Figures and data in An engineered biosensor enables dynamic aspartate measurements in living cells

Figures
Tables
Additional files

3 figures, 2 tables and 3 additional files

Figures

Figure 1 with 4 supplements

Download asset Open asset

Protein engineering and in vitro characterization.

(A) Structure of the binding pocket of glutamate-bound GltI (2VHA.pdb) with residues S72 (left) and S27 (right) shown as sticks and bound glutamate as sticks inside transparent spheres. (B) Fluorescence response of purified jAspSnFR3-mRuby3 when titrated with aspartate (black) or glutamate or asparagine (gray tones). Ex. 485 nm (20 nm bandpass), Em. 535 nm (20 nm bandpass). Error bars are standard deviation (SD) of three technical replicates. (C) Live cell imaging in the phase contrast, GFP and red fluorescent protein (RFP) channels of H1299 Nuclear-RFP cells expressing jAspSnFR3 after 24 hr with/without glutamine.

Figure 1—source data 1 Fluorescence measurements for Figure 1.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig1-data1-v1.xlsx
Download elife-90024-fig1-data1-v1.xlsx

Figure 1—figure supplement 1

Download asset Open asset

Aspartate specificity and excitation/emission spectra.

(A) Switching specificity of the iGluSnFR3 precursor from glutamate to aspartate using S72X library (left) and S72P, S27X library (right). Titrations with aspartate (solid lines) and glutamate (dashed lines) in bacterial lysate. (B) Excitation and emission spectra of jAspSnFR3-mRuby3. Left, one-photon spectra. Excitation wavelength was varied from 400 to 520 nm (7.5 nm bandpass) while observing emission at 535 nm (10 nm bandpass). Emission wavelength was varied from 535 to 600 nm (10 nm bandpass) while exciting at 510 nm (7.5 nm bandpass). Fluorescence was measured both in the absence (dashed lines) and presence of 10 mM aspartate (solid lines). Right, two-photon cross-sections, also ±10 mM aspartate, with an overlay of calculated ΔF/F (green). Vertical bar indicates 1040 nm.

Figure 1—figure supplement 1—source data 1 Fluorescence measurements for Figure 1—figure supplement 1.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig1-figsupp1-data1-v1.xlsx
Download elife-90024-fig1-figsupp1-data1-v1.xlsx

Figure 1—figure supplement 2

Download asset Open asset

Decoy, temperature, and pH sensitivity.

(A) jAspSnFR3-mRuby3 does not appreciably change its green fluorescence in response to other amino acids (alanine, phenylalanine, glycine, histidine (red line), isoleucine, leucine, methionine, proline, glutamine, arginine, serine, threonine, valine, or tryptophan). Insert with aspartate in black and glutamate/asparagine in gray for comparison. Ex. 485 nm (20 nm bandpass), Em. 535 nm (20 nm bandpass), 0.2 µM purified protein in phosphate-buffered saline (PBS). (B) jAspSnFR3-mRuby3 does not respond to other decoys: citrate, lactate, pyruvate, malate, alpha-ketoglutarate, cis-aconitate, succinate, fumarate, or oxaloacetate (orange squares); nor to relevant pharmacological treatments: rotenone (green squares) or metformin. The small increase in fluorescence from rotenone is likely due to the scattering of a visibly turbid solution; rotenone has very low solubility in water. Ex. 485 nm (20 nm bandpass), Em. 535 nm (20 nm bandpass). (C) jAspSnFR3-mRuby3 is not adversely affected by temperature. Fluorescence as a function of aspartate titration at 23°C (light gray), 30°C (medium gray), and 37°C (black). Error bars are standard deviation of three technical replicates. (D) pH sensitivity of jAspSnFR3-mRuby3 (green component). Ex 485 nm (5 nm bp), Em 515 nm (10 nm bp). Error bars are standard deviation of five technical replicates. Solid line is with 3 mM aspartate, dashed line is without aspartate.

Figure 1—figure supplement 2—source data 1 Fluorescence measurements for Figure 1—figure supplement 2.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig1-figsupp2-data1-v1.xlsx
Download elife-90024-fig1-figsupp2-data1-v1.xlsx

Figure 1—figure supplement 3

Download asset Open asset

Stopped-flow kinetics.

(A) Stopped-flow kinetics of jAspSnFR3 using different aspartate concentrations for injection. Measurements were performed at a frequency of 1 per ms and indicated by dots. To each time-series an exponential function was fit, shown as a solid line with matching color. (B) $k_{o b s}$ as a function of aspartate concentration shown for two independent stopped-flow experiments. The line represents the linear function, fitted to the linear range to extract the kinetic rates.

Figure 1—figure supplement 3—source data 1 Fluorescence measurements and k_obs values for Figure 1—figure supplement 3.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig1-figsupp3-data1-v1.xlsx
Download elife-90024-fig1-figsupp3-data1-v1.xlsx

Figure 1—figure supplement 4

Download asset Open asset

mRuby3 interaction with histidine tag.

(A) jAspSnFR3-mRuby3 shows increased red fluorescence at millimolar concentrations of all amino acids amino acids (alanine, phenylalanine, glycine, histidine, isoleucine, leucine, methionine, proline, glutamine, arginine, serine, threonine, valine, or tryptophan), with apparent responses to histidine at 100 µM (red line). (B) Increased red fluorescence of mRuby3 in response to histidine requires a C-terminal histidine tag. (C) Increased red fluorescence of mRuby3 in response to millimolar concentrations of aspartate requires a C-terminal histidine tag. (D) mRuby, with or without histidine tag, does not increase in fluorescence upon treatment with amino acid-related compound gamma-aminobutyric acid (GABA). For all plots Ex. 555 nm (20 nm bandpass), Em. 600 nm (20 nm bandpass).

Figure 1—figure supplement 4—source data 1 Fluorescence measurements for Figure 1—figure supplement 4.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig1-figsupp4-data1-v1.xlsx
Download elife-90024-fig1-figsupp4-data1-v1.xlsx

Figure 2 with 2 supplements

Download asset Open asset

jAspSnFR3 resolves temporal aspartate changes in live cells.

(A) Overview of aspartate metabolism, highlighting how glutamine depletion, mitochondrial inhibition, GOT1/2 knockout and pyruvate/asparagine supplementation can impact aspartate levels. (B) H1299 cells treated with a rotenone titration and rescued by co-treatment with pyruvate. (C) H1299 GOT1/2 double knockout cells grown in media with 40 mM aspartate, washed thrice in media without aspartate and then changed into media with a titration of aspartate. (D) Western blot verification of H1299 GOT1/2 double knockout. (E) H1299 cells changed into media without glutamine and then glutamine repleted (repl.) at the different timepoints. (F) H1299 cells treated with either rotenone or metformin to compare inhibitor kinetics. (G) HT1080 cells treated with oligomycin A and after 22 hr rescued with a titration of mitochondrial uncoupler BAM15. (H) H1299 cells changed into media with a titration of glutamine with or without 1 mM asparagine. For (B), (C), (E–H), sensor signal over time shown as RFP normalized jAspSnFR3 signal following various perturbations of live cells. All experiments shown are normalized to a pre-treatment scan and then treated with the specified drug or amino acid. Gray dashed lines indicate the time of treatment. Colored dashed lines indicate the time of treatment for multiple treatments in the same plot. Markers indicate the average using available well replicates and are superimposed on a bootstrapped 95% confidence interval colored using the same color code as the markers. GLN, glutamine; ETC, electron transport chain; LDH, lactate dehydrogenase; OAA, oxaloacetic acid; ASP, aspartate; ASN, asparagine; AU, arbitrary unit.

Figure 2—source data 1 Fluorescence measurements for Figure 2.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig2-data1-v1.xlsx
Download elife-90024-fig2-data1-v1.xlsx
Figure 2—source data 2 Original files for Western blot analysis in Figure 2D (anti-Vinculin, anti-GOT1, anti-GOT2).: https://cdn.elifesciences.org/articles/90024/elife-90024-fig2-data2-v1.zip
Download elife-90024-fig2-data2-v1.zip
Figure 2—source data 3 PDF containing Figure 2D and original scans of relevant Western blot analysis (anti-Vinculin, anti-GOT1, anti-GOT2) with highlighted bands and sample labels.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig2-data3-v1.pdf
Download elife-90024-fig2-data3-v1.pdf

Figure 2—figure supplement 1

Download asset Open asset

Rotenone titration in different cell lines.

jAspSnFR3 temporal response after rotenone treatment. (A) HT1080 cells using nuclear RFP to normalize the jAspSnFR3 signal, treated with a rotenone titration. (B) HT1080 cells using an RFP fused to jAspSnFR3 (jAspSnFR3-mRuby3) for normalization, treated with a rotenone titration. (C) HT1080 cells treated with 100 nM rotenone at the start of the experiment (0 hr) and then rescued with pyruvate at start, 22 hr or never. (D) Comparison between the steady-state signal of (A) and (B) with a linear regression shown as a red dashed line to show that nuclear RFP and RFP fusion normalizations are equivalent. (E) HEK293t cells using an RFP fused to jAspSnFR3 for normalization, treated with a rotenone titration. For plots (A–C) and (E), markers indicate the average using available well replicates and are superimposed on a bootstrapped 95% confidence interval colored using the same color code as the markers. For plot (D), markers indicate the average using available well replicates and error bars are drawn as ± the standard deviation of the replicates. Gray dashed lines indicate the time of treatment. Orange dashed line in panel (C) indicates time of pyruvate addition. AU, arbitrary unit.

Figure 2—figure supplement 1—source data 1 Fluorescence measurements for Figure 2—figure supplement 1.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig2-figsupp1-data1-v1.xlsx
Download elife-90024-fig2-figsupp1-data1-v1.xlsx

Figure 2—figure supplement 2

Download asset Open asset

Plots related to glutamine limitation.

(A) Nuclei count over time for conditions displayed in Figure 2E. (B) Cell confluency over time for conditions displayed in Figure 2E. (C) H1299 cells changed into media with a titration of glutamine with or without 1 mM asparagine. Identical to Figure 2H but with fewer glutamine concentrations and more well replicates.

Figure 2—figure supplement 2—source data 1 RFP nuclei counts, confluency measurements, and fluorescence measurements for Figure 2—figure supplement 2.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig2-figsupp2-data1-v1.xlsx
Download elife-90024-fig2-figsupp2-data1-v1.xlsx

Figure 3 with 1 supplement

Download asset Open asset

jAspSnFR3 signal predicts liquid chromatography–mass spectrometry (LCMS) measured intracellular aspartate concentration.

(A) Hill equation with top and bottom asymptotes, midpoint and slope as free variables is fitted to the data points and shown by the black line. The intracellular aspartate concentration at the inferred half maximum of RFP normalized jAspSnFR3 signal is reported in the red inserts. (A) Rotenone, metformin, and antimycin A titrations in H1299 cells. (B) Rotenone titration in HEK293t cells. (C) Rotenone and metformin titrations in HT1080 cells. Markers indicate a single well from which both LCMS and jAspSnFR3 data was collected. Replicate wells have identical color and marker shape. AU, arbitrary unit.

Figure 3—source data 1 Fluorescence measurements and intracellular aspartate measurements for Figure 3.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig3-data1-v1.xlsx
Download elife-90024-fig3-data1-v1.xlsx

Figure 3—figure supplement 1

Download asset Open asset

jAspSnFR3 signal does not correlate with glutamate concentration.

RFP normalized jAspSnFR3 signal, following various perturbations to live cells, is not correlated with the liquid chromatography–mass spectrometry (LCMS) measured intracellular glutamate concentration. Data points are fitted to a local linear regression, shown by the black line, otherwise, these plots are identical to those in Figure 3. AU, arbitrary unit.

Figure 3—figure supplement 1—source data 1 Fluorescence measurements and intracellular glutamate measurements for Figure 3—figure supplement 1.: https://cdn.elifesciences.org/articles/90024/elife-90024-fig3-figsupp1-data1-v1.xlsx
Download elife-90024-fig3-figsupp1-data1-v1.xlsx

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Cell line (human)	H1299	ATCC	CRL-5803
Cell line (human)	HEK293T	ATCC	CRL-1573
Cell line (human)	HT1080	ATCC	CCL-121
Other	EF1A-nuclear RFP lentivirus	Cellomics Technology	PLV-10205--50	Virus
Other	U-13C, U-15N-labeled canonical amino acid mix	Cambridge Isotope Laboratories	MSK-CAA-1	Isotopic standard
Antibody	anti-Vinculin, mouse monoclonal	Sigma	SAB4200729	1:10,000 dilution
Antibody	anti-GOT2, rabbit polyclonal	Proteintech	14800-1-AP	1:750 dilution
Antibody	anti-GOT1, rabbit monoclonal	Cell Signaling	34423S	1:1000 dilution
Sequence-based reagent	GOT1_1	Synthego	CRISPR guide	CAGUCAUCCGUGCGAUAUGC
Sequence-based reagent	GOT1_2	Synthego	CRISPR guide	GCACGGAUGACUGCCAUCCC
Sequence-based reagent	GOT1_3	Synthego	CRISPR guide	CGAUCUUCUCCAUCUGGGAA
Sequence-based reagent	GOT2_1	Synthego	CRISPR guide	UUUCUCAUUUCAGCUCCUGG
Sequence-based reagent	GOT2_2	Synthego	CRISPR guide	CGGACGCUAGGCAGAACGUA
Sequence-based reagent	GOT2_3	Synthego	CRISPR guide	UCCUUCCACUGUUCCGGACG
Other	Incucyte S3	Sartorius		Instrument
Other	Q Exactive HF-X Hybrid Quadrupole	Thermo		Instrument
Sequence-based reagent	S72X	IDT	Primer	CAG CAG TGG AAT ACG GTT TTG SNN GGT AAT CGG AAT CAG TTT TAC
Sequence-based reagent	S27X.E25K	IDT	Primer	GTC GTA ATA AGA GAA AGG CAC SNN AGA TTT ACG GTG ACC GAC GAC
Chemical compound	Aspartate	Sigma-Aldrich	A6683
Chemical compound	Glutamate	Sigma-Aldrich	G8415
Chemical compound	Alanine	Sigma-Aldrich	A7627
Chemical compound	Cysteine	Sigma-Aldrich	C7352
Chemical compound	Phenylalanine	Sigma-Aldrich	P2126
Chemical compound	Glycine	Fisher Bioreagents	BP381
Chemical compound	Histidine	Sigma-Aldrich	H8125
Chemical compound	Isoleucine	Sigma-Aldrich	I2752
Chemical compound	Leucine	Sigma-Aldrich	L8000
Chemical compound	Lysine	Sigma-Aldrich	L5626
Chemical compound	Methionine	Sigma-Aldrich	M9625
Chemical compound	Asparagine	Sigma-Aldrich	A4159
Chemical compound	Proline	Sigma-Aldrich	P5607
Chemical compound	Glutamine	Sigma-Aldrich	G3126
Chemical compound	Arginine	Sigma-Aldrich	A5131
Chemical compound	Serine	Sigma-Aldrich	S4311
Chemical compound	Threonine	Sigma-Aldrich	T8625
Chemical compound	Valine	Sigma-Aldrich	V0513
Chemical compound	Tyrosine	Fluka	93830
Chemical compound	Tryptophan	Sigma-Aldrich	T0254
Chemical compound	Citrate	Thermo Fisher Scientific	A940
Chemical compound	L-Lactate	Sigma-Aldrich	L7022
Chemical compound	Pyruvate	Gibco	11360070
Chemical compound	Rotenone	Sigma-Aldrich	R9975
Chemical compound	Metformin	Sigma-Aldrich	317240
Chemical compound	Malate	Sigma-Aldrich	240176
Chemical compound	Fumarate	Sigma-Aldrich	F1506
Chemical compound	alpha-Ketoglutarate	Sigma-Aldrich	75890
Chemical compound	cis-Aconitic acid	Sigma-Aldrich	A3412
Chemical compound	Oxaloacetate	Sigma-Aldrich	O4126
Chemical compound	Succinate	Sigma-Aldrich	S2378
Chemical compound	GABA	Sigma-Aldrich	A2129