Autophagosome development and chloroplast segmentation occur synchronously for piecemeal degradation of chloroplasts
- Frontier Research Institute for Interdisciplinary Sciences (FRIS), Tohoku University, Japan
- Center for Sustainable Resource Science (CSRS), RIKEN, Japan
- Exploratory Research Center on Life and Living Systems (ExCELLs), National Institutes of Natural Sciences, Japan
- National Institute for Physiological Sciences, National Institutes of Natural Sciences, Japan
- The Graduate University for Advanced Studies, SOKENDAI, Japan
- Research Institute for Electronic Science, Hokkaido University, Japan
- Graduate School of Medicine, Juntendo University, Japan
- Graduate School of Agricultural Science, Tohoku University, Japan
- Graduate School of Life Sciences, Tohoku University, Japan
Figures
Figure 1 with 2 supplements
Chloroplast buds are released in sugar-starved leaves.
Time-lapse observations of three-dimensional (3D) reconstructed chloroplast morphology in Arabidopsis mesophyll cells accumulating chloroplast stroma–targeted fluorescent markers. A leaf from a …
Figure 1—figure supplement 1
Accumulation of chloroplast stroma components in the vacuole via autophagy.
Confocal images of mesophyll cells from wild-type (A) or atg7 (B) plants accumulating the chloroplast stroma marker RBCS-mRFP. Second rosette leaves of 21-day-old plants were excised and incubated …
-
Figure 1—figure supplement 1—source data 1
Source data for the graph in Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig1-figsupp1-data1-v1.zip
Figure 1—figure supplement 2
The release of chloroplast buds by autophagy contributes to the decline in chloroplast stroma volume.
(A) Orthogonal projections produced from z-stack images (30 µm in depth) of mesophyll cells from wild-type (WT) or atg7 leaves accumulating the chloroplast stroma marker RBCS-mRFP. Second rosette …
-
Figure 1—figure supplement 2—source data 1
Source data for the graph in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig1-figsupp2-data1-v1.zip
Figure 2 with 2 supplements
Chloroplast buds containing stroma and envelope components are released from the chloroplasts.
Time-lapse observations of Arabidopsis mesophyll cells accumulating the chloroplast stroma marker along with an envelope marker or a thylakoid membrane marker. Leaves accumulating stromal RBCS-GFP …
-
Figure 2—source data 1
Source data for the graphs in Figure 2.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Chloroplast buds contain stroma and envelope proteins.
Second rosette leaves accumulating stromal RBCS-GFP along with outer envelope membrane–bound TOC64-mRFP (A), inner envelope membrane–bound KEA1-mRFP (B), or thylakoid membrane–bound ATPC1-tagRFP (C) …
-
Figure 2—figure supplement 1—source data 1
Source data for the graphs in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig2-figsupp1-data1-v1.zip
Figure 2—figure supplement 2
A released chloroplast bud contains an inner envelope marker protein.
Time-lapse observations of Arabidopsis mesophyll cells accumulating the chloroplast stroma marker RBCS-GFP along with inner envelope membrane–bound KEA1-mRFP. The second rosette leaf from a …
Figure 3 with 1 supplement
Tracking the transport of a Rubisco-containing body (RCB).
A leaf accumulating chloroplast stroma–targeted GFP (CT-GFP) was incubated in sugar-free solution in darkness for 6 hr from dawn, and the transport of an RCB was tracked. The second rosette leaf …
-
Figure 3—source data 1
Source data for the graph in Figure 3.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Rubisco-containing bodies (RCBs) appear to begin random movement during their tracking.
A leaf accumulating RBCS-tagRFP (A) or RBCS-EYFP (B) was incubated in sugar-free solution in the dark for 7–8 hr from dawn, and the transport of an RCB was tracked. Second rosette leaves from …
Figure 4 with 1 supplement
Dynamics of the vacuolar membrane during the incorporation of Rubisco-containing bodies (RCBs).
Leaves accumulating the chloroplast stroma marker RBCS-mRFP along with the vacuolar membrane marker VHP1-mGFP were incubated in sugar-free solution in darkness for 6–8 hr from dawn, and the behavior …
Figure 4—figure supplement 1
Additional observations of the incorporation of Rubisco-containing bodies (RCBs) into the vacuolar lumen.
Additional time-lapse data of the experiments described in Figure 4. The second rosette leaves from 21- (A) or 24-day-old (B, C) plants were used. The images in (A), (B) and (C) are still frames …
Figure 5 with 1 supplement
Autophagy deficiency does not increase the number of chloroplast protrusions during a 1-day dark treatment.
Leaves from wild-type (WT), atg5, or atg7 plants accumulating the chloroplast stroma marker RBCS-mRFP were incubated in sugar-free solution containing 1 µM concanamycin A (concA) for 1 day in …
-
Figure 5—source data 1
Source data for the graphs in Figure 5.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig5-data1-v1.zip
Figure 5—figure supplement 1
Chloroplast protrusions do not increase in atg2 or atg10 mutant leaves during a 1-day dark treatment.
The experiments described in Figure 5 were performed on leaves from wild-type (WT), atg2, or atg10 plants accumulating the chloroplast stroma marker RBCS-mRFP. Second rosette leaves from 21-day-old …
-
Figure 5—figure supplement 1—source data 1
Source data for the graphs in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig5-figsupp1-data1-v1.zip
Figure 6 with 4 supplements
The formation of a chloroplast bud and the maturation of the chloroplast-associated isolation membrane occur concomitantly.
Leaves accumulating the chloroplast stroma marker, RBCS-mRFP (A) or CT-DsRed (B), and the isolation membrane marker GFP-ATG8a were incubated in sugar-free solution in darkness for 6 hr from dawn (A) …
-
Figure 6—source data 1
Source data for the graphs in Figure 6.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Another observation of the budding of the isolation membrane–associated site in a chloroplast.
(A) A leaf accumulating the chloroplast stroma marker CT-DsRed and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in darkness for 6 hr from dawn and then observed. A …
-
Figure 6—figure supplement 1—source data 1
Source data for the graphs in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig6-figsupp1-data1-v1.xlsx
Figure 6—figure supplement 2
Chloroplast buds surrounded by the isolation membrane appear in multiple chloroplasts.
A leaf accumulating the chloroplast stroma marker RBCS-tagRFP and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in darkness for 5 hr from dawn and then observed. A …
Figure 6—figure supplement 3
Proportion of chloroplast buds engulfed by GFP-ATG8a-labeled isolation membranes.
Leaves accumulating the chloroplast stroma marker RBCS-mRFP and the isolation membrane marker GFP-ATG8a were incubated in sugar-free solution in the dark for 5–9 hr from dawn, and chloroplast …
-
Figure 6—figure supplement 3—source data 1
Source data for the graphs in Figure 6—figure supplement 3.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig6-figsupp3-data1-v1.xlsx
Figure 6—figure supplement 4
Proportion of GFP-ATG8a-labeled structures that are associated with chloroplasts.
Leaves accumulating the chloroplast stroma marker RBCS-mRFP and the isolation membrane marker GFP-ATG8a were incubated in sugar-free solution in the dark for 5–9 hr from dawn, and GFP-ATG8a-labeled …
-
Figure 6—figure supplement 4—source data 1
Source data for the graph in Figure 6—figure supplement 4.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig6-figsupp4-data1-v1.xlsx
Figure 7 with 3 supplements
Diminished salicylic acid signal suppresses stromule formation in autophagy-deficient mutants.
(A) Orthogonal projections produced from z-stack images (10 μm in depth) of guard cells from wild-type (WT), atg5, NahG, and atg5 NahG leaves accumulating chloroplast stroma−targeted GFP (CT-GFP). …
-
Figure 7—source data 1
Source data for the graphs in Figure 7.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig7-data1-v1.zip
Figure 7—figure supplement 1
Autophagy deficiency activates stromule formation from mesophyll chloroplasts accumulating RBCS-mRFP in senescing leaves.
(A) Orthogonal projections produced from z-stack images (15 µm in depth) of mesophyll cells from leaves of wild-type (WT), atg5, and atg7 plants accumulating RBCS-mRFP. Third rosette leaves from …
-
Figure 7—figure supplement 1—source data 1
Source data for the graph in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig7-figsupp1-data1-v1.zip
Figure 7—figure supplement 2
Autophagy deficiency does not activate stromule formation from mesophyll chloroplasts in young leaves.
Orthogonal projections produced from z-stack images (15 µm in depth) of mesophyll cells from wild-type (WT), atg5, atg7, sid2, sid2 atg5, and sid2 atg7 leaves accumulating CT-GFP. Third rosette …
Figure 7—figure supplement 3
NahG expression does not counteract the increase in hydrogen peroxide (H2O2) content produced by the atg5 mutation.
H2O2 contents in third rosette leaves from 36-day-old plants. Wild-type (WT) plants without any transgenic construct and CT-GFP-expressing plants in the WT, atg5, NahG, and atg5 NahG backgrounds …
-
Figure 7—figure supplement 3—source data 1
Source data for the graph in Figure 7—figure supplement 3.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig7-figsupp3-data1-v1.zip
Figure 8 with 2 supplements
DRP5B is dispensable for chloroplast autophagy in sugar-starved leaves.
(A) Confocal images of mesophyll cells from wild-type (WT) and drp5b leaves accumulating the stroma marker RBCS-mRFP. Second rosette leaves from 21-day-old plants were incubated in sugar-free …
-
Figure 8—source data 1
Original files for western blot analysis displayed in Figure 8C.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig8-data1-v1.zip
-
Figure 8—source data 2
PDF file containing original western blots for Figure 8C, indicating the relevant bands, genotypes, and conditions.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig8-data2-v1.zip
-
Figure 8—source data 3
Source data for the graphs in Figure 8.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig8-data3-v1.zip
Figure 8—figure supplement 1
Production of Rubisco-containing bodies (RCBs) in drp5b mutants is ATG5 dependent.
(A) Confocal images of mesophyll cells from wild-type (WT), atg5, drp5b, and drp5b atg5 leaves accumulating the stroma marker CT-GFP. Second rosette leaves from 21-day-old plants were incubated in …
-
Figure 8—figure supplement 1—source data 1
Source data for the graph in Figure 8—figure supplement 1.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig8-figsupp1-data1-v1.zip
Figure 8—figure supplement 2
Vacuolar accumulation of stromal marker proteins in sugar-starved leaves.
(A) Confocal images of mesophyll cells from wild-type (WT), drp5b, atg5, and atg7 leaves accumulating the stroma marker RBCS-mRFP. Second rosette leaves from 21-day-old plants were incubated in …
-
Figure 8—figure supplement 2—source data 1
Source data for the graph in Figure 8—figure supplement 2.
- https://cdn.elifesciences.org/articles/93232/elife-93232-fig8-figsupp2-data1-v1.zip
Figure 9
Formation and segmentation of chloroplast buds in leaves of the drp5b mutant.
(A) A leaf from the drp5b mutant accumulating the stroma marker RBCS-mRFP was incubated in sugar-free solution in darkness for 5 hr from dawn and then observed. Arrowheads indicate a chloroplast …
Author response image 1
Mesophyll cells in a leaf of atg7 accumulating stromal CT-GFP, reconstructed from the data shown in the previous version of Figure 7–figure supplement 1.
(A) Individual channel images (CT-GFP and chlorophyll) from the merged orthogonal projection image shown in the previous version of Figure 7–figure supplement 1. The right panel shows the enhanced …
Videos
Video 1
Release of a chloroplast bud as visualized by chloroplast stroma–targeted GFP.
The second rosette leaf from a 21-day-old plant accumulating the chloroplast stroma–targeted GFP (CT-GFP) was incubated in sugar-free solution in darkness for time-lapse imaging with a two-photon …
Video 2
Release of a chloroplast bud as visualized by RBCS-mRFP.
The second rosette leaf from a 22-day-old plant accumulating the chloroplast stroma marker RBCS-mRFP was incubated in sugar-free solution in darkness for time-lapse imaging with a two-photon …
Video 3
Tracking of the stroma marker and chlorophyll fluorescence during the release of a chloroplast bud.
The second rosette leaf from a 20-day-old plant accumulating the chloroplast stroma marker RBCS-EYFP was incubated in sugar-free solution in darkness for time-lapse imaging with a two-photon …
Video 4
A released chloroplast bud contains the outer envelope marker TOC64-mRFP.
The second rosette leaf from a 21-day-old plant accumulating the chloroplast stroma marker RBCS-GFP and the outer envelope marker TOC64-mRFP was incubated in sugar-free solution in darkness for …
Video 5
A released chloroplast bud contains the inner envelope marker KEA1-mRFP.
The second rosette leaf from a 22-day-old plant accumulating the chloroplast stroma marker RBCS-GFP and the inner envelope marker KEA1-mRFP was incubated in sugar-free solution in the dark for …
Video 6
A released chloroplast bud does not contain the thylakoid membrane marker ATPC1-tagRFP.
The second rosette leaf from a 21-day-old plant accumulating the chloroplast stroma marker RBCS-GFP and the thylakoid membrane marker ATPC1-tagRFP was incubated in sugar-free solution in darkness …
Video 7
Tracking of a Rubisco-containing body (RCB) marked by CT-GFP.
The second rosette leaf from a 21-day-old plant accumulating chloroplast stroma–targeted GFP (CT-GFP) was incubated in sugar-free solution in darkness for time-lapse monitoring of an RCB marked by …
Video 8
Tracking of a Rubisco-containing body (RCB) marked by RBCS-tagRFP.
The second rosette leaf from a 22-day-old plant accumulating stromal RBCS-tagRFP was incubated in sugar-free solution in the dark for time-lapse monitoring of an RCB marked by RBCS-tagRFP. Arrowhead …
Video 9
Tracking of a Rubisco-containing body (RCB) marked by RBCS-EYFP.
The second rosette leaf from a 22-day-old plant accumulating stromal RBCS-EYFP was incubated in sugar-free solution in the dark for time-lapse monitoring of an RCB marked by RBCS-EYFP. Arrowhead …
Video 10
Incorporation of a Rubisco-containing body (RCB) into the vacuolar lumen.
The second rosette leaf from a 21-day-old plant accumulating the chloroplast stroma marker RBCS-mRFP along with the vacuolar membrane marker VHP1-mGFP was incubated in sugar-free solution in …
Video 11
Video 2 of the vacuolar incorporation of a Rubisco-containing body (RCB).
Video 12
Video 3 of the vacuolar incorporation of a Rubisco-containing body (RCB).
Video 13
Video 4 of the vacuolar incorporation of a Rubisco-containing body (RCB).
Video 14
Video 5 of the vacuolar incorporation of a Rubisco-containing body (RCB).
Video 15
Budding of the isolation membrane–associated site within a chloroplast.
The second rosette leaf from a 23-day-old plant accumulating the chloroplast stroma marker RBCS-mRFP and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in darkness for …
Video 16
Autophagosome development and chloroplast segmentation occur concomitantly.
The second rosette leaf from a 23-day-old plant accumulating the chloroplast stroma–targeted DsRed (CT-DsRed) and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in …
Video 17
Another time-lapse assay showing the concomitant progression of autophagosome development and chloroplast segmentation.
The second rosette leaf from a 22-day-old plant accumulating the chloroplast stroma–targeted DsRed (CT-DsRed) and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in …
Video 18
Autophagy-related chloroplast segmentation occurs in sequence.
The second rosette leaf from a 21-day-old plant accumulating the chloroplast stroma marker RBCS-tagRFP and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in darkness …
Video 19
Release of a chloroplast bud in a sugar-starved leaf of the drp5b mutant.
The second rosette leaf from a 21-day-old drp5b plant accumulating the chloroplast stroma marker RBCS-mRFP was incubated in sugar-free solution in darkness for time-lapse imaging. Arrowhead …
Video 20
An enlarged chloroplast caused by the drp5b mutation forms Rubisco-containing bodies (RCBs) along the isolation membrane−associated sites.
The second rosette leaf from a 22-day-old drp5b plant accumulating the chloroplast stroma marker RBCS-mRFP and the isolation membrane marker GFP-ATG8a was incubated in sugar-free solution in …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Arabidopsis thaliana) | RBCS2B | TAIR | AT5G38420 | |
| Gene (A. thaliana) | VHP1 | TAIR | AT1G15690 | |
| Gene (A. thaliana) | TOC64-III | TAIR | AT3G17970 | |
| Gene (A. thaliana) | ATG8a | TAIR | AT4G21980 | |
| Gene (A. thaliana) | ATPC1 | TAIR | AT4G04640 | |
| Gene (A. thaliana) | KEA1 | TAIR | AT1G01790 | |
| Genetic reagent (A. thaliana) | atg5-1 | ABRC | SAIL_129_B07 | |
| Genetic reagent (A. thaliana) | atg7-2 | ABRC | GABI_655B06 | |
| Genetic reagent (A. thaliana) | atg2-1 | ABRC | SALK_076727 | |
| Genetic reagent (A. thaliana) | atg10-1 | ABRC | SALK_084434 | |
| Genetic reagent (A. thaliana) | drp5b (arc5-2) | ABRC | SAIL_71_D11 | |
| Genetic reagent (A. thaliana) | sid2-2 | ABRC | CS16438 | |
| Genetic reagent (A. thaliana) | NahG atg5-1 | 10.1105/tpc.109.068635 | ||
| Genetic reagent (A. thaliana) | sid2-2 atg5-1 | 10.1105/tpc.109.068635 | ||
| Genetic reagent (A. thaliana) | Pro35S:CT-GFP | 10.1126/science.276.5321.2039 | ||
| Genetic reagent (A. thaliana) | Pro35S:CT-DsRed | 10.1093/pcp/pcab084 | ||
| Genetic reagent (A. thaliana) | ProRBCS:RBCS-GFP | 10.1104/pp.108.122770 | ||
| Genetic reagent (A. thaliana) | ProVHP1:VHP1-mGFP | 10.1105/tpc.114.127571 | ||
| Genetic reagent (A. thaliana) | ProUBQ:GFP-ATG8a | 10.1093/pcp/pcaa162 | ||
| Genetic reagent (A. thaliana) | ProTOC64:TOC64-mRFP | 10.26434/chemrxiv-2023-kx6gp | ||
| Genetic reagent (A. thaliana) | ProRBCS:RBCS-EYFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Genetic reagent (A. thaliana) | ProRBCS:RBCS-mRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Genetic reagent (A. thaliana) | ProRBCS:RBCS-tagRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Genetic reagent (A. thaliana) | ProATPC1:ATPC1-tagRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Genetic reagent (A. thaliana) | ProKEA1:KEA1-mRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Antibody | Anti-RFP (Mouse, monoclonal) | MBL | M204-3 | (1:2000) |
| Antibody | Anti-cFBPase (Rabbit, polyclonal) | Agrisera | AS04043 | (1:5000) |
| Recombinant DNA reagent | ProRBCS:RBCS-EYFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Recombinant DNA reagent | ProRBCS:RBCS-mRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Recombinant DNA reagent | ProRBCS:RBCS-tagRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Recombinant DNA reagent | ProATPC1:ATPC1-tagRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Recombinant DNA reagent | ProKEA1:KEA1-mRFP | This paper | See ‘Plant materials’ in Materials and methods | |
| Sequence-based reagent | ATPC1_F | This paper | PCR primers (cloning) | CACCCATGGAGAGGGCTCGTACCTTAC |
| Sequence-based reagent | ATPC1_R | This paper | PCR primers (cloning) | AACCTGTGCATTAGCTCCAG |
| Sequence-based reagent | KEA1_F | This paper | PCR primers (cloning) | AGGAACCAATTCAGTCGACTCATGATCATAACAAGTCTC |
| Sequence-based reagent | KEA1_R | This paper | PCR primers (cloning) | AAAGCTGGGTCTAGATATCCGATTACGACTGTGCCTCCTTC |
| Commercial assay or kit | Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit | Invitrogen | A22188 | |
| Chemical compound, drug | Concanamycin A | Santa Cruz | sc-202111 | |
| Software, algorithm | ZEN | Carl Zeiss | RRID:SCR_013672 | Image processing and quantification (microscopy) |
| Software, algorithm | NIS-Elements C | Nikon | RRID:SCR_020318 | Image processing and quantification (microscopy) |
| Software, algorithm | LAS X | Leica | RRID:SCR_013673 | Image processing and quantification (microscopy) |
| Software, algorithm | Imaris | Bitplane | RRID:SCR_007370 | Image processing and quantification (microscopy) |
| Software, algorithm | Image lab | Bio-Rad | RRID:SCR_014210 | Image processing and quantification (western blot) |
| Software, algorithm | JMP14 | SAS | RRID:SCR_022199 | Statistics |
