Structural basis for the phase separation of the chromosome passenger complex
- Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, United States
- Graduate Program in Biochemistry and Molecular Biophysics, University of Pennsylvania, United States
- Department of Biochemistry and Molecular Genetics, University of Virginia, United States
- Penn Center for Genome Integrity, Perelman School of Medicine, University of Pennsylvania, United States
- Epigenetics Institute, Perelman School of Medicine, University of Pennsylvania, United States
Figures
Figure 1 with 1 supplement
Phase separation leads to decreases in hydrogen/deuterium exchange (HX) within the three-helix bundle structure of ISB.
(A) Schematic of the ISB showing various structural domains within the subunits. Structural information was extracted from crystal structure of three-helix bundle structure of the ISB (PDB# 2QFA) (Je…
-
Figure 1—source code 1
MATLAB script to produce difference plots between two hydrogen/deuterium exchange mass spectrometry (HXMS) datasets.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig1-code1-v2.zip
-
Figure 1—source data 1
Data used to generate Figure 1.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig1-data1-v2.zip
Figure 1—figure supplement 1
Phase properties of WT-ISB in absence of crowder.
(A) Fusion of WT-ISB droplets as visualized by time-lapse imaging in the absence of crowding agent. (B) Phase diagram of WT-ISB phase separation as a function of the concentration of NaCl and ISB in …
Figure 2 with 3 supplements
Regions of the three-helix bundle structure of INCENP and Borealin become protected from hydrogen/deuterium exchange (HX) upon phase separation.
(A) Percent difference in HX upon phase separation at 100 s in the indicated region of INCENP. (B) Raw MS data of a representative peptide from indicated region of INCENP. Centroid values are …
-
Figure 2—source code 1
R script to produce ribbon diagrams for each hydrogen/deuterium exchange mass spectrometry (HXMS) dataset.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig2-code1-v2.zip
-
Figure 2—source data 1
Data used to generate Figure 2.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig2-data1-v2.zip
Figure 2—figure supplement 1
Ribbon plots for free and droplet ISB protein.
Hydrogen/deuterium exchange mass spectrometry (HXMS) data for free ISB protein and droplet ISB protein. Each horizontal bar represents an individual peptide, and the five stripes within each bar are …
Figure 2—figure supplement 2
Extent of deuteration within fully deuterated (FD) hydrogen/deuterium exchange mass spectrometry (HXMS) control samples.
(A) Extent of peptide deuteration across INCENP, Borealin, and Survivin sequence within a representative FD HXMS control samples. (B) Cumulative distribution curve of a representative FD sample, …
Figure 2—figure supplement 3
Percent difference in hydrogen/deuterium exchange (HX) calculated for each peptide at 300 s.
(A) Percent difference in HX is calculated for each peptide (represented by horizontal bars) at the 300 s timepoint and plotted using the corresponding color key. The consensus behavior at each ISB …
-
Figure 2—figure supplement 3—source data 1
Data used to generate Figure 2—figure supplement 3.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig2-figsupp3-data1-v2.zip
Figure 3
Acidic patch within INCENP coiled-coiled region contributes to electrostatic interaction within droplets.
(A) Location of indicated acidic residues (E35/36/39/40/42) within INCENP at the surface of the coiled-coiled structure. Side chains are colored in red to indicate acidic charge. (B) Summary of a …
-
Figure 3—source data 1
Data used to generate Figure 3.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig3-data1-v2.zip
Figure 4 with 1 supplement
Crystal packing of ISB three-helix bundle structure highlights possible salt-bridges between multiple complexes.
(A) Location of acidic and basic residues within crystal packing of ISB between INCENP1 and Borealin2/Borealin3. Side chains are colored in red to indicate acidic charge and blue to indicate basic …
-
Figure 4—source data 1
Data used to generate Figure 4.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig4-data1-v2.zip
Figure 4—figure supplement 1
Highlighting structure of conflicting salt-bridge between INCENP and Borealin.
Highlighting crystal structure between INCENP1 and Borealin2. Side chains E36 and E40 of INCENP1 have the potential to form a salt-bridge with K63 of Borealin2. Potential polar contacts and …
Figure 5 with 2 supplements
Salt-bridges between multiple ISB complexes provide multivalency required for phase separation.
(A) Location of key salt-bridges within crystal packing of ISB between INCENP1 and Borealin2/Borealin3. Side chains are colored in red to indicate acidic charge and blue to indicate basic charge. …
-
Figure 5—source data 1
Data used to generate Figure 5.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig5-data1-v2.zip
Figure 5—figure supplement 1
SDS-PAGE gels from saturation concentration experiment.
SDS-PAGE gels measuring saturation concentration of (ISB)WT, IMut6SB, IMut7SB, ISBMut, and IMut6SBMut in buffer containing 75 mM NaCl measured using spin-down method. N=5 for all samples. Bands were …
-
Figure 5—figure supplement 1—source data 1
Data used to generate Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig5-figsupp1-data1-v2.zip
Figure 5—figure supplement 2
ISB-WT and mutant protein complexes (SDS-PAGE).
SDS-PAGE gel of WT and mutant protein complexes at 1.5 mg/mL.
-
Figure 5—figure supplement 2—source data 1
Data used to generate Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/92709/elife-92709-fig5-figsupp2-data1-v2.zip
Figure 6 with 2 supplements
Disrupting salt-bridge residues in Borealin diminishes phase separation in cells.
(A) Endogenous Aurora B is recruited to nuclear Borealin foci upon exposure to 488 nm light. Images within the nucleus are shown (see Figure 6—figure supplement 1 for images of the entire cell for …
Figure 6—figure supplement 1
Endogenous Aurora B is recruited to Borealin-mCherry-Cry2 droplets in the nucleus upon exposure to white light.
(A) Cells expressing the indicated construct with and without exposure to white light were fixed and assessed for Aurora B and mCherry localization. Note that to expose the entire coverslip, the …
Figure 6—figure supplement 2
Evidence supporting the engagement of the Borealin-mCherry-Cry2 with the endogenous chromosome passenger complex (CPC).
(A) Borealin-mCherry-Cry2-expressing cells were exposed to white light analyzed as in Figure 6A and Figure 6—figure supplement 1. Scale bar = 5 μm. (B) Mitotic cells expressing the indicated …
Figure 7
Summary model highlighting functionality of chromosome passenger complex (CPC) phase separation in cells.
Stabilized interactions defined by hydrogen/deuterium exchange mass spectrometry (HXMS) findings are indicated in solid black lines, while proposed weak interactions via Borealin loop are defined by …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Sequence-based reagent | WTISB_F | This Paper | PCR primer | 3’ - TGAGATCCGAATTCGAGCTCTAATTTTG - 5’ |
| Sequence-based reagent | WTISB_R | This paper | PCR primer | 3’ - GCTGTGATGATGATGATGATGGCTGCTG - 5’ |
| Sequence-based reagent | ISBMut6_F | This paper | PCR primer | 3’ - CTTGAGCGTATCCAAGAGGAGGCCCGACGCATGTTCACC - 5’ |
| Sequence-based reagent | ISBMut6_R | This paper | PCR primer | 3’ - GGTGAACATGCGTCGGGCCTCCTCTTGGATACGCTCAAG - 5’ |
| Sequence-based reagent | ISBMut7_F | This paper | PCR primer | 3’ - CGTATCCAAGAGCGAGCCGAGCGCATGTTCACCAGAGAA - 5’ |
| Sequence-based reagent | ISBMut7_R | This paper | PCR primer | 3’ - TTCTCTGGTGAACATGCGCTCGGCTCGCTCTTGGATACG - 5’ |
| Sequence-based reagent | WTISB_F_2 | This paper | PCR primer | 3’ - CCGTCTCGCCCAAATCTGCA - 5’ |
| Sequence-based reagent | WTISB_R_2 | This paper | PCR primer | 3’ - GCTGTGATGATGATGATGATGGCTGCTG - 5’ |
| Sequence-based reagent | IMut1SB_G_Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Sequence-based reagent | IMut2SB_G_Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Sequence-based reagent | IMut3SB_G_Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Sequence-based reagent | IMut4SB_G_Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Sequence-based reagent | IMut5SB_G _Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Sequence-based reagent | ISBMut_G_Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Sequence-based reagent | IMut6SBMut_G_Block | This paper | Oligonucleotide | See Supplementary file 2 |
| Strain, strain background (Escherichia coli) | Rosetta 2 (DE3) plysS | Novagen | 71403 | Electrocompetent cells |
| Cell line (Homo sapiens) | T-Rex HeLa Cell Line | Thermo Fisher Scientific | R71407 | |
| Recombinant DNA reagent | pET28a_ISB | Trivedi et al., 2019 | 6xHis-INCENP1-58, FL Survivin and FL Borealin | |
| Commercial assay, kit | NEB Hifi DNA Assembly Kit | New England Biolabs | E5520S | For molecular cloning |
| Other | HisTrap HP Column | Cytiva/GE Life Sciences | 17524801 | For protein purification |
| Other | Hi-Load 16/60 Superdex-200 pg | Cytiva/GE Life Sciences | 28989335 | For protein purification |
| Other | C18 HPLC Column, 0.3×75 mm2 | Agilent | For HXMS experimentation | |
| Other | TARGA C8 5 µM Piccolo HPLC column | Higgins Analytical | For HXMS experimentation | |
| Other | Leica DMI6000 B | Leica Microsystems | For differential interference contrast microscopy | |
| Other | Discovery M120SE Sorvall Ultracentrifuge | New Life Scientific | For sedimentation and saturation concentration assays | |
| Other | LTQ Orbitrap XL Mass Spectrometer | Thermo Fisher Scientific | For HXMS data acquisition | |
| Other | Exactive Plus EMR Orbitrap Mass Spectrometer | Thermo Fisher Scientific | For HXMS data acquisition | |
| Other | NanoDrop 2000 UV-Vis Spectrophotometer | Thermo Fisher Scientific | ND2000CLAPTOP | For turbidity measurements |
| Other | Zeiss Observer-Z1 Microscope | Zeiss | For optoDroplet assay | |
| Software | XCalibur | Thermo Fisher Scientific | OPTON-30965 | For HXMS data acquisition |
| Software | ExMS2 | Kan et al., 2019 | For HXMS data processing | |
| Software | MATLAB | Mathworks | For HXMS data processing | |
| Software | RStudio | Posit | For HXMS data processing | |
| Software | Bioworks 3.3 | Thermo Fisher Scientific | For HXMS data processing | |
| Software | HDExaminer | Sierra Analytics | For HXMS data processing | |
| Software | GelQuant Express Analysis Software | Fisher Scientific | For densitometry measurements | |
| Software | Fiji (ImageJ) | National Institutes of Health (NIH) | To analyze images | |
| Software | Prism | GraphPad | For data processing |
Additional files
-
Supplementary file 1
Hydrogen-deuterium exchange mass spectrometry summary table for ISB free protein and ISB droplet protein datasets.
- https://cdn.elifesciences.org/articles/92709/elife-92709-supp1-v2.xlsx
-
Supplementary file 2
List of gene block sequences used to produce IMut1SB, IMut2SB, IMut3SB, IMut4SB, IMut5SB, ISBMut, and IMut6SBMut mutant proteins.
- https://cdn.elifesciences.org/articles/92709/elife-92709-supp2-v2.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/92709/elife-92709-mdarchecklist1-v2.pdf
