Mutant mice lacking alternatively spliced p53 isoforms unveil Ackr4 as a male-specific prognostic factor in Myc-driven B-cell lymphomas
- Genetics of Tumor Suppression, Institut Curie, France
- CNRS UMR3244, France
- Sorbonne University, France
- PSL Research University, France
- Non Coding RNA, Epigenetic and Genome Fluidity, Institut Curie, France
- School of Medicine, Ninewells Hospital, University of Dundee, United Kingdom
Figures
Figure 1 with 1 supplement
The loss of p53-AS isoforms does not alter cellular stress responses or survival to spontaneous tumors.
(A) mRNAs for p53-α and p53-AS isoforms from thymocytes of irradiated mice were quantified by RT-qPCR, and p53-α levels in Trp53+/+ mice were assigned a value of 1. Means ± SEM (n = 3). (B) Protein extracts from thymocytes of Trp53+/+ (WT) or Trp53ΔAS/ΔAS (ΔAS) irradiated mice were immunoblotted with p53 or actin antibodies. After normalization to actin, full-length (FL) p53-α levels in WT thymocytes were assigned a value of 1. (C) mRNA levels of p53 target genes in thymocytes, before or after γ-irradiation. Means ± SEM (n = 3). (D) Thymocyte apoptotic response to γ-irradiation. Means ± SEM (n = 6). (E) Cell cycle control in mouse embryonic fibroblasts (MEFs) after γ-irradiation. Asynchronous MEFs were exposed to 0–10 Gy γ-irradiation, and after 24 hr, cells were labeled with BrdU for 1 hr and analyzed by FACS. Means ± SEM from >3 independent experiments with at least two independent MEF clones per genotype. (F) mRNA levels of p53 target genes in MEFs untreated or treated with 0.5 μg/ml of clastogenic doxorubicin (Doxo) or 10 μM of the Mdm2 antagonist Nutlin. Means ± SEM from >3 experiments with ≥2 independent MEF clones. (G) MEFs proliferation under hyperoxic conditions. Cells were grown according to a 3T3 protocol. Each point is the mean from four independent MEF clones, the value for each clone resulting from triplicates. (H) Growth of tumor xenografts. E1A+Ras-expressing MEFs were injected into the flanks of nude mice and tumor volumes were determined after 1–25 days. Means ± SD (n = 4 per timepoint and genotype). (I) Tumor-free survival of Trp53+/+ and Trp53ΔAS/ΔAS mice (n = cohort size). (J) Incidence of the indicated tumor types, determined at death after macroscopic examination and histological analysis of Trp53+/+ (WT) and Trp53ΔAS/ΔAS (ΔAS) mice. In (A, D, E), ns = non-significant in Student’s t-test.
-
Figure 1—source data 1
Raw unedited gels and blots for Figure 1B.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig1-data1-v2.zip
-
Figure 1—source data 2
Uncropped and labeled gels and blots for Figure 1B.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig1-data2-v2.jpg
Figure 1—figure supplement 1
Description of the Trp53ΔAS mouse model and analysis of Trp53ΔAS/ΔAS thymocytes and fibroblasts.
(A) Relative expression of p53 isoforms with an α or AS C-terminus in tissues of wild-type mice. RNAs were prepared from the indicated tissues of wild-type mice, then p53-AS and p53-α mRNAs were quantified by RT-qPCR. Results are expressed as mean AS/α ratios ± SD, from three independent experiments. (B) Comparative maps of the wild-type (WT) and ΔAS Trp53 alleles. Left, top: the 3’ end of the WT Trp53 gene is shown; black line: intron 10; boxes are for exons, with graytones for translated regions from exon 10 (light gray), exon 11 (dark gray), and exon AS (black). Left, below: the WT Trp53 allele encodes proteins with two different C-termini. (4D: tetramerization domain; CTD: C-terminal domain). Right, top: the 3’ end of the Trp53ΔAS allele is shown; the AS exon was deleted and replaced by a SpeI restriction site. Right, below: the Trp53ΔAS allele only enables the synthesis of proteins with the ‘canonical’ α C-terminus. (C) Quantifications of p53 isoforms with an AS or an α C-terminus, in mouse embryonic fibroblasts (MEFs) of the indicated genotypes, that were either untreated, or treated for 24 hr with 0.5 μg/ml doxorubicin (Doxo) or 10 μM Nutlin. Means ± SEM from >3 experiments with ≥2 independent MEF clones of each genotype are shown. ***p<0.001, *p<0.05, °p=0.07 by Student’s t-test. (D) Apoptotic responses of Trp53+/+ and Trp53ΔAS/ΔAS thymocytes. Trp53+/+ and Trp53ΔAS/ΔAS mice were irradiated and their thymocytes were recovered and analyzed by FACS after annexin V-FITC staining. A typical experiment for cells of each genotype and condition is shown. Numbers indicate % cells, apopt.: apoptotic cells. (E) Cell cycle control of Trp53-/-, Trp53+/+, and Trp53ΔAS/ΔAS fibroblasts. Asynchronous MEFs were exposed to 0–10 Gy γ-irradiation, then after 24 hr cells were labeled with BrdU for 1 hr and analyzed by FACS. A typical experiment for cells of each genotype and condition is shown, with % of cells in G1, S, and G2/M mentioned in each panel. (F) mRNA levels of the indicated genes were quantified in MEFs of the indicated genotypes left untreated or treated for 24 hr with 0.5 μg/ml Doxo or 10 μM Nutlin-3 (Nutlin). Means ± SEM from at least three experiments with two independent MEF clones of Trp53+/+ and Trp53ΔAS/ΔAS genotypes are shown. (G) mRNA levels of the indicated genes were quantified in MEFs of the indicated genotypes left untreated or treated for 24 hr with 15 μM etoposide (Eto). Means ± SEM from at least three experiments with two independent MEF clones per genotype.
Figure 2 with 1 supplement
Male-specific acceleration of Myc-induced B-cell lymphomagenesis in mice lacking p53-AS isoforms.
(A) Tumor-free survival of Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice, classified according to sex (n = cohort size). (B) Tumor volumes upon dissection of Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice, classified according to sex. Means ± SEM from 100 lymph nodes from Trp53+/+ Eμ-Myc males, 96 from Trp53+/+ Eμ-Myc females, 148 from Trp53ΔAS/ΔAS Eμ-Myc males, and 124 from Trp53ΔAS/ΔAS Eμ-Myc females. (C) Myc mRNA and protein levels in lymph node tumors. (D) Levels of p53-α and p53-AS transcripts and p53 protein levels in lymph node tumors. (E) Transcript levels of the indicated p53 target genes. Means ± SEM (n = 6 per genotype). (F, G) Apoptosis (F) and cell proliferation (G) in tumor lymph nodes from Eμ-Myc males were determined by immunohistochemistry with antibodies against cleaved caspase-3 and ki67, respectively. Positive cells were counted and normalized to the analyzed areas. Means ± SEM (n = 6 mice per assay and genotype). In (F, G) scale bars = 50 μm. Statistical analyses with Mantel–Cox (A) and Student’s t (B–G) tests. ***p<0.001, *p<0.05, ns: nonsignificant.
-
Figure 2—source data 1
Raw unedited gels and blots for Figure 2C.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig2-data1-v2.zip
-
Figure 2—source data 2
Raw unedited gels and blots for Figure 2D.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig2-data2-v2.zip
-
Figure 2—source data 3
Uncropped and labeled gels and blots for Figure 2C.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig2-data3-v2.jpg
-
Figure 2—source data 4
Uncropped and labeled gels and blots for Figure 2D.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig2-data4-v2.jpg
Figure 2—figure supplement 1
Analysis of tumors from Trp53+/+ Eμ-myc and Trp53ΔAS/ΔAS Eμ-Myc mice.
(A) Histological analyses of Eμ-Myc-induced tumor lymph nodes. Tumor lymph nodes were analyzed by hematoxilin-eosin staining (H&E), or antibodies against B220 (a B-cell-specific marker) or CD3 (a T-cell-specific marker). Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice developed similar B-cell lymphomas, characterized by massive tissue homogenization of the lymph node by B cells. Scale bars = 50 μM. (B) Tumor-free survival of Trp53+/+ Eμ-myc and Trp53ΔAS/ΔAS Eμ-Myc mice are similar when sexes are not considered (n = cohort size). (C) Increased tumor-free survival of Trp53+/+ Eμ-myc males compared to Trp53ΔAS/ΔAS Eμ-Myc males, Trp53+/+ Eμ-Myc females and Trp53ΔAS/ΔAS Eμ-Myc females (n = cohort size). Statistical analysis with Mantel–Cox test. (D) Trp53 DNA sequencing of Trp53+/+ Eμ-myc and Trp53ΔAS/ΔAS Eμ-Myc tumors. The portion of the Trp53 gene encoding the DNA Binding domain (DBD), most frequently mutated in cancers, was sequenced for 14 tumors from Trp53+/+ (WT) Eμ-myc males and 18 tumors from Trp53ΔAS/ΔAS (ΔAS) Eμ-myc males, and Trp53 mutations were found in 3/14 and 1/18 tumors, respectively. (E) Details on the four p53 mutations identified in (D).
Figure 3 with 1 supplement
The loss of p53-AS isoforms affects Ackr4 expression in Eμ-Myc male mice.
(A) B-cell subpopulations in spleens of 6-week-old Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice. Means ± SEM (n = 6 per genotype). (B, C) RNAseq analysis of spleens from Trp53+/+ Eμ-Myc (n = 3) and Trp53ΔAS/ΔAS Eμ-Myc (n = 4) 4–6-week-old male mice. Volcano plot (B), with differentially expressed genes (DEGs) in red. Unsupervised clustering heatmap plot (C), with DEGs ranked according to mean fold changes, and protein-coding genes in bold. (D) RT-qPCR analysis of candidate DEGs from spleens of Trp53+/+ (p53WT) Eμ-Myc males and Trp53ΔAS/ΔAS (p53ΔAS) Eμ-Myc males. Means ± SEM (n = 3–4 per genotype). (E) RT-qPCR analysis of indicated DEGs from spleens of 4–6-week-old Trp53+/+ Eμ-Myc males, Trp53ΔAS/ΔAS Eμ-Myc males, Trp53+/+ Eμ-Myc females, and Trp53ΔAS/ΔAS Eμ-Myc females. Means ± SEM (n = 3–4 per sex and genotype). (F) Ackr4 is transactivated by p53 in response to stress. Ackr4 mRNAs in untreated or doxorubicin-treated WT and Trp53-/- mouse embryonic fibroblasts (MEFs). Data from 2 to 3 MEFs per genotype (Younger et al., 2015). (G) A putative p53 response element in Ackr4 intron 1. Top: map of the Ackr4 gene. (boxes: exons [brown box: translated region]; black line: intron 1); middle: p53 ChIP in doxorubicin-treated MEFs according to ChIP-Atlas (SRX270554) (Oki et al., 2018); bottom: p53 Response Element (p53RE) consensus sequence (R = G or A, W = A or T, Y = C or T), the putative p53RE and its mutated counterpart. (H) Luciferase assays of the candidate p53RE. A 1.5 kb fragment containing the WT or mutant p53RE was cloned upstream a luciferase reporter, then transfected into Trp53-/- MEFs together with an expression plasmid for full length p53 (FL), p53-AS or the DNA-binding mutant p53R270H (RH). Means ± SEM (n = 4–6). (I) In MEFs, p53 activation leads to an increased Ackr4 expression attenuated by estradiol. Ackr4 and Cdkn1a mRNAs were quantified by RT-qPCR from Trp53+/+ and Trp53ΔAS/ΔAS MEFs, untreated or treated with 10 μM Nutlin and/or 5 μg/ml 17-β estradiol (E2). Means ± SEM from four independent experiments. (J) Evidence for Myc binding at the Mt2 promoter in B cells. ChIP-Atlas reports Myc binding to Mt2 promoter sequences in primary B cells from the lymph nodes of Eμ-Myc mice (SRX353785, SRX353783) and in Eμ-Myc-induced lymphoma cells (SRX522383). Chr: chromosome. (K) Gene set enrichment analysis (GSEA). GSEA, performed in Trp53+/+ Eμ-Myc (WT_Myc) and Trp53ΔAS/ΔAS Eμ-Myc (p53DAS_Myc) male splenic cells, indicated an enrichment of hallmark Myc targets in Trp53ΔAS/ΔAS Eμ-Myc cells. In (A, D, E, F, H, I) **p<0.001, **p<0.01, *p<0.05, °p≤0.057, ns: nonsignificant in Student’s t or Mann–Whitney tests.
Figure 3—figure supplement 1
Analysis of pre-tumoral spleens.
(A) Cell sorting of B-cell subpopulations by FACS. Splenic cells were incubated with DAPI and the following antibodies: APC rat anti-mouse CD45R/B220, FITC rat anti-mouse CD43, PE rat anti-mouse IgM, and BV605 rat anti-mouse IgD. First, the B220+ CD43 cells were selected from DAPI-negative living cells, subsequently yielding four different B subpopulations based on IgM and IgD labeling: IgM-/IgD- pre-B cells (box 1), IgM low/IgD- immature B cells (box 2), IgM high/IgD- transitional B cells (box 3), and IgM+/IgD + mature B cells (box 4). Typical results with a Trp53+/+ Eμ-Myc male mouse and a Trp53ΔAS/ΔAS Eμ-Myc male mouse are shown. (B) The loss of p53-AS isoforms does not impair B-cell differentiation in 6-week-old non-transgenic male mice. Means ± SEM from four mice per genotype. ns: nonsignificant by Student’s t-test. (C) Control for expression of p53-FL, p53-AS, and p53R270H in luciferase assays. As a control to luciferase experiments reported in Figure 3H, protein extracts from Trp53-/- mouse embryonic fibroblasts (MEFs) transfected with expression plasmids for p53-FL, p53-AS, or p53R270H were immunoblotted with antibodies against p53, p21, and actin. Quantifications are relative to actin. p53-FL and p53-AS were expressed at similar levels and both transactivated p21, whereas the DNA-binding mutant p53R270H was expressed at higher amounts but failed to transactivate p21, as expected. nd: not determined.
-
Figure 3—figure supplement 1—source data 1
Raw unedited gels and blots for Figure 3—figure supplement 1C.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig3-figsupp1-data1-v2.zip
-
Figure 3—figure supplement 1—source data 2
Uncropped and labeled gels and blots for Figure 3—figure supplement 1C.
- https://cdn.elifesciences.org/articles/92774/elife-92774-fig3-figsupp1-data2-v2.jpg
Figure 4 with 4 supplements
ACKR4 is a male-specific prognostic factor in Burkitt lymphoma.
(A) In human cells, p53 activation leads to an increased ACKR4 expression abrogated by estradiol. ACKR4 and CDKN1A mRNAs were quantified by RT-qPCR from p53-proficient (MRC5) and p53-deficient (MRC5-SV40) human fibroblasts, untreated or treated with Nutlin and/or estradiol (E2). Means ± SEM from four independent experiments. (B, C) Analysis of lymphoma dataset #GSE4475. ACKR4 gene expression was plotted for all lymphoma patients with clinical follow-up (91 men [M], 68 women [W]), classified according to sex (B, left). Gene expression (B, right) or survival curves (C) were plotted for the 30% patients (27 men, 20 women) with the highest or lowest ACKR4 expression, classified according to sex. (D, E) Analysis of Burkitt lymphoma-specific dataset #phs00235. ACKR4 gene expression was plotted for all patients with a Burkitt lymphoma diagnosed at age 0–17 (48 males, 29 females), classified according to sex (D, left). Gene expression (D, right) or survival curves (E) were plotted for the 30% patients (15 men, 9 women) with the highest or lowest ACKR4 expression, classified according to sex. (F) The knockout of ACKR4 in Burkitt lymphoma Raji cells increases their CCL21-guided migration. Chemotaxis was assayed by using Boyden chambers with bare polycarbonate membranes as previously described (Calpe et al., 2011). Equal number of cells were deposited on the membrane of a transwell insert, then migration was determined by counting cells in the lower compartment, after 15 hr of culture with or without CCL21 added to the lower chamber. Statistical analyses by Student’s t or Mann–Whitney tests (A, B, D, F) and Mantel–Cox (C, E) test. ***p<0.001, **p<0.01, *p<0.01, °p=0.054, ns: nonsignificant.
Figure 4—figure supplement 1
Further analyses of human B-cell lymphoma or multiple myeloma datasets.
(A) MT2A gene expression is not a prognostic marker in human B-cell lymphomas. Survival curves for the 30% patients with the highest MT2A mRNA levels and the 30% patients with the lowest MT2A mRNA levels according to sex (n = cohort sizes), for patients from dataset #GSE4475. (B) ACKR4 is a prognostic factor in Burkitt lymphomas but not in diffuse large B-cell lymphomas. Survival curves of patients from dataset #GSE181063, for the 30% patients with the highest ACKR4 mRNA levels and the 30% patients with the lowest ACKR4 mRNA levels, classified according to sex (n = cohort sizes), and diagnosed with either a diffuse large B-cell (top) or a Burkitt (bottom) lymphoma. (C) ACKR4 is not a prognostic factor in Multiple Myeloma. Survival curves of patients from dataset #GSE136337, for the 30% patients with the highest ACKR4 mRNA levels and the 30% patients with the lowest ACKR4 mRNA levels in malignant plasma cells, classified according to sex (n = cohort sizes). Statistical analyses in all panels by Mantel–Cox test.
Figure 4—figure supplement 2
Strategy to knockout ACKR4 in Burkitt lymphoma cells.
Burkitt lymphoma cells were transfected with a PX459 vector expressing Cas9, a puromycin resistance gene and either of two guide RNAs targeting ACKR4 (or no guide RNA for control), then puromycin-resistant cells were selected and recovered either as cellular pools or diluted to get one cell per five wells in a 96-well plate to isolate cellular clones. Individual clones were then expanded, and clonal cell populations were split for freezing and DNA extraction. DNA was analyzed by performing a PCR amplifying a fragment of ACKR4, then amplified products were cloned in a PGL3 plasmid for DNA sequencing. For each cellular clone, eight plasmid clones were sequenced to ensure information on both ACKR4 alleles.
Figure 4—figure supplement 3
Characterization of ACKR4 KO Burkitt lymphoma cell clones.
(A) Characterization of the ACKR4 KO 4.14 clone. Left, DNA sequences of the region targeted by the guide RNA g4. Compared to the WT ACKR4 DNA sequence from Burkitt lymphoma (BL) Raji control cells (center), the 4.14 clone has two mutated alleles: allele a, with a deletion of 17 nt (top) and allele b, with a deletion of 4 nt (bottom). Right, comparison of the ACKR4 proteins encoded by WT alleles from BL Raji control cells (center), or by the 4.14a (top) and 4.14b mutated alleles (bottom). The WT ACKR4 protein consists of 350 amino acids, including a DRY motif (at residues 136–138) essential for signal transduction. The protein region corresponding to the target of guide RNA g4 is indicated. Allele 4.14a encodes a putative protein with 59 N-terminal residues of ACKR4 and 34 amino acids of unrelated sequence due to the mutational frameshift. Allele 4.14b encodes a putative protein with 60 N-terminal residues of ACKR4. (B) Characterization of the ACKR4 KO 5.2 clone. DNA sequences of the region targeted by the guide RNA g5 (left) and comparison of the encoded ACKR4 proteins (right), are represented as in (A).
Figure 4—figure supplement 4
The knockout of ACKR4 in Burkitt lymphoma Raji cells does not impact their proliferation.
Equal numbers of cells of the indicated genotypes were seeded, then cultured for 15 hr with or without CCL21 and counted. Statistical analyses by Student’s t-test. ns: nonsignificant.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Trp53 | GenBank | ENSMUSG00000059552 | |
| Gene (M. musculus) | Ackr4 | GenBank | ENSMUSG00000079355 | |
| Gene (M. musculus) | Mt2 | GenBank | ENSMUSG00000031762 | |
| Gene (Homo sapiens) | ACKR4 | GenBank | ENSMUSG00000129048 | |
| Strain, strain background (M. musculus, both sexes) | Trp53ΔAS, C57Bl/6J | Simeonova et al., 2013 | ||
| Strain, strain background (M. musculus, both sexes) | Eμ−Myc, C57Bl/6J | Jackson Labs | B6.Cg-Tg(IghMyc)22Bri/J | |
| Strain, strain background (M. musculus, females) | CD-1 Nude CD-1 | Charles River Labs | Crl:CD1-Foxn1nu | |
| Strain, strain background (M. musculus, both sexes) | C57Bl/6J | Charles River Labs | ||
| Cell line (M. musculus, both sexes) | WT, Trp53+/ΔAS, Trp53ΔAS/ΔAS, Trp53+/-, Trp53-/- fibroblasts | This paper | Primary fibroblasts prepared from E13.5 days embryos | ‘Cells and cell culture reagents’ |
| Cell line (H. sapiens, male) | MRC5 | Sigma-Aldrich | MRC5 PD19 (#05072101) | |
| Cell line (H. sapiens, male) | MRC5-SV40 | Sigma-Aldrich | MRC5-SV2 (#84100401) | |
| Cell line (H. sapiens, female) | HEK293T | ATCC | CRL-3216 | |
| Cell line (H. sapiens, male) | Raji | ATCC | CCL-86 | |
| Cell line (H. sapiens, male) | Raji ACKR4 KO | This paper | ACKR4 KO 4.14 & 5.2 Raji derivatives | Figure 4—figure supplement 3 |
| Transfected construct (Adenoviral E1A) | pWZL-E1A12S | Addgene | pWZL hygro 12S E1A (#18748) | |
| Transfected construct (human Ras) | pBabe-Hrasv12 | Addgene | pBabe-puro Ras v12 (# 1768) | |
| Antibody | p53 (rabbit polyclonal) | Novocastra | Leica NCL-p53-CM5p | 1/2000 |
| Antibody | Myc (mouse monoclonal) | Santa Cruz | 9E-10 sc40 | 1/1000 |
| Antibody | p21 (mouse monoclonal) | Santa Cruz | F-5 sc6246 | 1/200 |
| Antibody | Actin (mouse monoclonal) | Santa Cruz | Actin-HRP sc47778 | 1/5000 |
| Antibody | CD45R/B220 APC (rat, monoclonal) | BD Biosciences | Anti-mouse CD45R/B220 APC (#561880) | 1/200 |
| Antibody | IgD (rat, monoclonal) | BD Biosciences | Anti-mouse IgD BV 605 (#563003) | 1/100 |
| Antibody | CD43 (rat, monoclonal) | BD Biosciences | Anti-mouse CD43 FITC (#561856) | 1/200 |
| Antibody | IgM (rat, monoclonal) | BD Biosciences | Anti-mouse IgM PE (#562033) | 1/50 |
| Recombinant DNA reagent | pSpCas9(BB)–2A-Puro | Addgene | PX459 (#48139) | |
| Sequence-based reagent | Trp53α-F | This paper | qPCR primer | AAAGGATGCCCATGCTACAGA; Figure 1—figure supplement 1 |
| Sequence-based reagent | Trp53α-R | This paper | qPCR primer | TCTTGGTCTTCAGGTAGCTGGAG; Figure 1—figure supplement 1 |
| Sequence-based reagent | Trp53AS-F | This paper | qPCR primer | AAAGGATGCCCATGCTACAGA; Figure 1—figure supplement 1 |
| Sequence-based reagent | Trp53AS-R | This paper | qPCR primer | TGAAGTGATGGGAGCTAGCAGTT; Figure 1—figure supplement 1 |
| Sequence-based reagent | Ackr4-F | This paper | qPCR primer | GCACCTCTCCCAGCTTAAACA; Figure 3 |
| Sequence-based reagent | Ackr4-R | This paper | qPCR primer | AATAGTATTCCGCTGACTGGTTCAG; Figure 3 |
| Sequence-based reagent | ACKR4-F | This paper | qPCR primer | ACTGCTCCTCTCTGCCGACTAC; Figure 4 |
| Sequence-based reagent | ACKR4-R | This paper | qPCR primer | GCCATTCATTTCATTTTCCTCAT; Figure 4 |
| Sequence-based reagent | ACKR4-g4 | This paper | Guide for CRISPR #4 | TGGTAGTGGCAATTTATGCC; Figure 4—figure supplement 3 |
| Sequence-based reagent | ACKR4-g5 | This paper | Guide for CRISPR #5 | GGGCTGTTAATGCAGTTCAT; Figure 4—figure supplement 3 |
| Peptide, recombinant protein | CCL21 | Preprotech | #300-35A | |
| Peptide, recombinant protein | Superscript IV | Invitrogen | TF #18090010 | |
| Commercial assay or kit | Nucleospin RNA II | Macherey-Nagel | FS #NZ74095520 | |
| Commercial assay or kit | Power SYBR Green | Applied Biosystems | # 4367659 | |
| Commercial assay or kit | Supersignal West Femto | Thermo Fisher | # 34096 | |
| Commercial assay or kit | AnnexinV-FITC apoptosis staining/ detection kit | Abcam | # Ab14085 | |
| Commercial assay or kit | Truseq stranded Total RNA | Illumina | #20020596 | |
| Commercial assay or kit | Nucleofector Amaxa kit V | Lonza | # VCA-1003 | |
| Chemical compound, drug | Doxorubicin | Sigma-Aldrich | # D1515 | |
| Chemical compound, drug | Etoposide | Sigma-Aldrich | # E1383 | |
| Chemical compound, drug | Nutlin 3a | Sigma-Aldrich | # SML-0580 | |
| Chemical compound, drug | 17β-estradiol | Sigma-Aldrich | # E2758 | |
| Software, algorithm | FlowJo | Beckton-Dickinson | RRID:SCR_008520 | v 10.10 |
| Software, algorithm | featureCounts | Liao et al., 2014 | ||
| Software, algorithm | DESeq2 R package | Love et al., 2014 | ||
| Software, algorithm | GSEA software | Subramanian et al., 2005 | ||
| Software, algorithm | PWMScan | Ambrosini et al., 2018 | ||
| Software, algorithm | CRISPOR | Haeussler et al., 2016 | ||
| Software, algorithm | Prism | GraphPad | RRID:SCR_002798 | v 5.0 |
Additional files
-
Supplementary file 1
Expression of Ackr4, Cdkn1a, and Mdm2 in Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc male splenic cells.
Read numbers for the indicated genes, obtained by Bulk RNA-seq from the spleens of three Trp53+/+ Eμ-Myc (WT_Myc) and four Trp53ΔAS/ΔAS Eμ-Myc (ΔAS_Myc) male mice.
- https://cdn.elifesciences.org/articles/92774/elife-92774-supp1-v2.docx
-
Supplementary file 2
Details of the gene set enrichment analysis (GSEA) for hallmark Myc targets.
Datasets from Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc male splenic cells were analyzed by GSEA. A normalized enrichment score of 2.4965038 was found for the gene set 'Hallmark_Myc_targets_V1' in Trp53ΔAS/ΔAS Eμ-Myc males. The table provides details on the profile represented in Figure 3K, with scores and positions of gene set members on the rank ordered list.
- https://cdn.elifesciences.org/articles/92774/elife-92774-supp2-v2.xlsx
-
Supplementary file 3
Oligonucleotide sequences.
- https://cdn.elifesciences.org/articles/92774/elife-92774-supp3-v2.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/92774/elife-92774-mdarchecklist1-v2.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Mutant mice lacking alternatively spliced p53 isoforms unveil Ackr4 as a male-specific prognostic factor in Myc-driven B-cell lymphomas
eLife 13:RP92774.
https://doi.org/10.7554/eLife.92774.3
