A hepatocyte-specific transcriptional program driven by Rela and Stat3 exacerbates experimental colitis in mice by modulating bile synthesis
- Immunometabolism Laboratory, National Institute of Immunology, India
- System Immunology Laboratory, National Institute of Immunology, India
- Department of GastroEnterology, All India Institute of Medical Sciences, India
- Center for Cellular and Molecular Biology, India
- Gaikwad Steroidomics Lab LLC, United States
- Department of Biology, Indian Institute of Science Education and Research, India
Figures
Figure 1 with 1 supplement
Initiation of colitis in mice leads to hepatic Rela and Stat3 activation.
(A) GO pathway enrichment analysis was done for DEGs with adjusted p-value <0.05 on day 6 post DSS treatment. Bubble plot depicts the enrichment of pathways on day 6 for different genotypes, where …
-
Figure 1—source data 1
Table containing all the significantly regulated GO terms of which few are plotted in Figure 1A.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-data1-v1.docx
-
Figure 1—source data 2
Data used for generating graph in Figure 1E.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-data2-v1.docx
-
Figure 1—source data 3
Labeled and unedited blots shown in Figure 1D.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-data3-v1.pdf
-
Figure 1—source data 4
Zipped folder of the original blots shown in Figure 1D.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-data4-v1.zip
Figure 1—figure supplement 1
Biochemical, histological and molecular characterization of mice liver upon colitis induction.
(a) Violin plot comparing the clinical parameters in serum of untreated and dextran sodium sulfate (DSS)-treated wild-type mice (n=3) (b) Liver sections from untreated and DSS-treated wild-type mice …
-
Figure 1—figure supplement 1—source data 1
Data used for generating graph in Figure 1—figure supplement 1a.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-figsupp1-data1-v1.docx
-
Figure 1—figure supplement 1—source data 2
Labeled and unedited blots shown in Figure 1—figure supplement 1e.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-figsupp1-data2-v1.pdf
-
Figure 1—figure supplement 1—source data 3
Zipped folder of the original blots in Figure 1—figure supplement 1e.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig1-figsupp1-data3-v1.zip
Figure 2 with 1 supplement
Rela and Stat3 deficiency in hepatocytes ameliorates dextran sodium sulfate (DSS)-induced acute colitis in mice.
(A) Line plot charting disease activity index of wild-type, RelaΔhep, Stat3Δhep, and RelaΔhepStat3Δhep littermate mice subjected to treatment with 2% DSS for 6 days. (B) Bar plot depicting colon …
-
Figure 2—source data 1
Data used for generating graph in Figure 2A.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-data1-v1.docx
-
Figure 2—source data 2
Data used for generating graph in Figure 2B.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-data2-v1.docx
-
Figure 2—source data 3
Data used for generating graph in Figure 2D.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-data3-v1.docx
-
Figure 2—source data 4
Data used for generating graph in Figure 2E.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-data4-v1.docx
Figure 2—figure supplement 1
Methods for characterization of mice strain and analysis of colon pathology of colitogenic mice.
Characterization of mice strain by (a) genotyping and (b) western blotting; WTE - whole tissue extract. (c) Representative images of the colon from untreated and dextran sodium sulfate (DSS)-treated …
-
Figure 2—figure supplement 1—source data 1
Labeled and unedited gel shown in Figure 2—figure supplement 1a.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-figsupp1-data1-v1.pdf
-
Figure 2—figure supplement 1—source data 2
Zipped folder of the original gel shown in Figure 2—figure supplement 1a.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-figsupp1-data2-v1.zip
-
Figure 2—figure supplement 1—source data 3
Labeled and unedited blot shown in Figure 2—figure supplement 1b.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-figsupp1-data3-v1.pdf
-
Figure 2—figure supplement 1—source data 4
Zipped folder of the original blot shown in Figure 2—figure supplement 1b.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-figsupp1-data4-v1.zip
-
Figure 2—figure supplement 1—source data 5
Data used for generating graph in Figure 2—figure supplement 1d.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig2-figsupp1-data5-v1.docx
Figure 3 with 1 supplement
Charting hepatic gene expressions in colitogenic wild-type and RelaΔhepStat3Δhep mice.
(A) Principal component analysis (PCA) plot illustrating the hepatic transcriptome, identified through global RNA-seq analyses, of untreated or dextran sodium sulfate (DSS)-treated wild-type and Rela…
-
Figure 3—source data 1
Table containing all the significantly regulated GO terms of which few are plotted in Figure 3B.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig3-data1-v1.docx
-
Figure 3—source data 2
Data used for generating graph in Figure 3C.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig3-data2-v1.docx
-
Figure 3—source data 3
Data used for generating graph in Figure 3E.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig3-data3-v1.docx
-
Figure 3—source data 4
Table containing the demography of the control and UC patient for which the bile acids have been quantitated.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig3-data4-v1.docx
Figure 3—figure supplement 1
Analysis of biochemical and molecular parameters of colitogenic wildtype and RelaΔhepStat3Δhep mice.
(a) Violin plot comparing the clinical parameters in serum of untreated and dextran sodium sulfate (DSS)-treated RelaΔhepStat3Δhep mice (n=3) (b) Liver sections from untreated and DSS-treated RelaΔhe…
-
Figure 3—figure supplement 1—source data 1
Data used for generating graph in Figure 3—figure supplement 1a.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig3-figsupp1-data1-v1.docx
Figure 4 with 1 supplement
Altered accumulation of primary bile acids in RelaΔhepStat3Δhep mice accompanies a less severe inflammatory signature in the colitogenic gut.
Targeted LC-MS-based quantification of primary bile acid in the liver (A) and the colon (B) of dextran sodium sulfate (DSS)-treated wild-type and RelaΔhepStat3Δhep mice (n=5). (C) RT-qPCR analyses …
-
Figure 4—source data 1
Data used for generating graph in Figure 4A.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig4-data1-v1.docx
-
Figure 4—source data 2
Data used for generating graph in Figure 4B.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig4-data2-v1.docx
-
Figure 4—source data 3
Data used for generating graph in Figure 4C.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig4-data3-v1.docx
-
Figure 4—source data 4
Data used for generating graph in Figure 4D.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig4-data4-v1.docx
Figure 4—figure supplement 1
Microscopic analysis of immune cell infilteration in the colon of colitogenic mice.
(a) Representative images of colon tissue stained with indicated immune cell markers, DAPI, and merged section in the dextran sodium sulfate (DSS)-treated wild-type and RelaΔhepStat3Δhep mice. Scale …
Figure 5 with 1 supplement
Supplementing chenodeoxycholic acid (CDCA) restores the colitogenic sensitivity in RelaΔhepStat3Δhep mice.
(A) Line plot charting the disease activity in a time course of wild-type and RelaΔhepStat3Δhep mice subjected to dextran sodium sulfate (DSS) treatment while being supplemented with 10 mg/kg CDCA …
-
Figure 5—source data 1
Data used for generating graph in Figure 4A.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig5-data1-v1.docx
-
Figure 5—source data 2
Data used for generating graph in Figure 4B.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig5-data2-v1.docx
-
Figure 5—source data 3
Data used for generating graph in Figure 4D.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig5-data3-v1.docx
-
Figure 5—source data 4
Data used for generating graph in Figure 4E.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig5-data4-v1.docx
Figure 5—figure supplement 1
Supplementation of Chenodeoxycholic acid (CDCA) to the mice and its effect on gut.
(a) Schematic description of the experimental design describing the course of dextran sodium sulfate (DSS) treatment and chenodeoxycholic acid (CDCA) supplementation. (b) Quantification of CDCA in …
-
Figure 5—figure supplement 1—source data 1
Data used for generating graph in Figure 5—figure supplement 1b.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig5-figsupp1-data1-v1.docx
-
Figure 5—figure supplement 1—source data 2
Data used for generating graph in Figure 5—figure supplement 1d.
- https://cdn.elifesciences.org/articles/93273/elife-93273-fig5-figsupp1-data2-v1.docx
Figure 6
A model depicting the immuno-metabolic network linking the inflammation-induced hepatic signaling pathway to intestinal pathologies in mice.
Author response image 1
Author response image 2
Author response image 3
Author response image 4
Author response image 5
Author response image 6
Author response image 7
Author response image 8
Author response image 9
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | Alb-Cre Rela-/- Stat3-/- | A gift from Dr. Lee Quinton’s lab at Boston University | C57BL/6 | |
| Strain, strain background (Mus musculus) | Relafl/fl Stat3fl/fl | A gift from Dr. Lee Quinton’s lab at Boston University | C57BL/6 | |
| Strain, strain background (Mus musculus) | Alb-Cre Rela-/- | A gift from Dr. Lee Quinton’s lab at Boston University | C57BL/6 | |
| Strain, strain background (Mus musculus) | Relafl/fl | A gift from Dr. Lee Quinton’s lab at Boston University | C57BL/6 | |
| Strain, strain background (Mus musculus) | Alb-Cre Stat3-/- | A gift from Dr. Lee Quinton’s lab at Boston University | C57BL/6 | |
| Strain, strain background (Mus musculus) | Stat3fl/fl | A gift from Dr. Lee Quinton’s lab at Boston University | C57BL/6 | |
| Antibody | anti-mouse Ly-6G-PE (Rat monoclonal) | BD Biosciences | Cat# 551461, RRID: AB_394208 | IF (1:500) |
| Antibody | anti-mouse F4/80-FITC (Mouse Polyclonal) | BioLegend | Cat# 157309, RRID: AB_2876535 | IF (1:500) |
| Antibody | anti-mouse CD11c-PE (Hamster monoclonal) | BioLegend | Cat# 117308, RRID: AB_313777 | IF (1:500) |
| Antibody | anti-mouse CD4-PE (Rat monoclonal) | BioLegend | Cat# 100408, RRID: AB_312693 | IF (1:500) |
| Antibody | anti-mouse STAT3 (mouse monoclonal) | ThermoFisher Scientific | Cat# MA1-13042, RRID: AB_10985240 | IF (1:100) WB (1:1000) |
| Antibody | anti-mouse Rela (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc372, RRID: AB_632037 | IF (1:100) WB (1:1000) |
| Antibody | anti-mouse Phospho-Stat3 (Ser727) (Rabbit monoclonal) | Cell Signaling Technology | Cat# 34911, RRID: AB_2737598 | IF (1:100) WB (1:1000) |
| Antibody | anti-mouse Phospho-Stat3 (Ser727) (Rabbit monoclonal) | Cell Signaling Technology | Cat# 34911, RRID: AB_2737598 | IF (1:100) WB (1:1000) |
| Antibody | anti-mouse Phospho-Stat3 (Tyr705) (Rabbit monoclonal) | Cell Signaling Technology | Cat# 34911, RRID: AB_2737598 | IF (1:100)tjp WB (1:1000) |
| Antibody | anti-mouse Phospho-NF-κB p65 (Ser536) (Rabbit polyclonal) | Cell Signaling Technology | Cat# 3031, RRID: AB_330559 | WB (1:1000) |
| Antibody | anti-mouse GAPDH (Rabbit monoclonal) | Cell Signaling Technology | Cat# 2118, RRID: AB_561053 | WB (1:1000) |
| Antibody | anti-mouse β-Actin (Rabbit polyclonal) | Cell Signaling Technology | Cat# 4967, AB_330288 | WB (1:1000) |
| Antibody | anti-rabbit IgG (H+L) Secondary Antibody Alexa Fluor Plus 555 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A32732, AB_2633281 | IF (1:2000) |
| Sequence-based reagent | Tjp1_F | This paper | PCR primer | GCTTTAGCGAACAGAAGGAGC |
| Sequence-based reagent | Tjp1_R | This paper | PCR primer | TTCATTTTTCCGAGACTTCACCA |
| Sequence-based reagent | Ocln_F | This paper | PCR primer | TGAAAGTCCACCTCCTTACAGA |
| Sequence-based reagent | Ocln_R | This paper | PCR primer | CCGGATAAAAAGAGTACGCTGG |
| Sequence-based reagent | Muc2_F | This paper | PCR primer | AGGGCTCGGAACTCCAGAAA |
| Sequence-based reagent | Muc2_R | This paper | PCR primer | CCAGGGAATCGGTAGACATCG |
| Sequence-based reagent | Tff3_F | This paper | PCR primer | TTGCTGGGTCCTCTGGGATAG |
| Sequence-based reagent | Tff3_R | This paper | PCR primer | TACACTGCTCCGATGTGACAG |
| Sequence-based reagent | Il1b_F | This paper | PCR primer | CATCCCATGAGTCACAGAGGATG |
| Sequence-based reagent | Il1b_R | This paper | PCR primer | ACCTTCCAGGATGAGGACATGAG |
| Sequence-based reagent | Tnf_F | This paper | PCR primer | CTGAACTTCGGGGTGATCGG |
| Sequence-based reagent | Tnf_R | This paper | PCR primer | GGCTTGTCACTCGAATTTTGAGA |
| Sequence-based reagent | Il6_F | This paper | PCR primer | CCCCAATTTCCAATGCTCTCC |
| Sequence-based reagent | Il6_R | This paper | PCR primer | GGATGGTGTTGGTCCTTAGCC |
| Sequence-based reagent | Gapdh_F | This paper | PCR primer | AGGTCGGTGTGAACGGATT |
| Sequence-based reagent | Gapdh_R | This paper | PCR primer | AATCTCCACTTTGCCACTGC |
| Sequence-based reagent | Cyp7a1_F | This paper | PCR primer | GCTGTGGTAGTGAGCTGTTG |
| Sequence-based reagent | Cyp7a1_R | This paper | PCR primer | GTTGTCCAAAGGAGGTTCACC |
| Sequence-based reagent | Cyp8b1_F | This paper | PCR primer | CCTCTGGACAAGGGTTTTGTG |
| Sequence-based reagent | Cyp8b1_R | This paper | PCR primer | GCACCGTGAAGACATCCCC |
| Sequence-based reagent | Cyp27a1_F | This paper | PCR primer | AGGGCAAGTACCCAATAAGAGA |
| Sequence-based reagent | Cyp27a1_R | This paper | PCR primer | TCGTTTAAGGCATCCGTGTAGA |
| Sequence-based reagent | Cyp7b1_F | This paper | PCR primer | TCCTGGCTGAACTCTTCTGC |
| Sequence-based reagent | Cyp7b1_R | This paper | PCR primer | CCAGACCATATTGGCCCGTA |
| Sequence-based reagent | Cre_F | This paper | PCR primer | GGTGAACGTGCAAAACAGGCTC |
| Sequence-based reagent | Cre_R | This paper | PCR primer | AAAACAGGTAGTTATTCGGATCATCAGC |
| Sequence-based reagent | Tcrd_F | This paper | PCR primer | CAAATGTTGCTTGTCTGGTG |
| Sequence-based reagent | Tcrd_R | This paper | PCR primer | GTCAGTCGAGTGCACAGTTT |
| Sequence-based reagent | Stat3flox_F | This paper | PCR primer | CCTGAAGACCAAGTTCATCTGTGTTGAC |
| Sequence-based reagent | Stat3flox_R | This paper | PCR primer | CACACAAGCCATCAAACTCTGGTCTCC |
| Sequence-based reagent | Relaflox_F | This paper | PCR primer | GAGCGCATGCCTAGCACCAG |
| Sequence-based reagent | Relaflox_R | This paper | PCR primer | GTGCACTGCATGCGTGCAG |
| Chemical compound, drug | Dextran sulphate sodium salt | Sigma-Aldrich | Cat# 42867 | |
| Chemical compound, drug | Fluorescein isothiocyanate-dextran | Sigma-Aldrich | Cat# 60842-46-8 | |
| Chemical compound, drug | Chenodeoxycholic acid | Sigma-Aldrich | Cat# C9377 | |
| Chemical compound, drug | DAPI | Sigma-Aldrich | Cat# D9542 | |
| Chemical compound, drug | PowerUp SYBR | Thermo Fisher Scientific | Cat# A25742 | |
| Chemical compound, drug | Fluorosheild | Sigma-Aldrich | Cat# F6182 | |
| Commercial assay or kit | NucleoSpin RNA | Macherey-Nagel | Cat# 74106 | |
| Commercial assay or kit | Primescript 1st strand cDNA synthesis kit | Takara Bio | Cat# 6110 A | |
| Software, algorithm | Prism 9 | GraphPad | 9.0 |
Author response table 1
| The total number of nuclei analyzed | 90th percentile of signal intensity for control samples | Nuclei of DSS-treated sections with signal intensity above the 90th percentile | Percentage overlap | |
|---|---|---|---|---|
| For Rela probed samples | 29 | 3.465 | 27 | 100 |
| For Stat3 probed samples | 29 | 2.935 | 29 | 93 |
