Mobile barrier mechanisms for Na+-coupled symport in an MFS sugar transporter
- Department of Cell Physiology and Molecular Biophysics, Center for Membrane Protein Research, Texas Tech University Health Sciences Center, School of Medicine, United States
- Thermo Fisher Scientific, United States
- VIB-VUB Center for Structural Biology, VIB, Pleinlaan 2, Belgium
- Structural Biology Brussels, Vrije Universiteit Brussel, Pleinlaan 2, Belgium
- Division of CryoEM and Bioimaging, Stanford Synchrotron Radiation Light Source, SLAC National Accelerator Laboratory, United States
- Department of Chemistry and Biochemistry, Texas Tech University, United States
- Department of Physiology, University of California, Los Angeles, United States
Figures
Figure 1 with 3 supplements
Functional characterizations of the hybrid Nb725_4.
(a) In vivo two-hybrid interaction assay. Two compatible plasmids encoding T25:MelBSt and Nb:T18 were transformed into E. coli DH5α cyaA cells and plated on the maltose-containing MacConkey agar …
-
Figure 1—source data 1
Original photographs that were taken from in vivo two-hybrid interaction assay and used to prepare Figure 1a.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig1-data1-v1.pdf
-
Figure 1—source data 2
Original photographs that were taken from sugar fermentation assay results and used to prepare Figure 1b.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig1-data2-v1.pdf
-
Figure 1—source data 3
Western blot to detect MelBSt expression when co-expressing with Nb725 or Nb725_4 (unlabelled).
Membranes were prepared from E. coli DW2 cells that were transformed with two compatible plasmids derived from pACYC and pCS19 encoding MelBSt and Nb725_4 or Nb725, respectively, and used for the [3H]melibiose active transport assay. After protein concentration determination, 50 μg of total membrane proteins of each sample was analyzed by SDS-15%PAGE and western blot using anti-His tag antibody (HisProbe-HRP Conjugate) as described in the Materials and methods. The western blot result was imaged by the ChemiDoc MP Imaging System (Bio-Rad). MelBSt protein expression presented as the inset in Figure 1c. The bands migrating near 25 kDa are non-specific and also presented in the membranes with no MelB nor Nb.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig1-data3-v1.jpg
-
Figure 1—source data 4
Western blot to detect MelBSt expression when co-expressing with Nb725 or Nb725_4 (labelled).
Membranes were prepared from E. coli DW2 cells that were transformed with two compatible plasmids derived from pACYC and pCS19 encoding MelBSt and Nb725_4 or Nb725, respectively, and used for the [3H]melibiose active transport assay. After protein concentration determination, 50 μg of total membrane proteins of each sample was analyzed by SDS-15%PAGE and western blot using anti-His tag antibody (HisProbe-HRP Conjugate) as described in the Materials and methods. The western blot result was imaged by the ChemiDoc MP Imaging System (Bio-Rad). MelBSt protein expression presented as the inset in Figure 1c is highlighted by the box. The bands migrating near 25 kDa are non-specific and also presented in the membranes with no MelB nor Nb.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig1-data4-v1.pdf
Figure 1—figure supplement 1
Hybrid Nb725_4 generated by complementarity-determining region (CDR) grafting.
(a) All CDR regions are indicated by boxes. The sequences of TC-Nb4 and MelBSt Nb725 are colored in black and red, respectively. The sequence of hybrid Nb725_4 is colored in black and red from the …
-
Figure 1—figure supplement 1—source data 1
Western blot shown in Figure 1—figure supplement 1e (unlabelled).
Fractions collected from gel chromatography were analyzed by SDS-15% PAGE and stained by silver nitrate.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig1-figsupp1-data1-v1.jpg
-
Figure 1—figure supplement 1—source data 2
Western blot shown in Figure 1—figure supplement 1e (labelled).
Fractions collected from gel chromatography were analyzed by SDS-15% PAGE and stained by silver nitrate.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig1-figsupp1-data2-v1.pdf
Figure 1—figure supplement 2
Ligand effects on the nanobodies (Nbs) binding.
All isothermal titration calorimetry (ITC) binding measurements at 25°C and curve fitting are described in ‘Materials and methods’. The purified Nb725_4, Nb725, MelBSt, and EIIAGlc protein samples …
Figure 1—figure supplement 3
Nanobody (Nb) effects on substrate/ligand binding.
All isothermal titration calorimetry (ITC) binding measurements at 25°C and curve fitting are described in ‘Materials and methods’. The binding measurements of melibiose, α-NPG, and EIIAGlc were …
Figure 2 with 8 supplements
CryoEM single-particle analysis (cryoEM-SPA).
The samplecoum containing the wild-type MelBSt in lipids nanodiscs, the MelBSt-specific Nb725_4, NabFab, and anti-Fab Nb at 1.5 mg/mL in 20 mM Tris–HCl, pH 7.5, and 150 mM NaCl was prepared as …
Figure 2—figure supplement 1
CryoEM data process.
The strategy for the reconstruction and refinement is outlined.
Figure 2—figure supplement 2
Initial 3D reconstruction.
Data were processed in CryoSPARC program.
Figure 2—figure supplement 3
Refinement and map improvement.
A total number of 296,925 polished particles from both non-tilted and 30° tilted data acquisition were used to reconstruct a 3.37 Å volume using Local Refinement.
Figure 2—figure supplement 4
Golden standard Fourier shell correlation (GSFSC) resolution and 3dFSC.
The resolution of map and particle orientation distribution was assessed by cryoSPARC proteins using default setting parameters.
Figure 2—figure supplement 5
Evaluation of map and models.
(a) The local resolution. The map half_A and half_B files produced by the cryoSPARC Local Refinement program were used to calculate the Local Resolution Map by Phenix and displayed by UCSF ChimeraX …
Figure 2—figure supplement 6
NabFab comparison.
(a, b) NorM complexed with anti-NorM Nb17_4/NabFab/anti-NabFab Nb (PDB ID 7PHP) was superimposed with MelBSt complexed with Nb725-4 and NabFab based on the H chains of NabFab in the two structures. …
Figure 2—figure supplement 7
Interactions of Nb725m_4 and MelBSt.
(a) Nb725_4 bound to the N-terminal domain of MelBSt. The contact between Nb CDR-1 and CDR-2 and MelBSt loop4-5, and loop6-7 contributed to the major interactions. (b) The surface electro potential …
Figure 2—figure supplement 8
Complex of MelBSt with Nb725 and EIIAGlc.
Samples containing MelBSt (black curve), MelBSt with Nb725 (red curve), or with Nb725 and EIIAGlc (blue curve), were prepared and analyzed by gel filtration chromatography in a combination of the …
-
Figure 2—figure supplement 8—source data 1
Western blot shown in Figure 2—figure supplement 8 (unlabelled).
Fractions collected from gel chromatography were analyzed by SDS-15% PAGE and stained by silver nitrate.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig2-figsupp8-data1-v1.jpg
-
Figure 2—figure supplement 8—source data 2
Western blot shown in Figure 2—figure supplement 8 (labelled).
Fractions collected from gel chromatography were analyzed by SDS-15% PAGE and stained by silver nitrate.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig2-figsupp8-data2-v1.pdf
Figure 3 with 4 supplements
Na+- and sugar-binding pockets of MelBSt.
(a) Location of the Na+ binding site. The inward-facing cryoEM structure of the WT MelBSt is displayed in cylindrical helices with the cytoplasmic side on the top. One bound Na+ ion within the …
Figure 3—figure supplement 1
MD simulations of the Na+ binding at both inward- and outward-facing states.
The equilibrated structures of Na+-binding site for the inward- and outward-facing MelBSt in the absence of melibiose. Distances between Na+ and nearby residues' coordinating atoms are labeled in …
Figure 3—figure supplement 2
Galactose-binding pocket in the outward-facing crystal structure (PDB ID 7L17).
All polar interactions between the bound α-NPG and D59C MelBSt are indicated by dashed lines (Å) and the pocket is shown in surface representation in blue. The Na+-binding residues are highlighted …
Figure 3—figure supplement 3
The alignment of the sugar-bound outward-facing structure (7L17, green) with the Na+ -bound inward-facing structure (blue) was carried out in Pymol or Coot programs.
The rmsd values reported from Pymol program were either based on default settings with outlier rejection or using all atoms after removing unmatched residues. (a) Superposition of both structures. (b…
Figure 3—figure supplement 4
Membrane topology.
(a) The sugar-bound outward-facing structure (PDB ID 7L17). (b) The Na+-bound inward-facing structure. The full-length MelBSt is illustrated by transmembrane topology based on both structures. The …
Figure 4
Barriers and sugar-binding pocket.
Outward-facing (PDB ID 7L17; left column) and inward-facing (right column) structures were used to prepare the figures. (a, d) Side view with cytoplasmic side on top. The inner and outer barriers …
Figure 5
MelBSt dynamics probed by hydrogen/deuterium exchange mass spectrometry (HDX-MS).
(a) MelBSt peptide sequence coverage. The peptides of the deuterated MelBSt were determined based on the MelBSt peptide database that was generated by nonspecific digestions of non-deuterated MelBSt …
-
Figure 5—source data 1
Output results of HDExaminer software analysis for Figures 5 and 6.
- https://cdn.elifesciences.org/articles/92462/elife-92462-fig5-data1-v1.csv
Figure 6 with 3 supplements
Peptide mapping of hydrogen/deuterium exchange (HDX) results.
HDX results are presented in Figure 5. Any peptide of ΔD with p≤0.05 and ΔD ≥ |0.3184| were treated as significant. The peptides with statistically significant differences at the 3000 s time point …
Figure 6—figure supplement 1
Uptake time course for positions 2–263.
The deuterium uptake time course of peptides covering positions 2–263 is plotted as a percentage of deuterium uptake relative to the theoretic maximum number (D%) in the absence (black square) or …
Figure 6—figure supplement 2
Uptake time course for positions 261–475.
The deuterium uptake time course of peptides covering positions 261–475 is plotted as a percentage of deuterium uptake relative to the theoretic maximum number (D%) in the absence (black square) or …
Figure 6—figure supplement 3
Hydrogen/deuterium exchange mass spectrometry (HDX-MS).
Histograms of deuterium uptake time courses. The deuterium uptake time courses of the groups I and II presented in Figure 7 are replotted in the histogram. Error bar, SEM; test number, 3.
Figure 7
Dynamic regions of MelBSt.
The peptides that exhibited faster hydrogen/deuterium exchange (HDX) rates (>5% at 30 s) were mapped on both the α-NPG-bound outward-facing structure (7L17) in panel (a) and the inward-facing cryoEM …
Figure 8
Stepped-binding model for the Na+/melibiose symport catalyzed by MelB.
Eight states are postulated including transient intermediates. In this reversal reaction, the cation binds prior to the sugar and releases after sugar release. Melibiose active transport or inflex …
Tables
Table 1
Nanobodies (Nbs) binding.
| Titrant | Titrate condition | Kd(µM) | Number of tests | Fold of affinity change | p-Value* |
|---|---|---|---|---|---|
| Nb725_4 | MelBSt/Na+ | 3.64 ± 0.62† | 7 | ||
| MelBSt/Na+/melibiose | 11.81 ± 0.72 | 6 | -3.24 | <0.01 | |
| MelBSt/Na+/α- †NPG | 14.63 ± 1.27 | 2 | -4.02 | <0.01 | |
| MelBSt/Na+/EIIAGlc | 2.14 ± 0.11 | 2 | +1.70 | >0.05 | |
| NabFab | 52.53 ± 13.03‡ | 2 | |||
| Nb725 | MelBSt/Na+ | 1.58 ± 0.42 | 6 | ||
| MelBSt/Na+/melibiose | 8.88 ± 1.24 | 5 | -5.62 | <0.01 | |
| MelBSt/Na+/α-NPG | 12.58 ± 0.60 | 2 | -7.96 | <0.01 | |
| MelBSt/Na+/EIIAGlc | 1.18 ± 0.12 | 2 | +1.34 | >0.05 | |
| NabFab | 36.02 | 1 | |||
| Anti-Fab Nb | NabFab | 112.90 ± 16.33‡ | 2 |
-
*
Unpaired t-test.
-
†
Mean ± SEM.
-
‡
nM.
Table 2
Nanobody (Nb) effects on MelBSt binding to sugar, Na+, and EIIAGlc.
| Titrant | Titrate condition | Kd(µM) | Number of tests | Fold of affinity change | p-Value* | Reference |
|---|---|---|---|---|---|---|
| Melibiose | MelBSt/Na+ | 1430 ± 30.0† | 5 | / | ||
| MelBSt/Na+/Nb725_4 | /‡ | 3 | ||||
| MelBSt/Na+/Nb725 | / | 3 | ||||
| MelBSt/Na+/EIIAGlc | / | 3 | Hariharan et al., 2015 | |||
| α-NPG | MelBSt/Na+ | 16.46 ± 0.21 | 5 | / | ||
| MelBSt/Na+/Nb725_4 | 531.55 ± 19.25 | 2 | -32.29 | <0.01 | ||
| MelBSt/Na+/Nb725 | 353.55 ± 37.25 | 2 | -21.48 | <0.01 | ||
| MelBSt/Na+/EIIAGlc | 76.13 ± 4.52 | 2 | -4.63 | <0.01 | Hariharan et al., 2015 | |
| Na+ | MelBSt | 261.77 ± 49.15 | 4 | / | ||
| MelBSt/Nb725_4 | 345.04 ± 9.92 | 2 | -1.32 | >0.05 | ||
| MelBSt/Nb725 | 182.50 ± 11.30 | 2 | +1.43 | >0.05 | ||
| MelBSt/EIIAGlc | 253.50 ± 11.00 | 2 | +1.03 | >0.05 | Katsube et al., 2023 | |
| EIIAGlc | MelBSt/Na+ | 3.76 ± 0.29 | 5 | / | ||
| MelBSt/Na+/Nb725_4 | 4.32 ± 0.64 | 4 | -1.15 | >0.05 | ||
| MelBSt/Na+/Nb725 | 1.94 ± 0.10 | 4 | +1.94 | <0.01 |
-
*
Unpaired t-test.
-
†
Mean ± SEM.
-
‡
Not detectable.
Table 3
CryoEM data collection and structure determination statistics.
| MelBSt/Nb725m/NabFab | |||||
|---|---|---|---|---|---|
| EMDB | EMD-41062 | ||||
| PDB | 8T60 | ||||
| Non-tilted collection | Tilted collection | ||||
| Data collection | |||||
| Microscope | Krios-TEMBETA | Krios-TEMBETA | |||
| Voltage (kV) | 300 | 300 | |||
| Number of movies | 14,094 | 8716 | |||
| Electron dose (e-/Å2) | 50.00 | 50.00 | |||
| Defocus range (μm) | −0.8 to –1.8 | −0.8 to –1.8 | |||
| Pixel size (Å) | 0.86 | 0.86 | |||
| Plate tilt angel (°) | / | 30 | |||
| Data processing | |||||
| Initial number of particles | 7,632,727 | 2,887,147 | |||
| Combined final number of particles | 203,876 | ||||
| Symmetry imposed | C1 | ||||
| Map resolution* (Å) | 3.29 | ||||
| B factor | 101.4 | ||||
| Model refinement | |||||
| Chains | 5 | ||||
| Non-hydrogen atoms | 7503 | ||||
| Protein residues | 978 | ||||
| Mean B-factor | |||||
| Protein | 97.35 | ||||
| Na+ ion | 88.64 | ||||
| RMS deviations | |||||
| Bond lengths (Å) | 0.003 | ||||
| Bond angles (°) | 0.509 | ||||
| MolProbity score | 1.82 | ||||
| Clash score | 4.09 | ||||
| Poor rotamers (%) | 1.98 | ||||
| Ramachandran plot | |||||
| Favored (%) | 93.48 | ||||
| Allowed (%) | 6.52 | ||||
| Outliers (%) | 0.00 | ||||
| Model resolution (Å)† | 3.2/3.3/3.5 | ||||
-
*
Resolution determined by Fourier shell coefficient threshold of 0.143 for corrected masked map.
-
†
Resolution determined between the model and the resolved map by Fourier shell coefficient threshold of 0/0.143/0.5.
Table 4
HDX reaction and labeling details.
| Samples measured | WT MelBSt | WT MelBSt complexed with Nb725m |
|---|---|---|
| HX reaction buffer | 25 mM Tris-HCl, pD 7.5, 150 mM NaCl, 10% Glycerol, and 0.01% DDM | |
| Reaction temperature (°C) | 20 | |
| HX time course (s) | 0, 30, 300, 3000 | |
| Number of peptides | 153 | |
| Sequence coverage by labeling | 86% | |
| Mean peptide length | 9.3 | |
| Average redundancy | 2.9 | |
| Replicates (technical) | 3 | |
| |ΔD| (Da) | 0.3071 | |
| Back exchange rate | Not appliable | |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background melB (Salmonella typhimurium) | S. typhimurium strain LT2/SGSC1412/ATCC | PMID:1495487 | STM4299 | Used for melB cloning |
| Strain, strain background (Escherichia coli) | DW2 | PMID:3047112 | melA+ ΔmelB ΔlacZY | MelB expression and transport analysis |
| Strain, strain background (E. coli) | XL1 Blue | Agilent Technologies | recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)] | Plasmid amplification |
| Strain, strain background (E. coli) | ArcticExpress (DE3) | Agilent Technologies | F– ompT hsdS(rB – mB –) dcm+ Tetr gal λ(DE3) endA Hte [cpn10 cpn60 Gentr] | Protein expression |
| Strain, strain background (E. coli) | DH5α cyaA- | PMID:37380079 | ΔcyaA | Two-hybrid assay |
| Strain, strain background (E. coli) | BL21(DE3) T7 express | New England Biolabs | fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) endA1 Δ(mcrC-mrr)114::IS10 | Protein expression |
| Strain, strain background (E. coli) | BL21(DE3) C43 | PMID:8757792 | F– ompT hsdSB (rB- mB-) gal dcm (DE3) | Protein expression |
| Strain, strain background (E. coli) | BL21(DE3) pRIL | Agilent Technologies | F– ompT hsdS(rB – mB –) dcm+ Tetr gal endA Hte [argU ileY leuW], Camr | Protein expression |
| Recombinant DNA reagent (plasmid) | pCS19 | PMID:10319814 | pQE60 derivative inserted with gene lacIq; ampr | Cloning/expressing vector |
| Recombinant DNA reagent (plasmid) | pCS19/FX | PMID:25627011 | Expression vector derived from pCS19 with two SapI sites and ccdB gene for FX cloning; ampr | |
| Recombinant DNA reagent (plasmid) | pACYC | PMID:2190220 | Expression vector; no ccdB gene: camr | |
| Recombinant DNA reagent (plasmid) | pACYC/FX | PMID:25627011 | Expression vector derived from pACYC; with ccdB gene, camr | |
| Recombinant DNA reagent (plasmid) | pACYC/MelBSt | PMID:25627011 | Expression plasmid for MelBSt derived from pACYC/FX; no ccdB gene, camr | |
| Recombinant DNA reagent (plasmid) | pCS19/X:T18/FX | PMID:37380079 | FX cloning vector; two SapI sites and ccdB gene for FX cloning; ampr | Two-hybrid assay vector; expressing a target protein ‘X’ with a C-terminal T18 fusion |
| Recombinant DNA reagent (plasmid) | pCS19/T18 | PMID:37380079 | Expression plasmid from pCS19/X:T18/FX for expressing T18 fragment only; no ccdB gene. | Two-hybrid assay plasmid; control vector |
| Recombinant DNA reagent (plasmid) | pACYC/T25 | PMID:37380079 | Expression plasmid from pACYC/T25:X/FX for expressing T25 fragment; no ccdB gene, camr | Two-hybrid assay plasmid; control vector |
| Recombinant DNA reagent (plasmid) | pACYC/T25:MelBSt | PMID:37380079 | Expression plasmid derived from pACYC/T25:X/FX; no ccdB gene, camr | Two-hybrid assay plasmid; expressing T25:MelBSt hybrid |
| Recombinant DNA reagent (plasmid) | pCS19/Nb725:T18 | PMID:37380079 | Expression plasmid hybrid derived from pCS19/X:T18/FX; no ccdB gene, ampr | Two-hybrid assay plasmid; expressing Nb725:T18 hybrid |
| Recombinant DNA reagent (plasmid) | pCS19/Nb725_4:T18 | This study | Expression plasmid derived from pCS19/X:T18/FX; no ccdB gene, ampr | Two-hybrid assay plasmid; expressing Nb725_4:T18 hybrid |
| Recombinant DNA reagent (plasmid) | pK95ΔAH/MelBSt/CHis10 | PMC3057838 | Constitutive expression plasmid | MelBSt protein expression |
| Recombinant DNA reagent (plasmid) | pCS19/Nb725 | PMID:37380079 | Expression plasmid for Nb725 derived from pCS19/FX; no ccdB gene, ampr | Nb725 protein expression |
| Recombinant DNA reagent (plasmid) | pCS19/Nb725_4 | This study | Expression plasmid for Nb725_4 derived from pCS19/FX; no ccdB gene, ampr | Nb725_4 protein expression |
| Recombinant DNA reagent (plasmid) | pET26b(+) | Novagen (EMD Millipore) | Periplasmic expression plasmid with a N-terminal pelB signal sequence; Kanr | For expression Nb725_4 and anti-Fab Nb |
| Recombinant DNA reagent (plasmid) | pET26/Nb725_4 | This study | Periplasmic expression plasmid derived from pET26b(+); Kanr | Nb725_4 protein production |
| Recombinant DNA reagent (plasmid) | pET26/Anti-Fab Nb | This study | Anti-Fab Nb periplasmic expression plasmid; Kanr | Anti-Fab Nb protein expression |
| Recombinant DNA reagent (plasmid) | p7XC3H/Nb725 | PMID:37380079 | Cytoplasmic expression plasmid; Kanr | Nb725 protein production |
| Recombinant DNA reagent (plasmid) | p7XNH3/EIIAGlc | PMID:25296751 | Cytoplasmic expression plasmid; Kanr | EIIAGlc protein production |
| Recombinant DNA reagent (plasmid) | pR2.2/NabFab | PMID:34782475 | Periplasmic expression of NabFab; Ampr | NabFab protein production |
| Recombinant DNA reagent (plasmid) | pMSP1E3D1 | Addgene/20066 | Expressing SP1E3D1; Kanr | MSP1E3D1 production |
| Recombinant DNA reagent (plasmid) | pRK792 | Addgene/8830 | Expressing TEV protease; Ampr | TEV protease production |
| Sequence-based reagent (primers) | MelB_Nb725_4_T18 | This study | Fwd: 5′- ATATATGCTCTTCTAGTCAACGTCAATTGGTAG -3′ Rev: 5′- TATATAGCTCTTCATGCGCTGCTCACGGTCAC -3′ | FX cloning primers to contrast pCS19/Nb725_4:T18; addition of a C-terminal ‘A’ of Nb725_4 enabling the C-terminal T18 in-frame fusion |
| Sequence-based reagent (primer) | MelB_Nb725_4 | This study | Fwd: 5′-ATATATGCTCTTCTAGTATGCAACGTCAATTGGTAG-3′ Rev: 5′-TATATAGCTCTTCATGCTTAGTGGTGATGATGGTGGTGGCT GCTCACGGTCAC-3′ | FX cloning primers to construct pCS19:Nb725_4-CTH with a C-terminal 6x His-tag |
| Sequence-based reagent (primer) | Nb-PelB-NdeI | This study | Fwd: 5′-TTTAAGAAGGAGATATACATATG-3′ | Insert NdeI restriction site for Nb725_4 and anti-Fab Nb construction |
| Sequence-based reagent (primer) | Nb-STRP-XhoI | This study | Rev: 5′-TTTGTTCTAGACTCGAGTTATTTCTC-3′ | Add XhoI restriction site for Nb725_4 and anti-Fab Nb construction |
| Chemical compound, drug | [3H]Melibiose | PerkinElmer | (5.32 Ci/mmol) | Transport assay S |
| Chemical compound, drug | UDM | Anatrace | Cat# D300HA | MelBSt purification |
| Chemical compound, drug | DDM | Anatrace | Cat# D310 | MelBSt purification |
| Chemical compound, drug | Melibiose | Acros Organics | Cat# 125375000 | Fermentation and Binding assay |
| Chemical compound, drug | α-NPG | Acros Organics | Cat# 33733500 | Binding assay |
| Chemical compound, drug | E. coli lipids | Avanti Polar Lipids, Inc | Extract Polar, 100600 | Nanodiscs |
| Software, algorithm | CryoSPARC | CryoSPARC | 2-4.01 | CryoEM data processing |
| Software, algorithm | USF ChimeraX | USF ChimeraX | 1.6 | Mask preparation |
| Software, algorithm | Phenix | Phenix | 1.20-4459 | Map sharpen and model refinement |
| Software, algorithm | Coot | Coot | 0.9 | Model building |
| Software, algorithm | Pymol | Pymol | 2.5 | Model visualization |
| Software, algorithm | Qscore | Qscore | Q score calculation | |
| Software, algorithm | NanoAnalyze | TA Instruments | 3.7.5 | Data fitting |
| Software, algorithm | HDExaminer | Trajan Scientific and Medical | 3.3 | HDX data analysis |
| Software, algorithm | BioPharma Finder | Thermo | 5.1 | HDX data analysis and peptide mapping |
