Negative cell cycle regulation by calcineurin is necessary for proper beta cell regeneration in zebrafish
- Zebrafish Development and Disease Models Laboratory, GIGA-Stem Cells, University of Liège, Belgium
- GIGA-Genomics Core Facility, GIGA, University of Lièg, Belgium
Figures
Figure 1 with 1 supplement
Transcriptomic profiling of ductal cells during beta cell regeneration and validation in larvae.
(A, B) Enrichment ratio of selected non-redundant signatures of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways overrepresented in ductal cells after beta cells ablation (UP – A and DOWN – …
Figure 1—figure supplement 1
Transcriptomic profiling of ductal cells during beta cell regeneration and validation in larvae.
(1) Design of the experimental pipeline for transcriptomic experiment. (2) Expression of ppp3cca; ppp3ccb; nfatc3a; nfatc3b in acinar, alpha, beta, delta, or ductal cells population from the …
Figure 2 with 1 supplement
Calcineurin inhibition with Cyclosporin A (CsA) increases the ductal regenerative response.
(A) Experimental design for regeneration test in larvae with CsA treatment. Briefly, after nifurpirinol treatment from 3 to 4 dpf, larvae were treated with CsA from 1 to 3 dpt and fixed and analyzed …
Figure 2—figure supplement 1
Calcineurin inhibition with Cyclosporin A (CsA) increases the ductal regenerative response.
(1) Whole mount fluorescent immunohistochemistry (mCherry) of the pancreas of Tg(ins:NTR-P2A-mCherry) larvae at 4–7 and 14 dpt. 3D projection (stack) of ablated larvae treated with DMSO or CsA …
Figure 3
Transgenic mediated overexpression of calcineurin abolish the ductal regenerative response.
(A) Experimental design for regeneration test in larvae with heat-shocks. Briefly, after nifurpirinol treatment from 3 to 4 dpf, four heat-shock were performed from 1 to 3 dpt and larvae were fixed …
Figure 4 with 1 supplement
Calcineurin (CaN) repression potentializes the effect of Notch inhibition on beta cell formation.
(A) Experimental design for Notch inhibition test in non-ablated condition. Larvae were treated concomitantly with LY411575 (Notch inhibitor) and Cyclosporin A (CsA) from 3 to 4 dpf and were fixed …
Figure 4—figure supplement 1
Calcineurin (CaN) repression potentializes the effect of Notch inhibition on beta cell formation.
(1) Experimental design for Notch inhibition test in non-ablated condition. Larvae were treated concomitantly with LY411575 (Notch inhibitor) and FK506 from 3 to 4 dpf and were fixed and analyzed at …
Figure 5 with 1 supplement
Calcineurin (CaN) repression increases the proportion of ductal proliferating cells.
(A) Experimental design for 5‐ethynyl‐2′‐deoxyuridine (EdU) assay in Notch test. Larvae were treated concomitantly with LY411575 (Notch inhibitor) and Cyclosporin A (CsA) from 3 to 4 dpf and then …
Figure 5—figure supplement 1
Calcineurin (CaN) repression increases the proportion of duct proliferating cells.
(1–3) Barplot representing the number of GFP+ ductal cells which in pancreatic tail of Tg(ins:NTR-P2A-mCherry); Tg(nkx6.1:GFP) larvae at 4 dpf for the Notch test. (1) Mild Notch inhibition with …
Figure 6 with 1 supplement
Calcineurin (CaN) regulation is important in juveniles/adults and necessary for correct glycemia recovery.
(A) Whole mount fluorescent immunohistochemistry (GFP and mCherry) of the pancreas of Tg(ins:NTR-P2A-mCherry); Tg(nkx6.1:GFP) 2-month-old zebrafish at 7 dpt. 3D projection (stack) of non-ablated and …
Figure 6—figure supplement 1
Calcineurin (CaN) regulation is important in juveniles/adults and necessary for correct glycemia recovery.
(1) Barplot representing the glycemia (mg/dl) of Tg(ins:NTR-P2A-mCherry); adult zebrafish at 14 dpt. The pink triangles represent the ablated condition; the inverted green triangles ablated + …
Figure 7
Model of calcineurin (CaN) action on ductal progenitors to regenerate beta cells.
Under physiological conditions, the behavior of the ductal progenitors is determined by Notch signaling. CaN is active in these progenitors and enable a proper control between proliferation and …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Danio rerio) | TgBAC(nkx6. 1:eGFP)ulg004 | PMID:26329351 | ZFIN: ZDB-ALT-160205-1 | |
| Genetic reagent (Danio rerio) | Tg(ins:NTR-P2A-mCherry)ulg034 | PMID:29663654 | ZFIN: ZDB-ALT-171122-9 | |
| Genetic reagent (Danio rerio) | Tg(cftr:gal4) | PMID:25592226 | ZFIN: ZDB-FISH-150901-25442 | |
| Genetic reagent (Danio rerio) | Tg(tp1: VenusPest) | PMID:22492351 | ZFIN: ZDB-FISH-150901-8023 | |
| Genetic reagent (Danio rerio) | Tg(hsp70:eGFP- P2A-ppp3ccaCA) ulg068 | This paper | See Zebrafish husbandry and generation of the Tg(hsp70:eGF P-P2A-ppp3ccaCA) zebrafish line | |
| Genetic reagent (Danio rerio) | Tg(UAS:eGFP-P2A-ppp3ccaCA) ulg069 | This paper | See Zebrafish husbandry and generation of the Tg(UAS:eGFP- P2A-ppp3ccaCA) zebrafish line | |
| Antibody | Anti-GFP (chicken polyclonal) | Aves Labs | GFP-1020 | 1:1000 |
| Antibody | Anti-mCherry/ds Red (rabbit polyclonal) | Clontech | 632496 | 1:500 |
| Antibody | Anti-glucagon (mouse polyclonal) | Sigma | G2654 | 1:300 |
| Antibody | Goat polyclonal anti-Chicken IgY (H+L), Alexa Fluor 488 | Invitrogen | A-11039 | 1:750 |
| Antibody | Goat polyclonal anti-dsred 568 | Invitrogen | 1:750 | |
| Antibody | Goat polyclonal anti- Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 633 | Invitrogen | 1:750 | |
| Chemical compound | Nifurpirinol (NFP) | Sigma-Aldrich | 32439 | |
| Chemical compound | Metronidazole (MTZ) | Sigma-Aldrich | M1547 | |
| Chemical compound | Cyclosporine A (CsA) | Selleckchem | S2286 | |
| Chemical compound | LY411575 | Sigma-Aldrich | SML0506 | |
| Chemical compound | CHIR990211 | Sellekchem | CT99021 | |
| Commercial assay or kit | Gateway LR Clonase II Enzyme mix | Invitrogen | 11791020 | |
| Commercial assay or kit | Gateway BP Clonase II Enzyme mix | Invitrogen | 11789020 | |
| Sequence-based reagent | IM369 | This paper | PCR primer | gaagaaaaccccggtcctatgtcgacgaaagagccgaaag |
| Sequence-based reagent | IM380 | This paper | PCR primer | ccttacacattcccgtcagtgc |
| Sequence-based reagent | IM371 | This paper | PCR primer | CGGCTCTTTCGTCGACATAGGACCGGGGTTTTCTTCCACG |
| Sequence-based reagent | O226 | This paper | PCR primer | GCCACCATGGTGAGCAAGGGCGAGGA |
| Sequence-based reagent | IM370 | This paper | PCR primer | ttattagatcttatttctgatcacctcctt |
| Sequence-based reagent | IM459 | This paper | PCR primer | cacacgaattcgccgccaccATGGTGAGCAAGGGCGAG |
| Sequence-based reagent | IM460 | This paper | PCR primer | ggatcggtcgagatccttacGATCTTATTTCTGATCACCTCCTTACG |
| Sequence-based reagent | IM457 | This paper | PCR primer | GTAAGGATCTCGACCGATCCTG |
| Sequence-based reagent | IM458 | This paper | PCR primer | GGTGGCGGCGAATTCGTG |
| Commercial assay or kit | Nextera XT DNA Library kit | Illumina | FC-131–1024 | |
| Commercial assay or kit | Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye | Invitrogen | C10340 | |
| Software, algorithm | Imaris | Bitplane (http://www.bitplane.com/imaris/imaris) | RRID:SCR_007370 | Version 9.5 |
| Software, algorithm | GraphPad Prism | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | Version 8 |
| Software, algorithm | DESeq2 | DESeq2 (https://bioconductor.org/packages/release/bioc/html/DESeq2.html) | RRID:SCR_015687 | |
| Software, algorithm | WebGestalt | WebGestalt (http://www.webgestalt.org/) | RRID:SCR_006786 |
Additional files
-
Supplementary file 1
Table of DE (differentially expressed) genes od ductal cells 3 days after beta cell ablation compared to non-ablated controls.
- https://cdn.elifesciences.org/articles/88813/elife-88813-supp1-v1.xlsx
-
Supplementary file 2
Table of ORA analysis results with data from Supplementary file 1.
- https://cdn.elifesciences.org/articles/88813/elife-88813-supp2-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/88813/elife-88813-mdarchecklist1-v1.pdf
