paper | PCR primer | CGGCTCTTTCGTCGACATAGGACCGGGGTTTTCTTCCACG |
Sequence-based reagent | O226 | This paper | PCR primer | GCCACCATGGTGAGCAAGGGCGAGGA |
Sequence-based reagent | IM370 | This paper | PCR primer | ttattagatcttatttctgatcacctcctt |
Sequence-based reagent | IM459 | This paper | PCR primer | cacacgaattcgccgccaccATGGTGAGCAAGGGCGAG |
Sequence-based reagent | IM460 | This paper | PCR primer | ggatcggtcgagatccttacGATCTTATTTCTGATCACCTCCTTACG |
Sequence-based reagent | IM457 | This paper | PCR primer | GTAAGGATCTCGACCGATCCTG |
Sequence-based reagent | IM458 | This paper | PCR primer | GGTGGCGGCGAATTCGTG |
Commercial assay or kit | Nextera XT DNA Library kit | Illumina | FC-131–1024 | |
Commercial assay or kit | Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye | Invitrogen | C10340 | |
Software, algorithm | Imaris | Bitplane (http://www.bitplane.com/imaris/imaris) | RRID:SCR_007370 | Version 9.5 |
Software, algorithm | GraphPad Prism | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | Version 8 |
Software, algorithm | DESeq2 | DESeq2 (https://bioconductor.org/packages/release/bioc/html/DESeq2.html) | RRID:SCR_015687 | |
Software, algorithm | WebGestalt | WebGestalt (http://www.webgestalt.org/) | RRID:SCR_006786 |
Table of DE (differentially expressed) genes od ductal cells 3 days after beta cell ablation compared to non-ablated controls.
Table of ORA analysis results with data from Supplementary file 1.