Inhibition of the UFD-1-NPL-4 complex triggers an aberrant immune response in Caenorhabditis elegans
- Department of Biological Sciences, Indian Institute of Science Education and Research, India
- Department of Genetics, The University of Texas MD Anderson Cancer Center, United States
Figures
Figure 1 with 2 supplements
Inhibition of the UFD-1-NPL-4 complex reduces survival of C. elegans on P. aeruginosa.
(A) Representative survival plots of N2 animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control, ufd-1, and npl-4 RNA interference (RNAi). p<0.001 for ufd-1 and npl-4 RNAi compared to EV control. (B) Representative survival plots of N2 animals grown on bacteria for RNAi against ufd-1 and npl-4, along with the EV control at 20°C. Day 0 represents young adults. p<0.001 for ufd-1 and npl-4 RNAi compared to EV control. (C) Representative fluorescence (top) and the corresponding bright-field (bottom) images of N2 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. Scale bar = 200 μm. (D) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. ***p<0.001 via the t-test (n = 16 worms each). (E) Colony-forming units (CFUs) per animal of N2 worms incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. **p<0.01 via the t-test (n=6 biological replicates).
-
Figure 1—source data 1
Inhibition of the UFD-1-NPL-4 complex reduces survival of C. elegans on P. aeruginosa.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
RNA interference (RNAi) against ufd-1 and npl-4 results in the specific knockdown of their corresponding mRNAs.
(A–B) Quantitative reverse transcription-PCR for ufd-1 mRNA (A) and npl-4 mRNA (B) levels in N2 animals grown on the empty vector (EV) control, ufd-1, and npl-4 RNAi bacteria at 20°C until 1-day-old adults. ***p<0.001 and *p<0.05 via the t-test. n.s., nonsignificant (n=4 biological replicates).
-
Figure 1—figure supplement 1—source data 1
RNA interference (RNAi) against ufd-1 and npl-4 results in the specific knockdown of their corresponding mRNAs.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig1-figsupp1-data1-v1.xlsx
Figure 1—figure supplement 2
Effects on pharyngeal pumping and defecation are unlikely to be the reason for reduced pathogen colonization upon inhibition of the UFD-1-NPL-4 complex.
(A) Pharyngeal pumps per 30 s of N2 animals grown on ufd-1 and npl-4 RNA interference (RNAi), along with the empty vector (EV) control RNAi. *p<0.05 via the t-test. n.s., nonsignificant (n = 45 worms each). (B) Pharyngeal pumps per 30 s of N2 animals grown on EV control, ufd-1, and npl-4 RNAi, followed by incubation on P. aeruginosa PA14 at 25°C for 12 hr. ***p<0.001 and **p<0.01 via the t-test (n = 30 worms each). (C) The number of expulsion events observed in 15 min in N2 animals grown on EV control, ufd-1, and npl-4 RNAi. ***p<0.001 via the t-test (n = 12–13 worms each). (D) The number of expulsion events observed in 15 min in N2 animals grown on EV control, ufd-1, and npl-4 RNAi, followed by incubation on P. aeruginosa PA14 at 25°C for 12 hr. ***p<0.001 via the t-test (n = 9–10 worms each).
-
Figure 1—figure supplement 2—source data 1
Effects on pharyngeal pumping and defecation are unlikely to be the reason for reduced pathogen colonization upon inhibition of the UFD-1-NPL-4 complex.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig1-figsupp2-data1-v1.xlsx
Figure 2 with 1 supplement
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the ER-UPR pathways.
(A) Representative survival plots of xbp-1(tm2482) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNA interference (RNAi). The difference between the EV and ufd-1 RNAi survival plots is nonsignificant. (B) Representative fluorescence images of xbp-1(tm2482) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (C) Quantification of GFP levels of xbp-1(tm2482) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. **p<0.01 via the t-test (n = 16 worms each). (D) Representative survival plots of atf-6(ok551) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. p<0.001. (E) Representative fluorescence images of atf-6(ok551) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (F) Quantification of GFP levels of atf-6(ok551) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 16 worms each). (G) Representative survival plots of pek-1(ok275) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. p<0.001. (H) Representative fluorescence images of pek-1(ok275) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (I) Quantification of GFP levels of pek-1(ok275) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 24–25 worms each).
-
Figure 2—source data 1
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the ER-UPR pathways.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the XBP-1 ER-UPR pathway.
(A) Representative survival plots of AGD927 (neuronally overexpressing the constitutively active spliced form of XBP-1, XBP-1s) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNA interference (RNAi). p<0.001. (B) Representative fluorescence images of AGD927 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. The red fluorescence in the pharynx region is from the myo-2p::tdTomato coinjection marker. Scale bar = 200 μm. (C) Quantification of GFP levels of AGD927 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 30 worms each).
-
Figure 2—figure supplement 1—source data 1
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the XBP-1 ER-UPR pathway.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the major immunity pathways.
(A) Representative survival plots of pmk-1(km25) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNA interference (RNAi). The difference between the EV and ufd-1 RNAi survival plots is nonsignificant. (B) Representative fluorescence images of pmk-1(km25) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (C) Quantification of GFP levels of pmk-1(km25) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 16 worms each). (D) Representative survival plots of dbl-1(nk3) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. The difference between the EV and ufd-1 RNAi survival plots is nonsignificant. (E) Representative fluorescence images of dbl-1(nk3) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (F) Quantification of GFP levels of dbl-1(nk3) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 16 worms each). (G) Representative survival plots of hlh-30(tm1978) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. p<0.001. (H) Representative fluorescence images of hlh-30(tm1978) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (I) Quantification of GFP levels of hlh-30(tm1978) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 16 worms each).
-
Figure 3—source data 1
Reduced colonization with P. aeruginosa upon ufd-1 knockdown is independent of the major immunity pathways.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Reduced gut colonization upon ufd-1 knockdown is independent of the tir-1 immunity pathway.
(A) Representative survival plots of tir-1(qd4) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control and ufd-1 RNA interference (RNAi). The difference between the EV and ufd-1 RNAi survival plots is nonsignificant. (B) Representative fluorescence images of tir-1(qd4) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (C) Quantification of GFP levels of tir-1(qd4) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 19–20 worms each).
-
Figure 3—figure supplement 1—source data 1
Reduced gut colonization upon ufd-1 knockdown is independent of the tir-1 immunity pathway.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
Inhibition of the UFD-1-NPL-4 complex improves survival of severely immunocompromised C. elegans on P. aeruginosa.
(A) Representative survival plots of sek-1(km4) animals on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control, ufd-1, and npl-4 RNA interference (RNAi). p<0.001 for ufd-1 and npl-4 RNAi compared to EV control. (B) Representative fluorescence images of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hr at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. Scale bar = 200 μm. (C) Quantification of GFP levels of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hr at 25°C after growth on the EV control, ufd-1, and npl-4 RNAi bacteria. ***p<0.001 via the t-test (n = 19–20 worms each). (D) Representative survival plots of sek-1(km4) animals grown on bacteria for RNAi against ufd-1 and npl-4 along with the EV control at 20°C. Day 0 represents young adults. p<0.001 for ufd-1 and npl-4 RNAi compared to EV control. (E) Representative survival plots of dbl-1(nk3);pmk-1(km25) animals on P. aeruginosa PA14 at 25°C after treatment with the EV control and ufd-1 RNAi. p<0.001. (F) Representative fluorescence images of dbl-1(nk3);pmk-1(km25) animals incubated on P. aeruginosa-GFP for 12 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. Scale bar = 200 μm. (G) Quantification of GFP levels of dbl-1(nk3);pmk-1(km25) animals incubated on P. aeruginosa-GFP for 12 hr at 25°C after growth on the EV control and ufd-1 RNAi bacteria. ***p<0.001 via the t-test (n = 24 worms each).
-
Figure 4—source data 1
Inhibition of the UFD-1-NPL-4 complex improves survival of severely immunocompromised C. elegans on P. aeruginosa.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Knockdown of ufd-1 dictates survival of different worm strains on P. aeruginosa.
(A) Representative survival plots of worm strains on P. aeruginosa PA14 at 25°C after treatment with the empty vector (EV) control RNA interference (RNAi). (B) Representative survival plots of worm strains on P. aeruginosa PA14 at 25°C after treatment with ufd-1 RNAi. The data in (A) and (B) are pooled from the data from Figures 1—3, Figure 3—figure supplement 1.
Figure 5 with 1 supplement
Knockdown of ufd-1 results in the upregulation of protease and intracellular pathogen response genes.
(A) Volcano plot of upregulated and downregulated genes in ufd-1 RNA interference (RNAi) versus empty vector (EV) control RNAi N2 animals. Orange and green dots represent significantly upregulated and downregulated genes, respectively, while the gray dots represent the genes that are not differentially regulated. (B–D) Gene ontology enrichment analysis for ufd-1 RNAi upregulated genes for biological processes (B), cellular component (C), and molecular function (D). (E) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and upregulated upon Nematocida parisii infection (Bakowski et al., 2014). The p-value for the overlap between the data is 8.2×10–110. (F) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and upregulated upon Orsay virus infection (Sarkies et al., 2013). The p-value for the overlap between the data is 2.7×10–62.
Figure 5—figure supplement 1
Gene ontology enrichment analysis for ufd-1 RNA interference (RNAi) downregulated genes.
(A–C) Gene ontology enrichment analysis for ufd-1 RNAi downregulated genes for biological processes (A), cellular component (B), and molecular function (C).
Figure 6 with 3 supplements
GATA transcription factor ELT-2 mediates the ufd-1 knockdown phenotypes.
(A) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNA interference (RNAi) and upregulated in wt versus elt-2(-) larvae (Dineen et al., 2018). The p-value for the overlap between the data is 9.5×10–52. (B) Venn diagram showing the overlap between genes upregulated upon ufd-1 RNAi and the low-complexity ELT-2 target genes (Mann et al., 2016). The p-value for the overlap between the data is 1.5×10–34. (C) Representative fluorescence (top) and the corresponding bright-field (bottom) images of N2 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the gfp RNAi (GFP) control, ufd-1, GFP+elt-2, GFP+ufd-1, and ufd-1+elt-2 RNAi bacteria (see Materials and methods for the details). Scale bar = 200 μm. (D) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on the gfp RNAi control, ufd-1, GFP+elt-2, GFP+ufd-1, and ufd-1+elt-2 RNAi bacteria. ***p<0.001 via the t-test (n = 28–30 worms each). (E) Representative fluorescence (top) and the corresponding bright-field (bottom) images of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hr at 25°C after growth on the gfp RNAi control, ufd-1, GFP+elt-2, GFP+ufd-1, and ufd-1+elt-2 RNAi bacteria. Scale bar = 200 μm. (F) Quantification of GFP levels of sek-1(km4) animals incubated on P. aeruginosa-GFP for 12 hr at 25°C after growth on the gfp RNAi control, ufd-1, GFP+elt-2, GFP+ufd-1, and ufd-1+elt-2 RNAi bacteria. ***p<0.001 via the t-test (n = 30–31 worms each). (G) Representative survival plots of sek-1(km4) animals on P. aeruginosa PA14 at 25°C after treatment with the gfp RNAi control, ufd-1, GFP+elt-2, GFP+ufd-1, and ufd-1+elt-2 RNAi bacteria. p<0.001 for ufd-1+elt-2 RNAi compared to GFP+ufd-1 RNAi.
-
Figure 6—source data 1
GATA transcription factor ELT-2 mediates the ufd-1 knockdown phenotypes.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Role of protease or intracellular pathogen response genes in reduced colonization of ufd-1 RNA interference (RNAi) animals.
(A) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on indicated RNAi bacteria. p-Values in comparison to the gfp RNAi (GFP) and GFP+ufd-1 RNAi are indicated. ***p<0.001, **p<0.01, and *p<0.05 via the t-test. n.s., nonsignificant (n = 26–30 worms each). (B) Quantification of GFP levels of N2 animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on indicated RNAi bacteria. p-values in comparison to the gfp RNAi (GFP) and GFP+ufd-1 RNAi are indicated. ***p<0.001, **p<0.01, and *p<0.05 via the t-test. n.s., nonsignificant (n = 19–20 worms each).
-
Figure 6—figure supplement 1—source data 1
Role of protease or intracellular pathogen response genes in reduced colonization of ufd-1 RNA interference (RNAi) animals.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig6-figsupp1-data1-v1.xlsx
Figure 6—figure supplement 2
Double RNA interference (RNAi) does not impact ufd-1 orelt-2 mRNA knockdown.
(A) Quantitative reverse transcription-PCR for ufd-1 mRNA levels in N2 animals grown on the gfp RNAi control (GFP), ufd-1, GFP+elt-2, GFP+ufd-1, and ufd-1+elt-2 RNAi bacteria. ***p<0.001 via the t-test. n.s., nonsignificant (n=4 biological replicates). (B) Representative fluorescence and corresponding bright-field images of ELT-2::GFP worms grown on the control empty vector (EV), elt-2, and elt-2+ufd-1 RNAi bacteria. Scale bar = 200 μm.
-
Figure 6—figure supplement 2—source data 1
Double RNA interference (RNAi) does not impact ufd-1 or elt-2 mRNA knockdown.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig6-figsupp2-data1-v1.xlsx
Figure 6—figure supplement 3
ELT-2 overexpression partly recapitulates the ufd-1 knockdown phenotypes.
(A) Representative fluorescence images of N2 and ELT-2 overexpression (elt-2_OE) animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on E. coli OP50. Scale bar = 200 μm. (B) Quantification of GFP levels of N2 and elt-2_OE animals incubated on P. aeruginosa-GFP for 24 hr at 25°C after growth on E. coli OP50. ***p<0.001 via the t-test (n = 30 worms each). (C) Representative survival plots of N2 and elt-2_OE animals on P. aeruginosa PA14 at 25°C after growth on E. coli OP50. The difference between the N2 and elt-2_OE survival plots is nonsignificant.
-
Figure 6—figure supplement 3—source data 1
ELT-2 overexpression partly recapitulates the ufd-1 knockdown phenotypes.
- https://cdn.elifesciences.org/articles/94310/elife-94310-fig6-figsupp3-data1-v1.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | OP50 | Caenorhabditis Genetics Center (CGC) | OP50 | |
| Strain, strain background (E. coli) | HT115(DE3) | Source BioScience | HT115(DE3) | |
| Strain, strain background (Pseudomonas aeruginosa) | PA14 | Frederick M Ausubel laboratory | PA14 | |
| Strain, strain background (P. aeruginosa) | PA14-GFP | Frederick M Ausubel laboratory | PA14-GFP | |
| Strain, strain background (Caenorhabditis elegans) | N2 Bristol | CGC | N2 | |
| Strain, strain background (C. elegans) | sek-1(km4) | CGC | KU4 | |
| Strain, strain background (C. elegans) | pmk-1(km25) | CGC | KU25 | |
| Strain, strain background (C. elegans) | dbl-1(nk3) | CGC | NU3 | |
| Strain, strain background (C. elegans) | hlh-30(tm1978) | CGC | JIN1375 | |
| Strain, strain background (C. elegans) | xbp-1(tm2482) | NBRP, Japan | xbp-1(tm2482) | |
| Strain, strain background (C. elegans) | pek-1(ok275) | CGC | RB545 | |
| Strain, strain background (C. elegans) | atf-6(ok551) | CGC | RB772 | |
| Strain, strain background (C. elegans) | tir-1(qd4) | CGC | RB1085 | |
| Strain, strain background (C. elegans) | uthIs270 [rab-3p::xbp-1s (constitutively active)+myo-2p::tdTomato] | CGC | AGD927 | |
| Strain, strain background (C. elegans) | glo-4(ok623); gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12)+unc-119(+)] | CGC | SD1949 | |
| Strain, strain background (C. elegans) | dbl-1(nk3);pmk-1(km25) | This study | dbl-1(nk3);pmk-1(km25) | Materials and methods section |
| Strain, strain background (C. elegans) | jsnEx3 [elt-2p::elt-2+myo-2p::mCherry] | This study | elt-2_OE | Materials and methods section |
| Sequence-based reagent | Pan-act_qPCR_F | This study | qPCR primers | TCGGTATGGGACAGAAGGAC |
| Sequence-based reagent | Pan-act_qPCR_R | This study | qPCR primers | CATCCCAGTTGGTGACGATA |
| Sequence-based reagent | npl-4_qPCR_F | This study | qPCR primers | AATGGAGGAAGCGGCAATGA |
| Sequence-based reagent | npl-4_qPCR_R | This study | qPCR primers | TCCACAGTTCCACACAGCTC |
| Sequence-based reagent | ufd-1_qPCR_F | This study | qPCR primers | GGTCGTGTTTCATTCCTTCG |
| Sequence-based reagent | ufd-1_qPCR_R | This study | qPCR primers | TTGCCTCCACGGAAGACATT |
| Sequence-based reagent | npl-4_RNAi_F | This study | Cloning primers | GCTCCCGGGATGGTACTTGAAGTCCCTCA |
| Sequence-based reagent | npl-4_RNAi_R | This study | Cloning primers | AGGTCTAGAATCGGCAGCTGGCAATCCAC |
| Sequence-based reagent | elt-2_OE_F | This study | Cloning primers | CGTCTGCAG CTGATTGTTTCAGAACACCC |
| Sequence-based reagent | elt-2_OE_R | This study | Cloning primers | CGACCCGGG AAGTAGGGTACACATGTTTG |
| Software, algorithm | GraphPad Prism 8 | GraphPad Software | RRID:SCR_002798 | https://www.graphpad.com/scientificsoftware/prism/ |
| Software, algorithm | Photoshop CS5 | Adobe | RRID:SCR_014199 | https://www.adobe.com/products/photoshop.html |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | https://imagej.nih.gov/ij/ |
Additional files
-
Supplementary file 1
Upregulated and downregulated genes in ufd-1 RNA interference (RNAi) versus empty vector (EV) control RNAi N2 animals.
Genes exhibiting at least a twofold change and p-value<0.01 were considered differentially expressed.
- https://cdn.elifesciences.org/articles/94310/elife-94310-supp1-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/94310/elife-94310-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Inhibition of the UFD-1-NPL-4 complex triggers an aberrant immune response in Caenorhabditis elegans
eLife 13:RP94310.
https://doi.org/10.7554/eLife.94310.3
