Molecular tuning of sea anemone stinging
- Department of Molecular and Cellular Biology, Harvard University, United States
- Machine Learning Center Genoa (MalGa), Department of Civil, Chemical and Environmental Engineering (DICCA), University of Genoa, Italy
- Department of Organismic and Evolutionary Biology and Museum of Comparative Zoology, Harvard University, United States
Figures
Figure 1
Comparative sea anemone stinging behavior.
(A) Nematostella vectensis stings with tentacles while Exaiptasia diaphana also stings with acontia filaments that are ejected from its body for defense. Left: Nematostella nematocyte discharge was …
Figure 2 with 5 supplements
Nematostella stinging is regulated by predation while Exaiptasia stings for defense.
(A) The cost of stinging is , where is the cost for full nematocyte discharge and it either does not change (solid lines filled circles) or increases slightly (dashed lines empty circles) with …
Figure 2—figure supplement 1
Sketch of Markov Decision Processes model and predictions for stinging.
(A) Directed graph representing the Markov Decision Process for predatory stinging (top) including states of starvation , actions , and transitions to adjacent states depending on the …
Figure 2—figure supplement 2
Optimal policy predicted by Bellman’s theory for the MDP sketched in Figure 2—figure supplement 1A.
Left: three choices of concave reward functions : , upper left; , middle left; , lower left. Solid and dashed lines correspond to two choices of the parameter for each reward as in the …
Figure 2—figure supplement 3
Sketch of theoretical prediction for predatory stinging with increasing cost.
Similar to Figure 2—figure supplement 1A bottom, for the case where the cost per nematocyte varies with starvation . Moderate increase in the cost per starvation (dashed light-blue line) do not …
Figure 2—figure supplement 4
Effects of a moderately vs dramatically increasing cost with starvation.
For a constant cost of full discharge or moderately increasing cost with starvation, predatory stinging always increases, whereas defensive stinging decreases or stays constant (results discussed in …
Figure 2—figure supplement 5
Modulation of Nematostella and Exaiptasia stinging is not due to changes in the abundance of nematocytes.
Nematocytes were highly abundant in tentacles from Nematostella (top) and Exaiptasia (bottom) before and after starvation. Representative of n=3 animals. Scale bar = 50 μm.
Figure 3
Exaiptasia nematocyte voltage-gated Ca2+ currents exhibit minimal steady-state inactivation compared with Nematostella.
(A) Touch-elicited Exaiptasia tentacle nematocyte discharge was blocked in the absence of Ca2+ (p<0.01, paired two-tailed student’s t-test, n=9 animals) or by addition of the CaV channel blocker Cd2+…
Figure 4 with 1 supplement
Exaiptasia expresses a CaV β subunit splice isoform that confers weak voltage-dependent inactivation.
(A) ddPCR ratio of concentrations of CaV β subunit 1 and 2 mRNAs was similar in tentacle (n=5), body (n=5), and acontia (n=4 animals) tissue samples. (B) EdCaVβ1 and EdCaVβ2 localized to distinct …
Figure 4—figure supplement 1
Transcriptomic and molecular analyses of Exaiptasia β subunit isoforms.
(A) mRNA expression (transcripts per million, TPM) of voltage-gated calcium (CaV) channel α and β subunits in Exaiptasia tentacle (nematocyte abundant, blue), body (nematocyte non-abundant, red), …
Figure 5 with 1 supplement
Cnidarian CaV β subunit N-termini confer unique inactivation properties.
(A) Voltage-gated currents from heterologously expressed CaV channels with Nematostella-rat chimeric β subunits demonstrate that the Nematostella N-terminus is sufficient to drive inactivation at …
-
Figure 5—source data 1
Amino acid sequences of beta subunits.
- https://cdn.elifesciences.org/articles/88900/elife-88900-fig5-data1-v1.docx
Figure 5—figure supplement 1
Voltage-dependent activation of CaV channels is conserved across cnidarian β subunits.
(A) Top: Voltage-gated currents from heterologously-expressed chimeric CaVs with the indicated β subunits elicited by voltage pulses to –120 mV (no current, black) and 0 mV (colored). Abbreviations …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Nematostella vectensis, adult, male and female) | Nematostella | Woods Hole Marine Biological Laboratory | ||
| Strain, strain background (Exaiptasia diaphana, adult, male and female) | Exaiptasia | Carolina Biological Supply Company | Item #162865 | https://www.carolina.com/marine-and-saltwater-animals/sea-anemone-aiptasia-living/162865.pr |
| Strain, strain background (Cassiopea spp., adult, male and female) | Cassiopea xamachana | Carolina Biological Supply Company | Item #162936 | https://www.carolina.com/marine-and-saltwater-animals/mangrove-jellyfish-living-pack-of-5/162936.pr?question=mangrove |
| Cell line (Homo-sapiens) | HEK293T | ATCC | CRL-3216 | |
| Recombinant DNA reagent | nCaV: cacnb2 (plasmid) | Weir et al., 2020 | NveCaVβ | |
| Recombinant DNA reagent | Rat cacna2d1 | Lin et al., 2004 | Addgene Plasmid #26575 | rCaVα2δ |
| Recombinant DNA reagent | Mouse cacna1a | Richards et al., 2007 | Addgene Plasmid #26578 | mCaVα |
| Recombinant DNA reagent | Rat cacnb2a | Wyatt et al., 1998 | Addgene Plasmid #107424 | rCaVβ |
| Recombinant DNA reagent | Exaiptasia diaphana cacnb1 (plasmid) | This paper | EdCaVβ1 | |
| Recombinant DNA reagent | Exaiptasia diaphana cacnb2 (plasmid) | This paper | EdCaVβ2 | |
| Recombinant DNA reagent | Physalia physalis cacnb (plasmid) | This paper | PpCaVβ | |
| Recombinant DNA reagent | Cyanea capillata cacnb (plasmid) | This paper | CcCaVβ | |
| Recombinant DNA reagent | Cassiopea xamachana cacnb (plasmid) | This paper | CxCaVβ | |
| Recombinant DNA reagent | Clytia hemisphaerica cacnb (plasmid) | This paper | ChCaVβ | |
| Recombinant DNA reagent | EdCaVβ2 with NveCaVβ NTerm (plasmid) | This paper | NveCaVβ-N | |
| Recombinant DNA reagent | EdCaVβ2 with rCaVβ NTerm (plasmid) | This paper | rCaVβ-N | |
| Recombinant DNA reagent | EdCaVβ2 with EdCaVβ1 NTerm (plasmid) | This paper | EdCaVβ1-N | |
| Recombinant DNA reagent | EdCaVβ2 with PpCaVβ NTerm (plasmid) | This paper | PpCaVβ-N | |
| Recombinant DNA reagent | EdCaVβ2 with CcCaVβ NTerm (plasmid) | This paper | CcCaVβ-N | |
| Recombinant DNA reagent | EdCaVβ2 with CxCaVβ NTerm (plasmid) | This paper | CxCaVβ-N | |
| Recombinant DNA reagent | EdCaVβ2 with ChCaVβ NTerm (plasmid) | This paper | ChCaVβ-N | |
| Recombinant DNA reagent | NveCaVβ with Mouse CaVβ HOOK domain (plasmid) | This paper | NVE_cacnb2_mus_hook | |
| Recombinant DNA reagent | Mouse CaVβ with NveCaVβ HOOK domain (plasmid) | This paper | Mus_cacnb2_NVE_hook | |
| Recombinant DNA reagent | NveCaVβ with Mouse CaVβ GK domain (plasmid) | This paper | NVE_cacnb2_mus_GK_domain | |
| Recombinant DNA reagent | Mouse CaVβ with NveCaVβ GK domain (plasmid) | This paper | Mus_cacnb2_NVE_GK_domain | |
| Recombinant DNA reagent | NveCaVβ with rCaVβ NTerm domain (plasmid) | This paper | Rat_Nterm_NVE_cacnb2a | |
| Recombinant DNA reagent | NveCaVβ with rCaVβ NTerm and SH3 domains (plasmid) | This paper | Rat_Nterm_SH3_NVE_cacnb2a | |
| Recombinant DNA reagent | rCaVβ with NveCaVβ NTerm and SH3 domains domain (plasmid) | This paper | NVE_Nterm_SH3_rat_cacnb2a | |
| Recombinant DNA reagent | rCaVβ with NveCaVβ NTerm domain (plasmid) | This paper | NVE_Nterm_rat_cacnb2a | |
| Sequence-based reagent | EdCaVβ1 primer F | This paper | Custom PCR primer | GGATTTCGCCCTGAGCAA |
| Sequence-based reagent | EdCaVβ1 primer R | This paper | Custom PCR primer | TGGATCTCCGAAGGAGTTGA |
| Sequence-based reagent | EdCaVβ1 probe | This paper | Custom probe | FAM-ACATAGAACTTGATAGTCTCGAGCACG-BHQ-1 |
| Sequence-based reagent | EdCaVβ2 primer F | This paper | Custom PCR primer | TGTCCAGAGCTTCACAAAGG |
| Sequence-based reagent | EdCaVβ2 primer R | This paper | Custom PCR primer | TCTTCGTCAACACTACTTGTATCA |
| Sequence-based reagent | EdCaVβ2 probe | This paper | Custom probe | HEX-ACTCAGAACCTGCTTACAGAGCCT-BHQ-1 |
| Commercial assay or kit | One-Step RT-ddPCR Advanced Kit for Probes | Bio-Rad Laboratories | Cat #1864021 | |
| Commercial assay or kit | Droplet Gen Oil for Probes | Bio-Rad Laboratories | Cat #1863005 | |
| Chemical compound, drug | CdCl2 | Sigma | Cat #202908 | |
| Software, algorithm | Rcorrector | Song and Florea, 2015 | https://github.com/mourisl/Rcorrector | |
| Software, algorithm | FilterUncorrectablePEfastq.py | Harvard Informatics | https://github.com/harvardinformatics/TranscriptomeAssemblyTools | |
| Software, algorithm | Trimgalore | The Babraham Institute Bioinformatics Group | https://github.com/FelixKrueger/TrimGalore | |
| Software, algorithm | Bowtie2 | Langmead and Salzberg, 2012 | https://bowtie-bio.sourceforge.net/bowtie2/index.shtml | |
| Software, algorithm | Fastqc | The Babraham Institute Bioinformatics Group | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | |
| Software, algorithm | Trinity | Grabherr et al., 2011 | https://github.com/trinityrnaseq | |
| Software, algorithm | Transdecoder | Haas, BJ. https://github.com/TransDecoder/TransDecoder | https://github.com/TransDecoder/TransDecoder | |
| Software, algorithm | DIAMOND | Buchfink et al., 2015 | https://github.com/bbuchfink/diamond | |
| Software, algorithm | Kallisto | Bray et al., 2016 | https://github.com/pachterlab/kallisto | |
| Software, algorithm | Clustal Omega | Madeira et al., 2022 | https://www.ebi.ac.uk/Tools/msa/clustalo/ | |
| Software, algorithm | Geneious Prime | Geneious | RRID: SCR_010519 | https://www.geneious.com |
| Software, algorithm | MAFFT v.7 | Katoh and Standley, 2013 | https://mafft.cbrc.jp/alignment/server/ | |
| Software, algorithm | ModelFinder | Kalyaanamoorthy et al., 2017 | http://www.iqtree.org/ModelFinder/ | |
| Software, algorithm | IQ-TREE v2.0 | Minh et al., 2020 | http://www.iqtree.org/ | |
| Software, algorithm | UFBoot2 | Hoang et al., 2018 | https://bio.tools/ufboot2 | |
| Software, algorithm | QuantaSoft | Bio-Rad Laboratories | https://www.bio-rad.com/en-us/life-science/digital-pcr/qx200-droplet-digital-pcr-system/quantasoft-software-regulatory-edition | |
| Software, algorithm | pClamp 11 Software Suite | Molecular Devices | https://www.moleculardevices.com/products/axon-patch-clamp-system/acquisition-and-analysis-software/pclamp-software-suite | |
| Software, algorithm | MetaMorph Microscopy Automation and Image Analysis Software | Molecular Devices | https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy | |
| Software, algorithm | Fiji (ImageJ) | Schindelin et al., 2012 | RRID: SCR_002285 | |
| Software, algorithm | GraphPad Prism | GraphPad Software | RRID: SCR_002798 | http://www.graphpad.com/ |
| Software, algorithm | Cell Sens | Olympus | https://www.olympus-lifescience.com/en/software/cellsens/ | |
| Commercial assay or kit | BaseScope Duplex Reagent Kit | Advanced Cell Diagnostics | Cat #323800 | |
| Sequence-based reagent | BaseScope Probe-BA-Epa- LOC110232233-tvX3- 1zz-st-C1 (EdCaVβ1) | Advanced Cell Diagnostics | Custom probe 1162801 C1 | |
| Sequence-based reagent | BaseScope Probe-BA-Epa- LOC110232233-tvX6- 1zz-st-C2 (EdCaVβ2) | Advanced Cell Diagnostics | Custom probe 1162811 C2 | |
| Sequence-based reagent | BaseScope Duplex Positive Control Probe-Human [Hs]-C1- Hs-PPIB-1zz/C2-POLR2A-1zz | Advanced Cell Diagnostics | Cat #700101 | |
| Sequence-based reagent | BaseScope Duplex Negative Control Probe-C1-DapB-1zz/C2- DapB-1zz | Advanced Cell Diagnostics | Cat #700141 |
