Diversity in Notch ligand-receptor signaling interactions
- Division of Biology and Biological Engineering, California Institute of Technology, United States
- Howard Hughes Medical Institute, California Institute of Technology, United States
Figures
Figure 1 with 5 supplements
Engineered ‘receiver’ and ‘sender’ cells enable quantitative comparison of receptor-ligand interactions.
(A) Engineered cell lines enable systematic analysis of trans-activation, cis-activation, and cis-inhibition. Receiver cells contain chimeric Notch receptors (gray) composed of Notch extracellular and transmembrane domains fused with a minimal Gal4 transcription factor (Gal4) in place of the endogenous intracellular domain, co-transcribed with a T2A-H2B-mTurq2 cassette for quantitative readout of receptor expression. Receptor activation releases Gal4, which activates expression of a stably integrated UAS-H2B-mCitrine reporter (yellow). Some strains also contained a stably integrated ligand and reporter (second cartoon). These sender cell lines were constructed by integrating plasmids containing each of the four activating ligands fused to 2xFLAG, followed by T2A-H2B-mCherry for cotranslational readout of ligand expression, either under Tet-OFF control (to allow induction by 4-epiTc) or expressed from the constitutive CBh promoter. (B) Example distributions of Tet-OFF inducible ligand expression in CHO-K1 cells, read out by fluorescence of a cotranslational H2B-mCherry (A.U.). Black histograms are CHO-K1 wild-type cells (NCC = no color control). Dotted gray vertical lines mark binning windows used in some analyses (see also Methods). Data points in the gray-shaded region were omitted to avoid overexpression artifacts (see Methods). (C) Single-cell histograms (kernel density estimates) of stably expressed ligand levels (read out by cotranslational H2B-mCherry, A.U.) in the CHO-K1 sender populations used for trans-activation assay experiments. n denotes number of replicates per plot. Sender populations are named with the ligand expressed and a population identifier (e.g. ‘L4B’). (D) Schematics of the main assays used in this work. Each panel shows the cocultured cell types and their relative population sizes (majority or minority). In the cis-+trans-activation assay, dotted lines indicate alternative receptor interactions. See also Methods. Dot-and-arrow icons are used to identify assays in subsequent figures. (E) Experimental workflow for cell culture experiments with flow cytometry readout. Ligand expression is preinduced in either sender or receiver cells by reducing the 4-epi-Tc concentration in the culture medium to induce ligand expression to a given level. Receivers are incubated in the Notch signaling inhibitor DAPT to prevent reporter activation during this preinduction phase. Prepared cells, which may also undergo siRNA knockdown and/or plasmid transfection during the ligand preinduction phase, are replated without DAPT according to the chosen experimental scheme in (D) and allowed to signal for 22–24 hr before cells are detached and analyzed by flow cytometry. (F–G) Data plots show example flow cytometry data processing. Gates used in data processing are shown as dashed lines. (F) Senders and receivers are separated computationally in the flow cytometry data in a 2D plane of cell size (side scatter, A.U.) vs. cotranslational receptor expression (mTurquoise2, A.U.). (G) Plasmid-transfected cells are gated on fluorescence levels of a cotransfected infrared fluorescent protein (IFP2, A.U.). Data points in gray-shaded regions were discarded (Methods).
Figure 1—figure supplement 1
Receptor expression in CHO-K1 receiver clones.
(A) Flow cytometry of cotranslational receptor expression (mTurq2, A.U.) in Notch1 (light blue) and Notch2 (dark blue) receiver cell lines (same cell lines as Figure 4B). Expression of cis-ligands or control proteins (indicated at the top of each plot) was suppressed with maximum [4-epi-Tc]. Each receiver histogram contains pooled data from three biological replicates. Black histograms are wild-type CHO-K1 (NCC = no color control, n=18). (B) 2D fluorescence distributions of surface Notch expression (PE, A.U.) vs. cotranslational receptor expression (mTurq2, A.U.) in Notch1 and Notch2 receivers positive for mTurq2 compared with parental reporter cells (‘No Receptor’). Cells transfected with dLfng or Lfng were pooled. Each plot contains data from 20,000 cells, combined after randomly sampling 5000 cells from each of four biological replicates. Surface Notch was detected by staining with PE-conjugated antibodies (Methods). Contour interval (c) denotes the interval between successive cell density contours, and cell density in each discrete contour interval is indicated by color. The density interval below c is not shown. Pearson’s correlation coefficient r is shown in the top left of each plot, and all p-values were <<0.001.
Figure 1—figure supplement 2
The Tet-OFF system enables unimodal titration of ligand levels in receiver cells.
Distributions of cotranslational cis-ligand expression (mCherry, A.U.) in the receiver cell lines used to generate data in Figure 4. Each histogram contains data from three biological replicates corresponding to a specific 4-epi-Tc concentration ranging from 0 to 500 ng/mL (Supplementary file 2). Black histograms are CHO-K1 wild-type cells (NCC = no color control). Vertical dashed lines indicate mCherry bins used to generate dose-response curves elsewhere (Methods). Data points in the gray-shaded region were discarded due to overexpression artifacts at high levels.
Figure 1—figure supplement 3
The Tet-OFF system enables stable ligand expression in sender cells.
(A) Distributions of cotranslational ligand expression (mCherry, A.U.) in Tet-OFF sender cell lines expressing each of the four activating Notch ligands, tuned to different expression levels via titration of 4-epi-Tc concentration. Each histogram contains data from three biological replicates. Black histograms are wild-type CHO-K1 (NCC = no color control). (B) mRNA expression from the Tet-OFF promoter reaches stable levels after 24–48 hr. CHO-K1 senders with integrated Dll1 (yellow) or Dll4 (orange) ligands driven by the Tet-OFF promoter were induced to express ligand by reducing [4-epi-Tc] in the culture medium at time zero. Y-axis values are 2-ΔCq values quantifying mCherry transcript levels at the indicated time of cell harvest (x-axis) relative to the housekeeping gene beta-actin, normalized to the average of all data points after 36 hr for each ligand individually. Three biological replicates were collected for each cell type and time point.
Figure 1—figure supplement 4
Knockdown of endogenous Lfng and Rfng in CHO-K1 cells.
(A) qRT-PCR analysis of wild-type CHO-K1 Lfng and Rfng transcripts from cells treated with either a negative control siRNA, Rfng siRNA, Lfng siRNA, or Rfng and Lfng siRNAs together. The siRNA used is indicated by marker shape as shown in the legend while each column corresponds to an mRNA transcript assayed by qRT-PCR: Lfng (left) and Rfng (right). Y-axis values are 2-ΔCq values (computed using beta-actin as a housekeeping gene) normalized to the expression level in the negative control knockdown for each gene. Black bars are the mean of three biological replicates. (B) Log2 fold difference in the amount of surface Notch detected by staining with PE-conjugated antibodies (median PE fluorescence [A.U.]) from single-cell flow cytometry data in different Fringe expression conditions relative to Notch levels with dLfng expression (normalized within each bioreplicate). X-axis labels indicate whether data were gated on the cotransfection marker, IFP2 (Figure 1G, Methods). Notch1 fold differences are significantly greater than 1 (p-val<0.05) according to permutation testing with 10,000 bootstrap replicates (Methods). Horizontal bars are mean of four biological replicates.
Figure 1—figure supplement 5
Normalizing reporter activity to receptor expression addresses spurious dependence of signal on cis-ligand controls.
Data from negative control cis-activation assays for CHO-K1 Notch1 (black) and Notch2 (green) receivers coexpressing a control protein (H2B-mCherry, left column; nerve growth factor receptor [NGFR]-T2A-H2B-mCherry, right column) at different levels, corresponding to a range of 4-epi-Tc concentrations. Individual receivers were sorted into discrete bins of mCherry (Figure 1B, Methods). X- and y-axis values were averaged across all cells in each mCherry bin (Figure 1B). Y-axis values were further normalized to the mean signal in the lowest mCherry bin. Lines are interpolated through the mean of three biological replicates (individual data points).
Figure 2 with 4 supplements
Trans-activation properties depend on ligand and receptor identity, and are modulated by Lfng.
(A) Mean trans-activation signaling strength for different ligand-receptor-Lfng combinations. In each case, expression of the mCitrine reporter was normalized by the cotranslational Notch reporter (mTurq2) fluorescence. These values were averaged across all single cells in each sample, then background subtracted and further normalized by the strongest signaling activity measured for each receiver clone in the experiment. Normalized signaling activities for sub-saturated data points (Methods) were further normalized to the mean expression of the sender population (Figure 1C) in each coculture (Methods), and values are relative to the overall maximum. Data are from five different Notch1 receiver clones and three different Notch2 clones, with at least three biological replicates per clone (Supplementary file 3). Cis-ligand was suppressed with high 4-epi-Tc concentrations in receivers with integrated ligands. The significance of pairwise differences in normalized signaling activity was evaluated through permutation testing (see Methods). Except where labeled with ‘n.s.’, all signaling strengths within each subplot are significantly different (p-val<0.05) from all other receptor-ligand combinations within the same Lfng or dLfng condition. See Figure 2—figure supplement 1B for more granular analysis of p-values. Colors indicate the identity of the trans-ligand expressed by cocultured sender cells. Receptor identity is indicated below plot and by marker type (Notch1=circles, Notch2=triangles). Here and in subsequent panels, error bars denote bootstrapped 95% confidence intervals (Methods), in this case sampled from the number of bioreplicates given in the legend—n1 (for Notch1) or n2 (for Notch2). (B) Effects of Lfng on Notch1 (left) and Notch2 (right) signaling. Non-ligand-normalized signaling activities were re-plotted in dLfng (x-axis) vs. Lfng (y-axis) conditions. Saturated data points, defined here as those with normalized signaling activity over 0.75 in both dLfng and Lfng conditions, were excluded. Colored lines are least-squares linear fits. Black dashed line indicates no effect of Lfng expression. (C) Plotting the mean slope in (B) from bootstrap analysis reveals the effects of Lfng on trans-signaling for the indicated ligand-receptor combinations (Methods). Asterisks denote the p-value of the test statistic from a one-sided Wilcoxon signed-rank test (*p-val<0.05; **p-val<0.01; ***p-val<0.001), reflecting whether the slope is greater or less than 1. Receiver identity is indicated by x-axis labels and marker type. Ligand identity is indicated by color and the following abbreviations, which are used here and in subsequent figures: D1=Dll1, D4=Dll4, J1=Jag1, J2=Jag2. (D) Trans-activation dose-response curves for CHO-K1 Notch1 or Notch2 receivers, expressing endogenous Fringes activated by a cocultured majority of the Tet-OFF inducible sender cell lines shown in Figure 1—figure supplement 3A. Colors indicate ligand identity as in (C). X-axis values are the mean of the mCherry fluorescence in senders used for each coculture sample data point. Y-axis signaling activity values are the mean of the distribution in mCitrine (reporter activity, A.U.) divided by mTurq2 (cotranslational receptor expression, A.U.). Solid lines are fits of the increasing phase of each dataset to activating Hill functions (Methods). Dotted gray horizontal lines represent half-maximal signaling activity for each receptor across all ligand inputs. (E) Mean saturating signaling activities for indicated ligand-receptor combination, estimated by bootstrapping the Hill fits in (D), and normalized by the response to Jag2 for the same receptor. Although the decreasing phases of the Dll1 curves were excluded, saturating activity estimates may be influenced by incomplete saturation and biphasic behavior. (F) Mean logarithmic sensitivities of signaling response to ligand expression from bootstrapped linear regressions to log-log transformed, sub-saturating data points (see also Figure 2—figure supplement 3). (G) Mean Hill coefficients (n) estimated from bootstrap analysis of apparently saturating ligand-receptor responses in (D). (H) Relative signaling strength (ligand potency) was computed by estimating the ligand expression level sufficient to reach threshold activity level (where Hill fits crossed dotted lines in 2D) for each ligand-receptor combination, inverting it, and further normalizing all values by the value obtained for Jag2-Notch2. Mean values and 95% confidence intervals were computed from bootstrapped Hill function fitting (Methods). (I) Comparison of signaling strengths for Notch2 vs. Notch1 receivers in the dLfng, Lfng, and endogenous Fringe (enFng) backgrounds. dLfng and Lfng data are identical to values plotted in (A), and enFng values are identical to values plotted in (H), but scaled such that Dll4-Notch1 signaling strengths match in dLfng and enFng (based on Figure 2—figure supplement 4B).
Figure 2—figure supplement 1
Statistical analysis of differences in trans-activation strength for all receptor-ligand-Fringe combinations.
(A) Normalized trans-activation signaling activities for different ligand-receptor-Lfng combinations either further normalized by ligand expression (lower row) or without further normalization (upper row). Normalized signaling activity is defined as reporter activity (mCitrine, A.U.) divided by cotranslational receptor expression (mTurq2, A.U.), normalized to the strongest bioreplicate-averaged signaling activity across all ligand-receptor-Lfng combinations in the same experiment. Saturated data points, defined here as those with normalized signaling activity over 0.75 in both dLfng and Lfng conditions, were excluded. Figure 2A shows the summary statistics for the ligand-adjusted signaling activity (lower row). Colors indicate the identity of the trans-ligand expressed by cocultured sender cells. Error bars denote bootstrapped 95% confidence intervals (Methods), in this case sampled from the number of bioreplicates given in the legend—n1 (for Notch1) or n2 (for Notch2). See Methods and Figure 2A caption for more details. (B) A matrix of p-values computed by comparing the relative strengths of 64 receptor-ligand-Fringe combinations from data in Figure 2A. For each matrix entry (row, column), the p-value was computed from testing the alternative hypothesis that the Notch combination in the column came from a distribution with a lower mean than the Notch combination in the corresponding row. Thus, dark squares indicate that the Notch combination labeling its column is likely to signal more strongly than the Notch combination labeling its row. p-Values were computed via permutation testing with 10,000 bootstrap replicates (Methods).
Figure 2—figure supplement 2
Quantification of surface ligand in CHO-K1 sender clones.
(A) Single-cell histograms (kernel density estimates) of stably expressed cotranslational ligand expression (mCherry, A.U.), measured by flow cytometry, in the CHO-K1 sender clones assessed for surface ligand expression in (B). Each plot has only one bioreplicate. Sender populations are labeled with the ligand expressed and a clone identification number (e.g. ‘2F10’). (B) Western blot of Dll1, Dll4, or Jag1 ligands in CHO-K1 senders following surface protein biotinylation and isolation (except for ‘wt - cyto’, which is the cytoplasmic fraction control). These FLAG-tagged ligands were detected with an anti-FLAG antibody. GAPDH and NAK ATPase were measured as cytoplasmic fraction and surface fraction marker proteins, respectively. No duplicate was performed. Note that surface protein isolation may be sensitive to the number of primary amines available for biotinylation, possibly explaining why Dll4 is lowest (fewest lysines) and Jag1 is highest (most lysines). See Methods section, ‘Surface ligand isolation and quantification’, for details.
-
Figure 2—figure supplement 2—source data 1
Original files for western blots displayed in Figure 2—figure supplement 2B.
- https://cdn.elifesciences.org/articles/91422/elife-91422-fig2-figsupp2-data1-v1.zip
-
Figure 2—figure supplement 2—source data 2
PDF file containing original western blots for Figure 2—figure supplement 2B, indicating the relevant bands and sizes.
- https://cdn.elifesciences.org/articles/91422/elife-91422-fig2-figsupp2-data2-v1.zip
Figure 2—figure supplement 3
Notch trans-activation in coculture is modestly ultrasensitive.
Linear regressions to log-log dose-response curves from Figure 2D (trans-activation assay), in the sub-saturating range (Methods). X-axis values are the mean of the mCherry fluorescence in the sender cells. Y-axis values are the mean signaling activity, mCitrine (reporter activity, A.U.) divided by mTurq2 (cotranslational receptor expression, A.U.), in receiver cells cocultured with the senders.
Figure 2—figure supplement 4
Endogenous Lfng activity dominates over Rfng in CHO-K1 cells.
(A) Comparison of ligand-receptor signaling strengths in a trans-activation assay with CHO-K1 Notch1 and Notch2 receivers expressing endogenous CHO-K1 Fringes (‘enFng’), dLfng, or Lfng (see Methods). Sender populations used in each coculture are given on the x-axis. For ligand expression distributions, see Supplementary file 3 and Figure 1C. Y-axis signaling activity values are reporter activity (mCitrine, A.U.) divided by cotranslational receptor expression (mTurq2, A.U.), averaged across receivers, background subtracted, and normalized to the strongest signaling activity measured for each receiver clone in this experiment. Black bars are the mean of three biological replicates. (B) Sub-saturating signaling activities from (A) were further normalized to the mean expression of the sender population (Figure 1C) cocultured with each receiver as in Figure 2A (Methods). The ligand-normalized signaling activities were normalized for each receiver such that the bioreplicate mean of each ligand’s strongest Fringe condition is equal to 1. Black bars are mean and 95% confidence intervals from 10,000 bootstrap replicates.
Figure 3 with 1 supplement
Signaling properties of recombinant ligands.
(A) Plated ligand assay records Notch receivers’ responses to plated recombinant human C-terminal Fc-tagged ligand extracellular domains (‘ligand-ext-Fc’) (schematic). Blue in the cell nucleus represents H2B-mTurq2 fluorescence (readout of receptor expression), and the yellow construct represents the mCitrine reporter promoter. Line-dot-and-arrow icon refers to this assay. (B) CHO-K1 Notch1 (left) and Notch2 (right) receivers expressing endogenous Fringes were cocultured on plated recombinant ligand-ext-Fc proteins at the concentrations indicated on the x-axis. Y-axis signaling activity values are the mean of mCitrine reporter distributions (reporter activity, A.U.) divided by mTurq2 (cotranslational receptor expression, A.U.). Solid lines are activating Hill function fits, with free Hill coefficient (n) and EC50 parameters. Saturating activities were fixed since the curves did not fully saturate in these ligand concentration regimes (Methods). Dotted gray horizontal lines represent the signaling thresholds defined in Figure 2D. (C) Mean signaling strengths, based on bootstrap analysis of the responses in (D) (Methods). Each signaling strength is defined as the inverse of the ligand concentration sufficient to reach threshold activity level (dotted lines in (B)), normalized to show receptors’ relative activities. Colors and labels indicate ligand identity, as in Figure 2. X-axis labels are receivers; ‘N’ = ‘Notch.’ Here and in subsequent panels, error bars denote bootstrap 95% confidence intervals (Methods). (D) Comparison of mean Notch2/Notch1 signaling strength ratios with canonical trans-activation in sender-receiver cell cocultures (y-axis, values from Figure 2H) vs. the plated ligand assay (x-axis, values from (C)). (E) Mean logarithmic sensitivities computed from the slope of linear regressions to 10,000 bootstrap replicates of log-log sub-saturating signaling activities vs. ligand concentrations in Figure 3—figure supplement 1. (F) Soluble ligand binding assay (schematic, see also Methods), which enables the quantification of the strength of receptor binding to ligand-ext-Fc pre-clustered with secondary antibody. Blue in the cell nucleus represents H2B-mTurq2 fluorescence (readout of receptor expression). Star-dot-and-arrow icon refers to this specific assay. (G) Scatterplot of averaged single-cell data from the soluble ligand binding assay with Lfng (y-axis) vs. dLfng (x-axis) expression (Methods). Fluorescence background, determined as ligand bound to parental reporter cells with no ectopic Notch receptors, was subtracted, and negative values were set to zero. Solid lines are least-squares best fits, and the black dashed line is y=x. (H) Mean fold difference in the amount of each ligand bound to Notch1 with Lfng vs. dLfng from slopes of linear regressions in (G), based on bootstrap analysis of n=4 biological replicates per ligand. X-axis labels are recombinant ligands. (I) Normalized Notch signaling strength in CHO-K1 Notch1 receivers expressing Lfng or dLfng, plated on Dll1-ext-Fc (yellow) or Jag1-ext-Fc (purple) in a plated ligand assay (Methods). X- and y-axis values represent mean signaling activity (reporter activity, mCitrine, divided by cotranslational receptor expression, mTurq2), background subtracted and normalized to the maximum signaling activity—the average signal in the same receiver (+Lfng) plated on a high concentration of Dll4-ext-Fc. Solid lines are the least-squares best fits to six data points, representing three biological replicates for each of two plated ligand concentrations. Both slopes were significantly greater than or less than 1 according to a one-sided Wilcoxon signed-rank test (p-value = 0.015 for both lines). The black dashed line is y=x. Bracketed numbers are bootstrap 95% confidence intervals. (J) Cell schematic depicting the effects of Lfng expression on Jag1 and Dll1 interactions with the Notch1 receptor. White triangles represent glycosylation modifications added by Lfng, and yellow saturation level in cell nuclei represents signaling activity.
Figure 3—figure supplement 1
Notch activation by plated ligands is not ultrasensitive.
Linear regressions to log-log dose-response curves from Figure 3B (plated ligand assay), in the sub-saturating range. Y-axis signaling activity values are the mean of the distribution of mCitrine (reporter activity, A.U.) divided by mTurq2 (cotranslational receptor expression, A.U.).
Figure 4 with 2 supplements
Cis-interaction outcomes depend on receptor and ligand identity.
(A) The cell density used in the cis-activation assay prevents intercellular signaling (Methods). The legend indicates the number of pure sender and pure receiver cells plated along with an excess of wild-type CHO-K1 cells in each condition tested (e.g. ‘2.5k ea. senders & rec.’=2.5k senders+2.5k receivers). k indicates a multiplier of 1000. Normalized signaling activity (mCitrine/mTurq2) was averaged across all cells in each sample and then min-max normalized (Methods). Black bars represent the mean of three biological repeats. (B) Data from cis-activation (left column) and cis-modulation (right column) assays for CHO-K1 Notch1 (top row) and Notch2 (bottom row) receivers coexpressing a Notch ligand or control protein at different levels, corresponding to a range of 4-epi-Tc concentrations (see distributions in Figure 1—figure supplement 2). Individual receivers were sorted into discrete bins of mCherry (Figure 1B, Methods). The signaling activity (y-axis, defined in (A)) and cotranslational ligand expression (x-axis, mCherry (A.U.)) signals were averaged across all cells in each mCherry bin (Figure 1B). For each receptor, y-axis signaling activity was min-max normalized using the trans-signaling response to high-Dll1 senders in the cis-modulation assay (Methods, Supplementary file 3). Lines are interpolated through the mean of three biological replicates (individual data points). (C) Experimental workflow to assess the contribution of intercellular signaling during the 48 hr preinduction phase (from –72 to –24 hr) to the overall signal measured in the cis-activation assay at 0 hr (schematic). Cells were preinduced and cultured either sparsely or densely before setting up a cis-activation assay (Methods). NEXT denotes the Notch extracellular truncation, generated during the preinduction phase if cell density enables intercellular ligand-receptor interactions. Red and blue colors in cell nuclei represent H2B-mCherry and H2B-mTurq2, cotranslational reporters of cis-ligand (black) and receptor (gray) expression, respectively. Gamma-secretase is represented by the scissors. (D) 2D fluorescence distributions of signaling activity (mCitrine/mTurq2) vs. cis-ligand expression (mCherry) in single-cell fluorescence distributions measured by flow cytometry according to the experiment in (C) performed with Notch2-Dll1 and -Dll4 receiver cells. c denotes the interval between successive cell density contours, and cell density in each discrete contour interval is indicated by color. The density interval below c is not shown. Pearson’s correlation coefficient r is shown in the top left of each plot, and all p-values were <<0.001.
Figure 4—figure supplement 1
CHO-K1 receiver clones’ reporter dynamic ranges with minimum cis-ligand expression.
Histograms of reporter activity (mCitrine, A.U.) in the indicated receiver cells with minimum cis-ligand (maximum [4-epi-Tc]), cocultured with wild-type CHO-K1 cells (sender = ‘None’) or high-Dll1 CHO-K1 senders. Each receiver histogram includes pooled data from three biological replicates. Dark histograms represent non-fluorescent controls.
Figure 4—figure supplement 2
Cell density can affect expression from the Tet-OFF promoter.
Cell density can affect Tet-OFF controlled ligand expression. 25,000 CHO-K1 Dll1 or Dll4 sender cells were cultured at three different densities and induced to maximal ligand expression by removing 4-epi-Tc from the culture medium (Methods). Cells were collected 72 hr later and RNA expression was analyzed by qRT-PCR. Y-axis values were computed as in Figure 1—figure supplement 3B, except here they were normalized to transcript levels in the ‘low’ density condition. Horizontal bars are the mean of three biological replicates.
Figure 5 with 5 supplements
Coexpression of ligands and receptors can produce cis- or trans-signaling in confluent monoculture.
(A) Results of cis-activation (black) and cis-+trans-activation (red) assays for CHO-K1 Notch1 (top row) and Notch2 (bottom row) receivers coexpressing a Notch ligand at different levels. Ligand expression was varied by titrating 4-epi-Tc concentration (see distributions in Figure 5—figure supplement 1). X- and y-axis values respectively represent cis-ligand expression (mCherry, A.U.) and min-max normalized, mean Notch signaling activity (mCitrine/mTurq2) of all cells in a given mCherry bin (Methods, Supplementary file 3). Y-axis values thus reflect signaling strengths relative to strong trans-signaling. Lines are interpolated through the mean of seven biological replicates in each mCherry bin. Error bars are bootstrapped 95% confidence intervals. (B–C) Fold differences in signaling between the cis-+trans-activation assay vs. the cis-activation assay (B) and between Lfng and dLfng conditions (C). Values are means and 95% confidence intervals of the slopes computed from linear regressions to 10,000 bootstrap replicates of paired signaling activities from the two assay types (see scatterplots with linear regressions for (B) in Figure 5—figure supplement 3 and for (C) in Figure 5—figure supplement 5). Asterisks denote the p-value of the test statistic from a one-sided Wilcoxon signed-rank test (*p-val<0.05; **p-val<0.01; ***p-val<0.001), reflecting whether the slope is greater or lesser than 1. Fold differences could not be computed for ligand-receptor combinations with background-level signaling in one or both axis coordinates. (D) Comparison of Fringe effects on cis-activation (y-axis, mean values, and confidence intervals from (C)) vs. trans-activation (x-axis, mean values and confidence intervals from Figure 2C).
Figure 5—figure supplement 1
CHO-K1 receiver clones’ cis-ligand expression distributions for the cis-activation assay and cis-+trans-activation assay.
Distributions of cotranslational cis-ligand expression (mCherry, A.U.) corresponding to receivers used to generate data in Figure 5A. Each histogram corresponds to a specific 4-epi-Tc concentration ranging from 0 to 500 ng/mL, and includes data from the indicated number of biological replicates (n). Black histograms are CHO-K1 wild-type cells (NCC = no color control). To generate Figure 5A curves, receiver cells were binned into discrete intervals of mCherry expression indicated by the vertical dashed lines. Data points in the gray-shaded region were discarded to avoid overexpression artifacts (Methods).
Figure 5—figure supplement 2
Flow cytometry data analysis pipeline without mCherry binning yields similar results.
Results of cis-activation (black) and cis-+trans-activation (red) assays for CHO-K1 Notch1 (top row) and Notch2 (bottom row) receivers coexpressing a Notch ligand at different levels corresponding to a range of 4-epi-Tc concentrations. These are the same data shown in Figure 5A, but instead of averaging fluorescence distributions across cells binned into different mCherry levels, distributions were averaged across all cells corresponding to the same 4-epi-Tc concentration. Line type denotes expression of dLfng (solid) or Lfng (dashed). Y-axis values are min-max normalized average signaling activities (mCitrine [reporter activity, A.U.] divided by mTurq2 [cotranslational receptor expression, A.U.]). Lines connect means of seven biological replicates in each mCherry bin. Error bars are 95% confidence intervals on the mean value across 10,000 bootstrap replicates.
Figure 5—figure supplement 3
Allowing intercellular contacts between cells coexpressing ligands and receptors alters signaling activity.
Scatterplots comparing normalized signaling activities in the cis-+trans-activation assay (y-axis) with those in the cis-activation assay (x-axis) for receivers expressing dLfng (top row) or Lfng (bottom row). Normalized signaling activities are identical to those in Figure 5A but include only the increasing phase for biphasic curves. Signaling activities below a signaling threshold of 0.05 were also excluded. Ligand-receptor combinations with fewer than five data points above the minimum signaling threshold were omitted. Each plot contains curves for one receptor and both cis-ligands of the same class (Delta or Jagged), and color indicates the cis-ligand for each curve. Solid lines are least-squares best fits, and the black dashed line is y=x. See bootstrapped slope estimates in Figure 5B.
Figure 5—figure supplement 4
CHO-K1 receiver clones’ reporter dynamic ranges with minimum cis-ligand expression.
Histograms of reporter activity (mCitrine, A.U.) in the indicated receiver cells with minimum cis-ligand (maximum [4-epi-Tc]), transfected with Lfng and cultured with either wild-type CHO-K1 cells (sender = ‘None’; n=7 biological replicates per receiver) or high-Dll1 or -Dll4 senders (for Notch2 and Notch1, respectively; n=4 biological replicates per receiver). Each receiver histogram includes pooled data from all replicates. The averages of these distributions with CHO-K1 or Delta senders were used for background subtraction or y-axis normalization, respectively, in Figure 5A. Black histograms are CHO-K1 wild-type cells only (NCC = no color control).
Figure 5—figure supplement 5
Lfng effects on cis-activation and cis-+trans-activation.
Scatterplots comparing normalized signaling activities in receivers expressing Lfng (y-axis) vs. dLfng (x-axis) in the cis-activation assay (top row) and cis-+trans-activation assay (bottom row). Normalized signaling activities are identical to those in Figure 5A but include only the increasing phase for biphasic curves. Signaling activities below a signaling threshold of 0.05 were also excluded. Ligand-receptor combinations with fewer than five data points above the minimum signaling threshold were omitted. Each plot contains curves for one receptor and both cis-ligands of the same class (Delta or Jagged), and color indicates the cis-ligand for each curve. Solid lines are least-squares best fits, and the black dashed line is y=x. See bootstrapped slope estimates in Figure 5C.
Figure 6 with 1 supplement
Cis-inhibition strengths depend on the identities of the receptor, the cis-ligand, and the trans-ligand.
(A) Results of cis-modulation assays for CHO-K1 Notch1 (top row) and Notch2 (bottom row) receivers with endogenous Fringes, coexpressing cis-ligands at different levels corresponding to a range of 4-epi-Tc concentrations (Supplementary file 2). Columns are cis-ligands, and colors indicate the ligand expressed by the cocultured sender cells (Figure 6—figure supplement 1A and B; Supplementary file 3). X- and y-axis values are flow cytometry fluorescence values averaged across all cells in a given mCherry bin (Figure 1B). The x-axis represents cis-ligand expression (mCherry, A.U.) relative to cotranslational receptor expression (mTurq2, A.U.); see also Methods. Y-axis values are Notch signaling activity (reporter activity [mCitrine, A.U.] divided by cotranslational receptor expression [mTurq2, A.U.]). For each bioreplicate curve, signaling activity was normalized to maximum trans-signaling, at the y-value with minimum cis-ligand (Figure 6—figure supplement 1C). Cis-inhibition of Jag1-Notch1 signaling could not be analyzed because trans-activation was too weak. For Notch2-Delta receivers, lines connect means of three biological replicates in each mCherry bin along the x-axis. For other receivers, curves are fits of three biological replicates to a repressive Hill function with maximum y=1 (Methods). (B) Mean cis-inhibition strengths based on bootstrap analysis of repressive Hill fits in (A). Cis-inhibition strength is defined as the inverse of the fit EC50 parameter, relative to the minimum value across all combinations. (C) Comparison of cis-inhibition strengths (y-axis, mean values and confidence intervals from (B) with Dll1 senders rescaled such that the maximum value over all ligand-receptor combinations equals 1) vs. trans-activation strengths with endogenous Fringes (x-axis, mean values and confidence intervals from Figure 2H). Cis-inhibition strength was set to zero for Delta-Notch2 combinations. (D) Cis-inhibition efficiencies and confidence intervals from (B) adjusted for the strength of trans-signaling induced by the indicated sender cells (Figure 6—figure supplement 1C), and normalized such that the maximum cis-inhibition strength is equal to 1 for each cis-ligand-receptor combination. Error bars reflect uncertainty on cis-inhibition efficiency only (trans-activation error bars were not propagated). (E) Hill coefficients (n) computed from fits of data in (A) to repressive Hill functions. Hill coefficients could not be computed for Notch1-Dll4 receivers with Dll4 or Jag2 senders because of the modest cis-activation observed at intermediate cis-ligand levels for those combinations. Values are means and 95% confidence intervals from bootstrap analysis.
Figure 6—figure supplement 1
Ligands’ trans-activation strengths show greater diversity for Notch1 than Notch2.
(A) Single-cell distributions of cotranslational ligand expression (mCherry, A.U.) in the CHO-K1 sender populations used for this figure. Each histogram is a biological replicate, with a total of n replicates per plot. (B) Mean cotranslational ligand expression (mCherry, A.U.) computed from histograms in (A). Black bars are the mean and 95% confidence intervals across 10,000 bootstrap replicates. (C) Normalized signaling activity in receiver cells cultured with excess senders (A, B) in a trans-activation assay in the absence of cis-ligand expression (at maximum 4-epi-Tc). Cis-ligand is indicated on the x-axis, and colors denote the ligand expressed by the sender cells cultured in excess with a minority of receivers for a given data point. Normalized signaling activity is defined as reporter activity (mCitrine, A.U.) divided by cotranslational receptor expression (mTurq2, A.U.), normalized to the strongest signaling activity measured for each receiver clone in this experiment (average of three bioreplicates).
Figure 7 with 1 supplement
Similar ligand-receptor signaling features occur in CHO-K1 and C2C12-Nkd cells.
(A) Normalized Notch signaling strength in C2C12-Nkd Notch1 (black) or Notch2 (green) receivers cultured with Jag1 (y-axis) vs. Dll1 (x-axis) senders in a trans-activation assay. Receivers were treated with negative control (unfilled markers) or mouse Rfng (filled markers) siRNAs prior to the assay. X and y-axis values are mean signaling activity (reporter activity, mCitrine, divided by cotranslational receptor expression, mTurq2), background subtracted and normalized to the average signal in Dll1 coculture with negative control siRNA treatment for each receiver. Solid lines are the least-squares best fit through all points for a given receiver (pooling control and Rfng siRNA-treated samples, see Methods). Both slopes were significantly greater or less than 1 according to one-sided Wilcoxon signed-rank tests (p-val<0.05). The black dashed line is y=x. (B) The cell density used in the C2C12-Nkd cis-activation assay prevents intercellular signaling. After siRNA treatment to knock down residual endogenous Notch components (Methods), the assay was performed similarly to the assay used for CHO-K1 cells (Figure 4A), except for use of a 12-well plate. Here, y-axis values are min-max normalized, mean Notch signaling activities. Black bars are the mean of three biological repeats. (C) Results of cis-activation (left column) and cis-modulation (right column) assays for C2C12-Nkd Notch1 (top row) and Notch2 (bottom row) receivers coexpressing a Notch ligand or control protein. Fluorescence values were averaged differently for Notch1 vs. Notch2 based on responses to the nerve growth factor receptor (NGFR) control (see Methods). For both receptors, signaling activity defined in (A) was min-max normalized using the maximal trans-signaling in receivers cultured with the high-Dll4 senders (Dll4-2H10) used in the cis-modulation assay (Supplementary file 3). Lines connect means of three biological replicates (individual data points) in each mCherry bin. The bottom right plot is a zoomed-in view of the data for Notch2 receivers cultured with high-Dll4 senders, showing Jag2 cis-inhibition of Notch2 activation by Dll4 senders. (D) Comparison of cis-ligand effects in the cis-modulation assay for CHO-K1 (‘CHO’) vs. C2C12-Nkd (‘C2C12’) cell types. Y-axis units are normalized signaling activities as defined in Figure 4B for CHO-K1 cells and in (C) for C2C12-Nkd cells. (Note, maximal trans-signaling activities used in normalization differed greatly for CHO-K1 and C2C12-Nkd, so responses should be compared qualitatively, but not quantitatively (Methods).) Here, y-values are signaling activities corresponding to a cis-ligand expression level where x-axis cotranslational H2B-mCherry fluorescence equals 3×104 A.U., calculated by fitting a line between the x-axis mCherry bins flanking x=3×104 A.U. Y-values are the mean, and error bars are 95% confidence intervals, from bootstrap analysis.
Figure 7—figure supplement 1
CRISPR/Cas9 editing of C2C12 cells yields Notch-depleted clone C2C12-Nkd.
(A) Scatterplots of RNA transcript levels in RNA-sequencing (RNA-seq) data from wild-type C2C12 cells or the C2C12-Nkd (‘Notch-depleted’) clone generated in this study using CRISPR/Cas9 targeting deletion of mNotch2 and mJag1. Each data point is a transcript with a fragments per kilobase of transcript per million mapped reads (FPKM) value of ≥3 in at least one of the experimental conditions. The left scatterplot shows differences in expression between wild-type cells and the C2C12-Nkd clone with Notch signaling stimulated by plated recombinant Dll1-ext-Fc in a plated ligand assay. The right scatterplot shows the effect of Notch ligand stimulation of C2C12-Nkd by comparing expression in the +vs. - plated Dll1-ext-Fc conditions. Transcripts corresponding to key Notch pathway and target genes are colored red and labeled. (B) Western blot showing loss of endogenous Notch2 expression in CRISPR-treated C2C12 cell lines. (Left) First western blot performed. (Right) Repeat western blot to confirm the original results. The red X marks a well with no sample (signal is spill over from leftmost well). (C) RT-PCR analysis of endogenous Jag1 transcript in CRISPR-treated C2C12 cell lines. Agarose gel electrophoresis of Jag1 RT-PCR product from C2C12 wt cells and 2 CRISPR-treated cell lines, 1H10 and Nkd, shows loss of Jag1 transcript (617 bp band). No RT = ‘no reverse transcription’ control. No duplicate performed. (D) qRT-PCR of mouse Notch transcripts (labeled on x-axis) in Notch1 and Notch2 receiver cells derived from the C2C12-Nkd clone. Cells were treated with either a negative control siRNA, siRNAs against mNotch1, mNotch2, and mNotch3 (‘N1-3’), or siRNAs against all three endogenous mouse receptors and mRfng (‘N1-3, Rfng’). Y-axis values are 2-ΔCq values (computed using mSdhA as a housekeeping gene) normalized to the expression level in the negative control knockdown for each gene within each bioreplicate. Black bars are the mean of three biological replicates.
-
Figure 7—figure supplement 1—source data 1
Original files for western blots displayed in Figure 7—figure supplement 1B.
- https://cdn.elifesciences.org/articles/91422/elife-91422-fig7-figsupp1-data1-v1.zip
-
Figure 7—figure supplement 1—source data 2
PDF file containing original western blots for Figure 2—figure supplement 2B, indicating the relevant bands and sizes.
- https://cdn.elifesciences.org/articles/91422/elife-91422-fig7-figsupp1-data2-v1.zip
-
Figure 7—figure supplement 1—source data 3
Original file for RT-PCR gel image displayed in Figure 7—figure supplement 1C.
- https://cdn.elifesciences.org/articles/91422/elife-91422-fig7-figsupp1-data3-v1.zip
-
Figure 7—figure supplement 1—source data 4
PDF file containing original RT-PCR gel image for Figure 7—figure supplement 1C, indicating the relevant bands and sizes.
- https://cdn.elifesciences.org/articles/91422/elife-91422-fig7-figsupp1-data4-v1.zip
Figure 8
Each receptor-ligand combination has a unique activity profile.
(A) Schematic summary of productive signaling interactions observed here. Min-max normalized trans- and cis-activation strengths above a minimum threshold of 0.1 (Methods) are shown for all eight receptor-ligand pairs both with dLfng (black) and with Lfng (blue) expression, based on data from Figure 2A and Figure 5A (peak cis-activation). Combinations in which binding was strengthened at least 2-fold by Lfng (Figure 3H) are indicated with an asterisk. Absence of an asterisk should be interpreted as an unknown Lfng effect, rather than a lack of effect. (B) Cis-activation and cis-inhibition exhibited an inverse relationship (schematic, based on Figure 6C). Black ligands represent strong activators and white ligands represent weak activators, which are still able to bind receptors. Yellow intensity in cell nuclei represents signaling activity.
Tables
Appendix 1—key resources table
| Reagent type(species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | Notch1 | GenBank | NCBI ID: 4851 | |
| Gene (Homo sapiens) | Notch2 | GenBank | NCBI ID: 4853 | |
| Gene (Homo sapiens) | Dll1 | GenBank | NCBI ID: 28514 | |
| Gene (Homo sapiens) | Dll4 | GenBank | NCBI ID: 54567 | |
| Gene (Homo sapiens) | Jag1 | GenBank | NCBI ID: 182 | |
| Gene (Homo sapiens) | Jag2 | GenBank | NCBI ID: 3714 | |
| Gene (Homo sapiens) | NGFR | GenBank | NCBI ID: 4804 | |
| Gene (Mus musculus) | Rfng | GenBank | NCBI ID: 19719 | |
| Gene (Mus musculus) | Lfng | GenBank | NCBI ID: 16848 | |
| Cell line (Cricetulus griseus) | CHO-K1 | ATCC | Cat# CCL-61 | |
| Cell line (Cricetulus griseus) | CHO Dll1 sender L1 | Derived from CHO-K1 | CHO-K1+CBh-Dll1-2xFLAG- T2A-H2B-mCherry - Sort level 1 (high mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll1 sender L4B | Derived from CHO-K1 | CHO-K1+CBh-Dll1-2xFLAG- T2A-H2B-mCherry - Sort level 4B (low mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll1 sender L4A | Derived from CHO-K1 | CHO-K1+CBh-Dll1-2xFLAG- T2A-H2B-mCherry - Sort level 4A (low mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll1 sender L4 | Derived from CHO-K1 | CHO-K1+CBh-Dll1-2xFLAG- T2A-H2B-mCherry - Sort level 4 (medium mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll1 sender L2 | Derived from CHO-K1 | CHO-K1+CBh-Dll1-2xFLAG- T2A-H2B-mCherry - Sort level L2 (high mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll4 sender L1 | Derived from CHO-K1 | CHO-K1+CBh-Dll4-2xFLAG- T2A-H2B-mCherry - Sort level 1 (high mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll4 sender L4B | Derived from CHO-K1 | CHO-K1+CBh-Dll4-2xFLAG- T2A-H2B-mCherry - Sort level 4B (medium mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll4 sender L4 | Derived from CHO-K1 | CHO-K1+CBh-Dll4-2xFLAG- T2A-H2B-mCherry - Sort level 4 (medium mCherry) | |
| Cell line (Cricetulus griseus) | CHO Dll4 sender L2 | Derived from CHO-K1 | CHO-K1+CBh-Dll4-2xFLAG- T2A-H2B-mCherry - Sort level 2 (medium mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag1 sender L1 | Derived from CHO-K1 | CHO-K1+CBh-Jag1-2xFLAG-T2A-H2B-mCherry - Sort level 1 (high mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag1 sender L2 | Derived from CHO-K1 | CHO-K1+CBh-Jag1-2xFLAG-T2A-H2B-mCherry - Sort level 2 (medium mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag1 sender L3 | Derived from CHO-K1 | CHO-K1+CBh-Jag1-2xFLAG-T2A-H2B-mCherry - Sort level 3 (low mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag2 sender A | Derived from CHO-K1 | CHO-K1+CBh-Jag2-2xFLAG-T2A-H2B-mCherry - Sort level A (high mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag2 sender AB | Derived from CHO-K1 | CHO-K1+CBh-Jag2-2xFLAG-T2A-H2B-mCherry - Sort level AB (medium mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag2 sender AA | Derived from CHO-K1 | CHO-K1+CBh-Jag2-2xFLAG-T2A-H2B-mCherry - Sort level AA (high mCherry) | |
| Cell line (Cricetulus griseus) | CHO Jag2 sender B | Derived from CHO-K1 | CHO-K1+CBh-Jag2-2xFLAG-T2A-H2B-mCherry - Sort level B (low mCherry) | |
| Cell line (Cricetulus griseus) | CHO Tet-OFF Dll1 sender G1 | Derived from CHO-K1 | CHO-K1+Tet-OFF Dll1-2xFLAG-T2A-H2B- mCherry G1 | |
| Cell line (Cricetulus griseus) | CHO Tet-OFF Dll4 sender 2D6 | Derived from CHO-K1 | CHO-K1+Tet-OFF Dll4-2xFLAG-T2A-H2B- mCherry 2D6 | |
| Cell line (Cricetulus griseus) | CHO Tet-OFF Jag1 sender 1G3 | Derived from CHO-K1 | CHO-K1+Tet-OFF Jag1-2xFLAG-T2A-H2B- mCherry 1G3 | |
| Cell line (Cricetulus griseus) | CHO Tet-OFF Jag2 sender 1H6 | Derived from CHO-K1 | CHO-K1+Tet-OFF Jag2-2xFLAG-T2A-H2B- mCherry 1H6 | |
| Cell line (Cricetulus griseus) | CHO reporter | Derived from CHO-K1 | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4 H1 | |
| Cell line (Cricetulus griseus) | CHO N1 receiver 2D1 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+PB-PGK-N1ECD-Gal4esn- T2A-H2B-mTurq2 2-D1 | |
| Cell line (Cricetulus griseus) | CHO N2 receiver 2A4 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+PB-PGK-N2ECD-Gal4esn- T2A-H2B-mTurq2 2-A4 | |
| Cell line (Cricetulus griseus) | CHO N1-Tet-OFF Dll1 2G5 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Dll1-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 2-G5 | |
| Cell line (Cricetulus griseus) | CHO N1-Tet-OFF Dll4 1G11 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Dll4-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 1-G11 | |
| Cell line (Cricetulus griseus) | CHO N1-Tet-OFF Jag1 1E2 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag1-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn-T2A-H2B-mTurq2 1-E2 | |
| Cell line (Cricetulus griseus) | CHO N1-Tet-OFF Jag2 2E10 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag2-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 2-E10 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF Dll1 1C4 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Dll1-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 1-C4 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF Dll4 1B8 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Dll4-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 1-B8 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF Jag1 2B8 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag1-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 2-B8 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF Jag1 2B7 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag1-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 2-B7 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF Jag2 1A1 | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag2-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 1-A1 | |
| Cell line (Cricetulus griseus) | CHO N1-Tet-OFF H2B-mCherry | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF H2B-mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 F4 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF H2B-mCherry | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF H2B-mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 G2 | |
| Cell line (Cricetulus griseus) | CHO N1-Tet-OFF NGFR-T2A- H2B-mCherry | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF NGFR-T2A-H2B-mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 2-A6 | |
| Cell line (Cricetulus griseus) | CHO N2-Tet-OFF NGFR-T2A- H2B-mCherry | Derived from CHO reporter | CHO-K1+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF NGFR-T2A-H2B-mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 1-H4 | |
| Cell line (Cricetulus griseus) | CHO Dll1 sender 2F10 | Derived from CHO-K1 | CHO-K1+PGK-Dll1-2xFLAG-T2A-H2B-mCherry 2F10 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll1 sender 2D12 | Derived from CHO-K1 | CHO-K1+PGK-Dll1-2xFLAG-T2A-H2B-mCherry 2D12 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll1 sender 1D12 | Derived from CHO-K1 | CHO-K1+PGK-Dll1-2xFLAG-T2A-H2B-mCherry 1D12 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll1 sender 1G1 | Derived from CHO-K1 | CHO-K1+PGK-Dll1-2xFLAG-T2A-H2B-mCherry 1G1 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll1 sender 2A10 | Derived from CHO-K1 | CHO-K1+PGK-Dll1-2xFLAG-T2A-H2B-mCherry 2A10 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll4 sender 1B9 | Derived from CHO-K1 | CHO-K1+PGK-Dll4-2xFLAG-T2A-H2B-mCherry 1B9 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll4 sender 1D12 | Derived from CHO-K1 | CHO-K1+PGK-Dll4-2xFLAG-T2A-H2B-mCherry 1D12 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll4 sender 2E5 | Derived from CHO-K1 | CHO-K1+PGK-Dll4-2xFLAG-T2A-H2B-mCherry 22E5F10 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Dll4 sender 1B7 | Derived from CHO-K1 | CHO-K1+PGK-Dll4-2xFLAG-T2A-H2B-mCherry 1B7 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Jag1 sender 2E3 | Derived from CHO-K1 | CHO-K1+PGK-Jag1-2xFLAG-T2A-H2B-mCherry 2E3 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Jag1 sender 1H11 | Derived from CHO-K1 | CHO-K1+PGK-Jag1-2xFLAG-T2A-H2B-mCherry 1H11 | Used for surface ligand quantification only |
| Cell line (Cricetulus griseus) | CHO Jag1 sender 1A6 | Derived from CHO-K1 | CHO-K1+PGK-Jag1-2xFLAG-T2A-H2B-mCherry 1A6 | Used for surface ligand quantification only |
| Cell line (Mus musculus) | C2C12 | ATCC | Cat# CRL-1772 | |
| Cell line (Mus musculus) | C2C12-Nkd | Derived from C2C12 | C2C12 with N2 and Jag1 CRISPR knockout | |
| Cell line (Mus musculus) | C2C12 reporter | Derived from C2C12-Nkd | C2C12-Nkd+2xHS4-UAS-H2B-Citrine- 2xHS4 B5 | |
| Cell line (Mus musculus) | C2C12 N1 receiver | Derived from C2C12 reporter | C2C12-Nkd+2xHS4-UAS-H2B-Citrine –2xHS4+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 1-A5 | |
| Cell line (Mus musculus) | C2C12 N2 receiver | Derived from C2C12 reporter | C2C12-Nkd+2xHS4-UAS-H2B-Citrine –2xHS4+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 c24 | |
| Cell line (Mus musculus) | C2C12 Dll1 sender c19 | Derived from C2C12-Nkd | C2C12-Nkd+CBh-Dll1-2xFLAG-T2A- H2B-mCherry c19 (high mCherry) | |
| Cell line (Mus musculus) | C2C12 Dll4 sender 2-H10 | Derived from C2C12-Nkd | C2C12-Nkd+CBh-Dll4-2xFLAG-T2A- H2B-mCherry 2-H10 (high mCherry) | |
| Cell line (Mus musculus) | C2C12 Jag1 sender c11 | Derived from C2C12-Nkd | C2C12-Nkd+CBh-Jag1-2xFLAG-T2A- H2B-mCherry c11 (high mCherry) | |
| Cell line (Mus musculus) | C2C12 N1-Tet-OFF NGFR | Derived from C2C12 reporter | C2C12+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF NGFR-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 1-H6 | |
| Cell line (Mus musculus) | C2C12 N2-Tet-OFF NGFR | Derived from C2C12 reporter | C2C12+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF NGFR-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 1-E9 | |
| Cell line (Mus musculus) | C2C12 N1-Tet-OFF Dll4 | Derived from C2C12 reporter | C2C12+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Dll4-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 2-D1 | |
| Cell line (Mus musculus) | C2C12 N2-Tet-OFF Dll4 | Derived from C2C12 reporter | C2C12+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Dll4-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 3-B12 | |
| Cell line (Mus musculus) | C2C12 N1-Tet-OFF Jag2 | Derived from C2C12 reporter | C2C12+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag2-2xFLAG-T2A-H2B- mCherry+PB-CAG-N1ECD-Gal4esn- T2A-H2B-mTurq2 1-E7 | |
| Cell line (Mus musculus) | C2C12 N2-Tet-OFF Jag2 | Derived from C2C12 reporter | C2C12+2xHS4-UAS-H2B-Citrine- 2xHS4+Tet-OFF Jag2-2xFLAG-T2A-H2B- mCherry+PB-CAG-N2ECD-Gal4esn- T2A-H2B-mTurq2 1-B12 | |
| Transfected construct (Cricetulus griseus and Mus musculus) | Super PiggyBac Transposase Expression Vector | System Biosciences | Cat# PB210PA-1 | Transposase used in all transfections with PiggyBac vectors |
| Transfected construct (Cricetulus griseus and Mus musculus) | pEV-2xHS4-UAS- H2B-Citrine-2xHS4-SV40-Zeocin | This paper | Reporter for hNotch-Gal4 receptors in cell lines | |
| Transfected construct (Cricetulus griseus and Mus musculus) | PB-CMV-MCS-EF1-Puro (PiggyBac vector) | System Biosciences | Cat# PB510B-1 | Base vector used to derive all PiggyBac constructs |
| Transfected construct (Cricetulus griseus) | PB-PGK-N1ECD- Gal4esn-T2A-H2B-mTurq2-SV40- Neomycin | This paper | Notch1ECD- Gal4 synthetic receptor in CHO receiver cells | |
| Transfected construct (Cricetulus griseus) | PB-PGK-N2ECD- Gal4esn-T2A-H2B-mTurq2-SV40- Neomycin | This paper | Notch2ECD- Gal4 synthetic receptor in CHO receiver cells | |
| Transfected construct (Cricetulus griseus and Mus musculus) | PB-CAG-N1ECD- Gal4esn-T2A-H2B-mTurq2-SV40- Neomycin | This paper | Notch1ECD- Gal4 synthetic receptor in Tet-OFF cell lines and C2C12 receiver cells | |
| Transfected construct (Cricetulus griseus and Mus musculus) | PB-CAG-N2ECD- Gal4esn-T2A-H2B-mTurq2-SV40- Neomycin | This paper | Notch2ECD- Gal4 synthetic receptor in Tet-OFF cell lines and C2C12 receiver cells | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1-MAT2A | Addgene | Cat# 100521 | Base vector used to derive all Tet-OFF constructs and constitutive ligand constructs |
| Transfected construct (Cricetulus griseus) | pCW57.1 Tet-OFF Dll1-2xFLAG-T2A-H2B- mCherry-PGK Blasticidin | This paper | Repressible Dll1 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1 Tet-OFF Dll4-2xFLAG-T2A-H2B- mCherry-PGK Blasticidin | This paper | Repressible Dll4 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus) | pCW57.1 Tet-OFF Jag1-2xFLAG-T2A-H2B- mCherry-PGK Blasticidin | This paper | Repressible Jag1 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1 Tet-OFF Jag2-2xFLAG-T2A-H2B- mCherry-PGK Blasticidin | This paper | Repressible Jag2 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus) | pCW57.1 Tet-OFF H2B-mCherry-PGK-Blasticidin | This paper | Repressible H2B-mCherry used as negative control in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1 Tet-OFF NGFR-T2A-H2B- mCherry-PGK -Blasticidin | This paper | Repressible NGFR ligand used as negative control in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1 CBh-Dll1-2xFLAG-T2A-H2B-mCherry- PGK-Blasticidin | This paper | Constitutively expressed Dll1 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1 CBh-Dll4-2xFLAG-T2A-H2B-mCherry- PGK-Blasticidin | This paper | Constitutively expressed Dll4 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus and Mus musculus) | pCW57.1 CBh-Jag1-2xFLAG-T2A-H2B-mCherry-PGK-Blasticidin | This paper | Constitutively expressed Jag1 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus) | pCW57.1 CBh-Jag2-2xFLAG-T2A-H2B-mCherry-PGK-Blasticidin | This paper | Constitutively expressed Jag2 ligand in cell lines. Used to make lentivirus. | |
| Transfected construct (Cricetulus griseus) | PB-CMV-Lfng- BGHpA-EF1- Puromycin | LeBon et al., 2014; https://doi.org/10.7554/eLife.02950. | Constitutively expressed Lfng in cell lines treated with siRNA | |
| Transfected construct (Cricetulus griseus) | PB-CMV- Lfng(D289E)- BGHpA-EF1- Puromycin | This paper Luther et al., 2009; https://doi.org/10.1074/jbc | Constitutively expressed dLfng (D289E) in cell lines treated with siRNA. Sequence from Luther et al., 2009 | |
| Transfected construct (Cricetulus griseus) | PB-CMV7-IFP2.0- BGHpA-SV40- Neomycin | Addgene (for IFP2.0 gene) | Cat# 59427 | IFP2.0 gene cloned into piggyBac plasmid. Vector cotransfected with fringe plasmids. |
| Transfected construct (Mus musculus) | pX330 (CRISPR-Cas9 plasmid system) | Nandagopal et al., 2019; https://doi.org/10.7554/eLife.37880; Cong et al., 2013; https://doi.org/10.1126/science.1231143. | Plasmid used to insert RNA guide sequences for use in CRISPR knockdown in C2C12 cells | |
| Transfected construct (Cricetulus griseus) | PB-PGK-Dll1- 2xFLAG-T2A-H2B-mCherry-P2A- Hygromycin | This paper | Constitutively expressed Dll1 ligand in CHO-K1 cell lines | |
| Transfected construct (Cricetulus griseus) | PB-PGK-Dll4- 2xFLAG-T2A-H2B-mCherry-P2A- Hygromycin | This paper | Constitutively expressed Dll4 ligand in CHO-K1 cell lines | |
| Transfected construct (Cricetulus griseus) | PB-PGK-Jag1- 2xFLAG-T2A-H2B-mCherry-P2A- Hygromycin | This paper | Constitutively expressed Jag1 ligand in CHO-K1 cell lines | |
| Transfected construct (Cricetulus griseus) | PB-PGK-Jag2- 2xFLAG-T2A-H2B-mCherry-P2A- Hygromycin | This paper | Constitutively expressed Jag2 ligand in CHO-K1 cell lines | |
| Antibody | PE anti-human Notch1 MHN1-519 (Mouse monoclonal) | BioLegend | Cat# 352105 | Used in soluble ligand binding assay (1:400) |
| Antibody | PE anti-human Notch2 MHN2-25 (Mouse monoclonal) | BioLegend | Cat# 348303 | Used in soluble ligand binding assay (1:400) |
| Antibody | Goat anti-human IgG Alexa Fluor 594 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A-11014 | Secondary antibody used to pre-cluster ligands in soluble ligand binding assay (1:1000) |
| Antibody | Anti-Notch2 (Rabbit monoclonal) | Cell Signaling Technology | Cat# 5732 | WB (1:800) |
| Antibody | Anti-GAPDH (Rabbit monoclonal) | Cell Signaling Technology | Cat# 2118 | WB (1:3000) |
| Antibody | Rabbit anti-FLAG M2 | Cell Signaling Technology | Cat# 14793 | WB (1:750) |
| Antibody | Mouse anti-Sodium Potassium ATPase Alpha 1 | Novus Biologicals | Cat# NB300-146 | WB (1:1000) |
| Antibody | Amersham ECL Rabbit IgG, HRP-linked whole Ab | Cytiva | Cat# NA934 | WB (1:2000) |
| Sequence-based reagent | siRNA: AllStars negative control | QIAGEN | Cat# 1027281 | |
| Sequence-based reagent | siRNA: Custom Select siRNA hamster Rfng | Thermo Fisher Scientific | Cat# 4399666 ID# s553138 | Sequence (5’ to 3’) GCUGUAAAAUGUCAGUGGAtt |
| Sequence-based reagent | siRNA: Custom Select siRNA hamster Lfng | Thermo Fisher Scientific | Cat# 4399665 ID# 555728 | Sequence (5’ to 3’) AGCUAAUGAUGAUAAGGGAtt |
| Sequence-based reagent | siRNA: Silencer Select siRNA mouse N1 | Thermo Fisher Scientific | Cat# 4390771 ID# s70699 | |
| Sequence-based reagent | siRNA: Custom Stealth siRNA mouse N2 | Thermo Fisher Scientific | Cat# 10620312 ID# 359602D12 | Sequence (5’ to 3’) GACCUUCACCCAUCCUGCAAGUUCA |
| Sequence-based reagent | siRNA: Stealth siRNA mouse N3 | Thermo Fisher Scientific | Cat# 1320001 ID# mss207111 | |
| Sequence-based reagent | siRNA: Silencer Select siRNA mouse Rfng | Thermo Fisher Scientific | Cat# 4390771 ID# s72908 | |
| Peptide, recombinant protein | Cas9 Protein | PNA Bio Inc | Cat# CP01 | |
| Peptide, recombinant protein | Recombinant Human Dll1ext-Fc fusion proteins | Sprinzak et al., 2010; https://doi.org/10.1038/nature08959. | Kindly provided by Irwin Bernstein, MD at Fred Hutchinson Cancer Research Center | |
| Peptide, recombinant protein | Recombinant Human IgG1 Fc Protein | Bio-Techne/ R&D Systems | Cat# 110-HG-100 | |
| Peptide, recombinant protein | Recombinant Human DLL1 Fc Chimera Protein | Bio-Techne/ R&D Systems | Cat# 10,184-DL-050 | |
| Peptide, recombinant protein | Recombinant Human DLL4 Fc Chimera Protein | Bio-Techne/ R&D Systems | Cat# 10185-D4-050 | |
| Peptide, recombinant protein | Recombinant Human Jag1 Fc Chimera Protein | Bio-Techne/ R&D Systems | Cat# 1277-JG-050 | |
| Peptide, recombinant protein | Recombinant Human Jag2 Fc Chimera Protein | Bio-Techne/ R&D Systems | Cat# 1726-JG-050 | |
| Chemical compound, drug | Lipfectamine RNAiMAX Transfection Reagent | Thermo Fisher Scientific | Cat# 13778075 | |
| Chemical compound, drug | Polyplus- transfection jetOPTIMUS DNA Transfection Reagent | Genesee Scientific | Cat# 55-250 | |
| Chemical compound, drug | DAPT | Sigma-Aldrich | Cat# D5942 | |
| Chemical compound, drug | 4-epi tetracycline hydrochloride | Sigma-Aldrich | Cat# 37918 | |
| Commercial assay or kit | Megashortscript T7 transcription kit | Thermo Fisher Scientific | Cat# AM1354 | |
| Commercial assay or kit | RNeasy Mini Kit | QIAGEN | Cat# 74104 | |
| Commercial assay or kit | QIAshredder | QIAGEN | Cat# 79656 | |
| Commercial assay or kit | iScript cDNA Sythesis Kit | Bio-Rad | Cat# 1708890 | |
| Commercial assay or kit | MycoStrip | InvivoGen | Cat# rep-mys-100 | |
| Commercial assay or kit | Pierce Cell Surface Protein Biotinylation and Isolation Kit | Thermo Fisher Scientific | Cat# A44390 | |
| Software, algorithm | RNA-sequencing read trimming and quality control | TrimGalore | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | |
| Software, algorithm | RNA-sequencing read alignment | HISAT2 v2.1.0 (via Galaxy) Kim et al., 2019 | http://daehwankimlab.github.io/hisat2/; https://usegalaxy.org/ | |
| Software, algorithm | RNA-sequencing transcript abundance calculation | StringTie v1.3.4 (via Galaxy) | http://ccb.jhu.edu/software/stringtie/; https://usegalaxy.org/ | |
| Software, algorithm | Import of flow cytometry .fcs files for data processing in Python3 | FlowCal | https://flowcal.readthedocs.io/en/latest/; Castillo-Hair et al., 2016 |
Additional files
-
Supplementary file 1
Notch gene expression in wild-type CHO-K1 cells.
These expression values in counts per million reads mapped (CPM) were obtained from the CHO gene expression visualization application (CGEVA) database of CHO RNA-sequencing (RNA-seq) data, including from wild-type CHO-K1 cells, located at https://anksi.shinyapps.io/biosciences/ (Singh et al., 2018).
Dll1, Dll4, Jag2, and Mfng were not available in the database. See also Methods.
- https://cdn.elifesciences.org/articles/91422/elife-91422-supp1-v1.xlsx
-
Supplementary file 2
4-epi-Tc concentrations used to induce ligand expression.
Where Tet-OFF inducible sender or receiver cells were used but don’t appear in the table above, 4-epi-Tc was used at a concentration of 500–800 ng/mL to fully suppress expression.
- https://cdn.elifesciences.org/articles/91422/elife-91422-supp2-v1.xlsx
-
Supplementary file 3
Sender-receiver cell pairs used for coculture assays.
Where multiple receivers are listed, they were cultured with the same senders but in separate wells (receivers were not mixed together). All experiments with CHO-K1 cells used wild-type cells as negative sending controls and experiments with C2C12-Nkd receivers used the blank C2C12-Nkd parental line as negative controls. Clone identifiers are in parentheses; polyclonal cell lines lack parentheses. See senders’ ligand expression distributions in Figure 1C, Figure 1—figure supplement 3A, and Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/91422/elife-91422-supp3-v1.xlsx
-
Supplementary file 4
Recombinant Notch ligands and concentrations.
- https://cdn.elifesciences.org/articles/91422/elife-91422-supp4-v1.xlsx
-
Supplementary file 5
Primers for RT-PCR and qRT-PCR.
- https://cdn.elifesciences.org/articles/91422/elife-91422-supp5-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/91422/elife-91422-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Diversity in Notch ligand-receptor signaling interactions
eLife 12:RP91422.
https://doi.org/10.7554/eLife.91422.3
