Functional characterization of all CDKN2A missense variants and comparison to in silico models of pathogenicity

  1. Hirokazu Kimura
  2. Kamel Lahouel
  3. Cristian Tomasetti
  4. Nicholas Jason Roberts  Is a corresponding author
  1. Department of Pathology, the Johns Hopkins University School of Medicine, United States
  2. Division of Integrated Genomics, Translational Genomics Research Institute, United States
  3. Department of Computational and Quantitative Medicine, Beckman Research Institute, City of Hope, United States
  4. Department of Oncology, the Johns Hopkins University School of Medicine, United States

eLife Assessment

This is a saturation mutagenesis screening of CDKN2A gene, successfully assessing the functionality of the missense variants. The work is solid and well-prosecuted. The manuscript was improved during the revision process and this work will serve as a valuable resource for diagnostic labs as well as cancer geneticists.

https://doi.org/10.7554/eLife.95347.4.sa0

Abstract

Interpretation of variants identified during genetic testing is a significant clinical challenge. In this study, we developed a high-throughput CDKN2A functional assay and characterized all possible human CDKN2A missense variants. We found that 17.7% of all missense variants were functionally deleterious. We also used our functional classifications to assess the performance of in silico models that predict the effect of variants, including recently reported models based on machine learning. Notably, we found that all in silico models performed similarly when compared to our functional classifications with accuracies of 39.5–85.4%. Furthermore, while we found that functionally deleterious variants were enriched within ankyrin repeats, we did not identify any residues where all missense variants were functionally deleterious. Our functional classifications are a resource to aid the interpretation of CDKN2A variants and have important implications for the application of variant interpretation guidelines, particularly the use of in silico models for clinical variant interpretation.

Introduction

Genetic testing of patients with cancer to identify variants associated with an increased cancer risk and sensitivity to targeted therapies is becoming more common as broad testing criteria are integrated into clinical care guidelines (Goggins et al., 2020; Stoffel et al., 2019). The American College of Medical Genetics (ACMG) provides a framework to integrate multiple types of evidence, including variant characteristics, disease epidemiology, clinical information, and functional classifications, to interpret variants in any gene (Richards et al., 2015). In silico variant effect predictors are also integrated into ACMG variant interpretation guidelines as supporting evidence to aid classification of variants. While numerous models have been developed, varied accuracy, poor agreement between models, and inflated performance on publicly available data have been reported (Cubuk et al., 2021; Jaffe et al., 2011; Wilcox et al., 2022). Recently developed variant effect predictors aim to overcome these limitations by incorporating deep-learning-based protein structure predictions and by not training on human annotated datasets (Brandes et al., 2023; Cheng et al., 2023; Gao et al., 2023). However, post-development assessment of machine learning-based variant effect predictors, to determine accuracy on novel experimental datasets and suitability for clinical use, are limited.

Variants that cannot be classified as either pathogenic or benign are categorized as variants of uncertain significance (VUSs). However, while pathogenic and benign variants identified during genetic testing are clinically actionable, VUSs are the cause of deep uncertainty for patients and their health care providers as an unknown fraction are functionally deleterious and, therefore, likely pathogenic. For example, individuals with germline VUSs in a pancreatic cancer susceptibility gene are not be eligible for clinical surveillance programs that are associated with improved patient outcomes, unless they otherwise meet family history criteria (Goggins et al., 2020; Stoffel et al., 2019). Similarly, patients with breast or pancreatic cancer and a germline BRCA2 VUS would not be eligible for treatment with olaparib, a poly (ADP-ribose) polymerase inhibitor (Golan et al., 2019; Tutt et al., 2021). Reclassification of VUSs into pathogenic or benign strata has real-world, life-or-death consequences that necessitate a high degree of accuracy.

Germline VUSs in hereditary cancer genes are a common finding in patients with cancer and frequently can be reclassified as pathogenic on the basis of in vitro functional evidence (Kimura et al., 2022). In patients with pancreatic ductal adenocarcinoma (PDAC), germline CDKN2A VUSs affecting p16INK4a, most often rare missense variants, are found in up to 4.3% of patients (Chaffee et al., 2018; Kimura et al., 2021; McWilliams et al., 2018; Roberts et al., 2016; Shindo et al., 2017; Zhen et al., 2015). As functional data from well-validated in vitro assays are incorporated into ACMG variant interpretation guidelines, we recently determined the functional consequence of 29 CDKN2A VUSs identified in patients with PDAC using an in vitro cell proliferation assay (Kimura et al., 2022; Richards et al., 2015). We found that over 40% of VUSs assayed were functionally deleterious and could reclassified as likely pathogenic.

Functional characterization, however, is time-consuming, expensive, and requires technical and scientific expertise. These limitations hinder assessment of in silico variant effect predictors and patient access to functional data that may allow reclassification of VUSs into clinically actionable strata. As CDKN2A VUSs will continue to be identified in patients with cancer undergoing genetic testing, we developed a high-throughput functional assay to provide a broad interpretation framework for CDKN2A variants. We characterized all possible CDKN2A missense variants and compared our functional classifications to recently developed in silico models based on machine learning to determine the accuracy of variant effect predictions.

Results

Functional characterization of CDKN2A missense variants

We utilized a codon-optimized CDKN2A sequence for our multiplexed functional assay. Expression of codon-optimized CDKN2A or the synonymous CDKN2A variants, p.L32L, p.G101G, and p.V126V, in PANC-1, a PDAC cell line with a homozygous deletion of CDKN2A, resulted in significant reduction in cell proliferation (p-value<0.0001; Figure 1—figure supplement 1A). There was no significant difference between codon-optimized CDKN2A and the three synonymous variants assayed. Conversely, expression of three pathogenic variants, p.L32P, p.G101W, and p.V126D, in PANC-1 cells did not result in any significant changes in cell proliferation. To determine if there were unappreciated selective effects during in vitro culture, we generated a CellTag library based on the pLJM1 plasmid that contained 20 nonfunctional 9 base pair barcodes of equal representation. We then transduced PANC-1 cells that stably expressed codon-optimized CDKN2A with the CellTag library (day 0) and determined representation of each barcode in the cell pool on day 9 and at confluency (day 45). We found no statistically significant changes in barcode representation, indicating that representation of a pool of functionally neutral variants is stable over a period of in vitro culture representing our assay time course (Figure 1—figure supplement 1B, Supplementary file 1).

We next determined whether we could identify functionally deleterious CDKN2A variants at a single residue when all amino acid variants were assayed simultaneously. We generated lentiviral expression plasmid libraries for all 156 CDKN2A amino acid residues, where each library contained all possible amino acids at a single residue. Twenty-seven variants (27 of 3120, 0.87%) were represented in the plasmid libraries at ≤1%. Expression plasmids for each of these 27 variants were individually generated by site-directed mutagenesis and added to the corresponding plasmid library to a calculated representation of 5% (Figure 1—figure supplement 2A and B, Supplementary file 2). Plasmid libraries were then individually amplified, and lentivirus produced. To confirm that the representation of each variant was maintained after transduction, we transduced three lentiviral libraries (amino acid residues p.R24, p.H66, and p.A127) individually into PANC-1 cells and determined the proportion of each variant in the amplified plasmid library and in the cell pool at day 9 post-transduction. The proportion of each variant in the amplified plasmid library and in the cell pool at day 9 were highly correlated (Figure 1—figure supplement 2C and D, Supplementary file 3).

For two CDKN2A amino acid residues that include pathogenic and benign variants, p.V126 and p.R144, we determined the representation of each variant in the transduced cell pool at day 9 and at confluency after a period of in vitro culture, day 23 and day 31 post-transfection, respectively (Figure 1A and B, Supplementary file 4, Supplementary file 5). Two synonymous variants, p.V126V and p.R144R, as well as a previously reported benign variant, p.R144C, either decreased or maintained their representation in the cell pool during in vitro culture as determined by the number of sequence reads supporting the variant. Representation of a previously reported pathogenic variant, p.V126D, increased in the cell pool. Notably, several other variants including p.V126R, p.V126W, p.V126K, and p.V126Y, also increased in representation in the cell pool, suggesting that additional amino acid changes at this residue are functionally deleterious (Figure 1A).

Figure 1 with 2 supplements see all
Pooled analysis of CDKN2A variants at two residues with previously reported pathogenic and benign variants.

PANC-1 cell stably expressing 1 of 20 CDKN2A variants, 19 missense variants, and 1 synonymous variant, at residue p.V126 or p.R144 were cultured. Variant representation, as the percent of reads supporting the variant sequence, before and after a period in vitro cell proliferation determined by next-generation sequencing for the two residues, p.V126 (A) or p.R144 (B). CDKN2A variant p.V126D (*) was previously reported as pathogenic and increased representation during in vitro proliferation. CDKN2A variant p.R144C (**) was previously reported as benign variant and maintained representation during in vitro proliferation.

To functionally characterize 2964 CDKN2A missense variants, PANC-1 cells were transduced with each of the 156 lentiviral expression libraries individually and representation of each CDKN2A variant in the resulting cell pool determined at day 9 after transduction and at confluency (days 16–40) (Supplementary file 5). Variant read counts were then analyzed using a gamma generalized linear model (GLM), that does not rely on annotation of pathogenic and benign variants to set classification thresholds, and variants with statistically significant p-values were classified as functionally deleterious (log2 p-values≤–53.2). Variants with p-values that did not reach statistical significance were classified as either of indeterminate function (log2 p-values>–53.2 and <–5.8) or functionally neutral (log2 p-values≥–5.8).

We found that 525 of 2964 missense variants (17.7%) were functionally deleterious in our assay (Figure 2A, Figure 2—figure supplement 1A, Supplementary file 4). In addition, 1784 variants (60.2%) were classified as functionally neutral, with the remaining 655 variants (22.1%) classified as indeterminate function (Figure 2A, Supplementary file 4). In general, our results were consistent with previously reported classifications. Of variants identified in patients with cancer and previously reported to be functionally deleterious in published literature and/or reported in ClinVar as pathogenic or likely pathogenic (benchmark pathogenic variants), 27 of 32 (84.4%) were functionally deleterious in our assay (Figure 2B, Figure 2—figure supplement 1B and C, Supplementary file 4; Chaffee et al., 2018; Chang et al., 2016; Horn et al., 2021; Hu et al., 2018; Kimura et al., 2022; McWilliams et al., 2018; Roberts et al., 2016; Zhen et al., 2015). Five benchmark pathogenic variants were characterized as indeterminate function, with log2 p-values from –19.3 to –33.2. Of 156 synonymous variants and six missense variants previously reported to be functionally neutral in published literature and/or reported in ClinVar as benign or likely benign (benchmark benign variants), all were characterized as functionally neutral in our assay (Figure 2B, Figure 2—figure supplement 1B and C, Supplementary file 4; Kimura et al., 2022; McWilliams et al., 2018; Roberts et al., 2016). Of 31 VUSs previously reported to be functionally deleterious, 28 (90.3%) were functionally deleterious and 3 (9.7%) were of indeterminate function in our assay. Similarly, of 18 VUSs previously reported to be functionally neutral, 16 (88.9%) were functionally neutral and 2 (11.1%) were of indeterminate function in our assay (Figure 2B, Figure 2—figure supplement 1B and C, Supplementary file 4).

Figure 2 with 5 supplements see all
Functional characterization of all possible CDKN2A missense variants.

(A) Functional classifications for 3120 CDKN2A variants, including 2964 missense variants and 156 synonymous variants. Variants were classified as functionally deleterious, indeterminate function, or neutral based on p-value using gamma generalized linear model (GLM). 525 (17.7%) variants were classified as functionally deleterious. (B) Log2 p-value (gamma GLM) for 32 benchmark pathogenic variants, 6 benign variants, 31 variants of uncertain significance (VUSs) previously reported to have functionally deleterious effects, and 18 VUSs previously reported to have functionally neutral effects. (C) Heatmap with p-values (gamma GLM) for all 3120 CDKN2A variants assayed.

We next compared variant classifications using the gamma GLM to variant classifications using a normalized fold change method (Brenan et al., 2016; Giacomelli et al., 2018). Classification of missense variants using normalized fold change also differentiated benchmark pathogenic and benchmark benign variants (Figure 2—figure supplement 2A and B, Supplementary file 6). Using benchmark pathogenic variants and benchmark benign variants to set thresholds for classification, we classified all variants as either functionally deleterious (log2 normalized fold change ≤0.24), indeterminate function (log2 normalized fold change >0.24 and <1.09), or functionally neutral (log2 normalized fold change ≥1.09). Using these thresholds, 12 of 18 VUSs (66.7%) previously reported to be functionally neutral were classified as functionally neutral, while 6 (33.3%) were of indeterminate function. Similarly, of 31 VUSs previously reported to be functionally deleterious, 30 (96.8%) were functionally deleterious and 1 (3.2%) was of indeterminate function (Figure 2—figure supplement 2A and B, Supplementary file 6). Overall, 632 of 2964 missense variants were functionally deleterious (21.3%), 674 variants were indeterminate function (22.7%), and 1658 variants were functionally neutral (55.9%) using log2 normalized fold change to classify variants (Figure 1—figure supplement 2C, Supplementary file 6). Notably, 517 of 525 variants (98.5%) classified as functionally deleterious and 1586 of 1784 variants (88.9%) classified as functionally neutral using the gamma GLM were similarly classified using log2 normalized fold change (Figure 2—figure supplement 2D).

To confirm the reproducibility of our variant classifications, 28 amino acid residues were assayed in duplicate, and variants classified using the gamma GLM. The majority of missense variants, 452 of 560 (80.7%), had the same functional classification in each of the two replicates (Figure 2—figure supplement 3A and B, Supplementary file 4). Of variants with discordant classifications, 6 (1.1%) were functionally deleterious in one replicate and of indeterminate function in another. While 102 variants (18.2%) were functionally neutral in one replicate and of indeterminate function in another. Importantly, no variant that was functionally deleterious in one replicate and functionally neutral in another (Supplementary file 4). Furthermore, the correlation coefficient between duplicate assay results was similar using the gamma GLM and log2 normalized fold change (Figure 2—figure supplement 3A and C). We also determined whether underrepresentation in the cell pool at day 9 affected variant functional classifications. Fifty-three of 2964 missense variants (1.8%) were present in the cell pool at day 9 of the first assay replicate (experiment 1) at <2%, as determined by the number of sequence reads supporting the variant (Figure 2—figure supplement 4A, Supplementary file 4). There was no statistically significant difference in the proportion of variants classified as functionally deleterious for variants present in less than 2% of the cell pool at day 9 (12 of 53 variants; 22.6%), and variants present in more than 2% of the cell pool (496 of 2911 variants; 17.0%) (p-value=0.28) (Figure 2—figure supplement 4). We also found no significant differences in the proportion of variants classified as functionally deleterious for variants present in more than 2% of the cell pool at day 9 when variants were binned in 1% intervals (Figure 2—figure supplement 4B).

Comparison to in silico prediction algorithms

As in silico predictions of variant effect are integrated into ACMG variant interpretation guidelines as supporting evidence, we compared the ability of different algorithms, including recently described algorithms that incorporate deep-learning models of protein structure, to predict the functional consequence of CDKN2A missense variants. We compared our functional classifications to predictions from Combined Annotation Dependent Depletion (CADD), Polymorphism Phenotyping v2 (PolyPhen-2), Sorting Intolerant From Tolerant (SIFT), Variant Effect Scoring Tool score (VEST), AlphaMissense, ESM1b, and PrimateAI-3D. In silico predictions for all missense variants were available for PolyPhen-2, SIFT, VEST, AlphaMissense, and ESM1b. For CADD and PrimateAI-3D, 910 (152 functionally deleterious, 196 indeterminate, and 562 functionally neutral) and 904 (152 functionally deleterious, 196 indeterminate, and 556 functionally neutral) missense variants had in silico predictions available respectively (Supplementary file 7). In silico variant effect predictors performed similarly across a broad range of performance characteristics (Supplementary file 8). Accuracy of in silico model predictions were 39.5–85.4% (CADD – 45.1%; PolyPhen-2 – 39.5%; SIFT – 60.9%; VEST – 71.9%; AlphaMissense – 71.6%; ESM1b – 59.2%; and PrimateAI-3D – 85.4%) (Figure 3). We also assessed sensitivity, specificity, positive predictive value, and negative predictive value for each model. We found that sensitivity was 0.25–0.98 (CADD – 0.97; PolyPhen-2 – 0.98; SIFT – 0.79; VEST – 0.91; AlphaMissense – 0.94; ESM1b – 0.95; and PrimateAI-3D – 0.25), specificity was 0.27–0.98 (CADD – 0.35; PolyPhen-2 – 0.27; SIFT – 0.57; VEST – 0.68; AlphaMissense – 0.67; ESM1b – 0.51; and PrimateAI-3D – 0.98), positive predictive value was 0.22–0.68 (CADD – 0.23; PolyPhen-2 – 0.22; SIFT – 0.28; VEST – 0.38; AlphaMissense – 0.38; ESM1b – 0.3; and PrimateAI-3D – 0.68), and negative predictive value was 0.87–0.98 (CADD – 0.98; PolyPhen-2 – 0.98; SIFT – 0.93; VEST – 0.97; AlphaMissense – 0.98; ESM1b – 0.98; and PrimateAI-3D – 0.87).

Figure 3 with 2 supplements see all
Comparison of functional classifications and in silico variant effect predictions for all possible CDKN2A missense variants.

Variant effect predictions for CDKN2A missense variants using CADD, PolyPhen-2, SIFT, VEST, AlphaMissense, ESM1b, and PrimateAI-3D. Predicted deleterious, damaging, or pathogenic effects (black box) and predicted neutral, tolerated, benign, or ambiguous effects (white box) presented as percent of missense variants with an available prediction. Number of missense variants with an available prediction for each in silico model given in parentheses. Accuracy shown as a red line. CADD: Combined Annotation Dependent Depletion; PolyPhen-2: Polymorphism Phenotyping v2; SIFT: Sorting Intolerant From Tolerant; VEST: Variant Effect Scoring Tool score.

We also tested the effect of combining multiple in silico predictors. 904 missense variants had in silico predictions from all seven algorithms. The remaining 2060 missense variants had in silico predictions from five algorithms. Of variants with in silico predictions from all seven algorithms, 378 (41.8%) had predictions of deleterious or pathogenic effect from a majority of algorithms (≥4), and of these, 137 (36.2%) were functionally deleterious in our assay. Similarly, of 2060 missense variants that had in silico predictions from five algorithms, 1107 (53.7%) had predictions of deleterious or pathogenic effect from a majority of algorithms (≥3), of which, 361 (32.6%) were functionally deleterious in our assay (Supplementary file 7).

Distribution of functionally deleterious variants

Analysis of functionally deleterious variants may highlight critical and non-critical resides for CDKN2A function. We found that functionally deleterious missense variants were not distributed evenly across CDKN2A. CDKN2A contains four ankyrin repeats that mediate protein-protein interactions, ankyrin repeat 1 at codon 11–40, ankyrin repeat 2 at codon 44–72, ankyrin repeat 3 at codon 77–106, and ankyrin repeat 4 at codon 110–139 (Goldstein, 2004; Ruas and Peters, 1998; Sun et al., 2010; Figure 2—figure supplement 5A). Functionally deleterious variants were enriched in ankyrin repeat 1 (21.0%, adjusted p-value=0.01), ankyrin repeat 2 (26.2%, adjusted p-value=1.0 × 10–10), and ankyrin repeat 3 (26.3%, adjusted p-value=2.6 × 10–11), while depleted in ankyrin repeat 4 (6.5%, adjusted p-value=3.2 × 10–13) and non-ankyrin repeat regions (6.8%, adjusted p-value=0) (Figure 2—figure supplement 5B). Moreover, functionally deleterious variants were further enriched within 10 residue subregions of ankyrin repeats 1–3, with 37.0% of variants in residues 16–25 of ankyrin repeat 1, 40.0% of variants in residues 46–55 of ankyrin repeat 2, and 48.0% of variants in residues 80–89 of ankyrin repeat 3 being classified as functionally deleterious (Figure 2C, Supplementary file 4).

Across all single residues, the mean percent of functionally deleterious missense variants was 17.7% (95% confidence interval: 12.7–20.9%) (Figure 2—figure supplement 5C, Supplementary file 4). At five amino acid residues, p.G23, p.G55, p.H83, p.D84, and p.G89, 17 of 19 (89.5%) possible missense variants were functionally deleterious. Notably, these residues are conserved between human and murine p16 (Byeon et al., 1998). And p.H83 has been reported to stabilize peptide loops connecting the helix-turn-helix structure of the four ankyrin repeats (Byeon et al., 1998), whereas p.D84 and p.G89 are located in a 20-residue region reported to interact with CDK4 and CDK6 (Fåhraeus et al., 1996). Conversely, 18 residues were tolerant of amino acid substitutions, with no missense variant characterized as functionally deleterious in our assay (Figure 2—figure supplement 5C, Supplementary file 4).

We also determined whether the location of variants in protein domains correlated with in silico predictions for the 904 missense variants with predictions from all seven algorithms (Figure 3—figure supplement 1A–H) and the 2060 missense variants with predictions from five algorithms (Figure 3—figure supplement 2A–H). Notably, Ank2 and Ank3 domains had more variants predicted to have deleterious or pathogenic effect by the majority of algorithms compared to Ank1, Ank4, and non-Ank domains (Figure 3—figure supplement 1C, Figure 3—figure supplement 2C). We also found increasing agreement between in silico predictions of deleterious or pathogenic effect and functionally deleterious classification in our assay as the number of algorithms predicting deleterious or pathogenic effects increased (Figure 3—figure supplement 1B, Figure 3—figure supplement 2B). This was true for all CDKN2A protein domains assessed (Figure 3—figure supplement 1D–H, Figure 3—figure supplement 2D–H).

Functional effect of CDKN2A somatic mutations

Somatic alterations in CDKN2A are a frequent finding in many types of cancer. However, not all somatic alterations are unequivocally deleterious to protein function. Missense somatic mutations are particularly challenging to functionally interpret and the presence of a functionally neutral somatic mutation may impact patient care (Tung et al., 2020). To understand the functional effect of missense somatic mutations in CDKN2A, we functionally classified mutations reported in the Catalogue Of Somatic Mutations In Cancer (COSMIC) (Forbes et al., 2010), The Cancer Genome Atlas (TCGA) (Muddabhaktuni and Koyyala, 2021), patients with cancer undergoing sequencing at The Johns Hopkins University School of Medicine (JHU), and the Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets Clinical Sequencing Cohort (MSK-IMPACT) (Cheng et al., 2015). Overall, 355 unique missense somatic mutations were reported, of which 119 (33.5%) were functionally deleterious in our assay (Supplementary file 9). The percent of missense somatic mutations that were classified as functionally deleterious was greater than the percent of all possible CDKN2A missense variants classified as functionally deleterious, suggesting enrichment of functionally deleterious missense changes among somatic mutations (Figure 2A, Supplementary file 4, Supplementary file 9). The proportion of missense somatic mutations that were functionally deleterious was similar in COSMIC, TCGA, JHU, and MSK-IMPACT. We found that 34.2–53.4% of unique missense somatic mutations classified as functionally deleterious, with 61.4–67.6% of patients having a functionally deleterious somatic mutation (Figure 4A, Supplementary file 9). As with functionally deleterious variants, functionally deleterious missense somatic mutations were also not distributed evenly across CDKN2A, being enriched within the ankyrin repeat 3 (Figure 4B, Supplementary file 9). We found that 32.4–50.0% of all functionally deleterious missense somatic mutations occurred within ankyrin repeat 3, with 48.0–58.0% of patients in each cohort having a functionally deleterious missense somatic mutation in this domain. Notably, 65.7–76.0% of functionally deleterious missense somatic mutations in this domain were in residues 80–89 (Supplementary file 9).

Figure 4 with 2 supplements see all
Functional classification of missense somatic mutations in CDKN2A.

(A) Somatic missense variants in CDKN2A reported in COSMIC, TCGA, JHU, or MSK-IMPACT, by functional classification (deleterious – black box; indeterminate – gray box; neutral – white box). (B) Distribution of functionally deleterious missense somatic mutations CDKN2A reported in COSMIC, TCGA, JHU, or MSK-IMPACT by ankyrin (ANK) repeat. (C) Percent of missense somatic mutations in CDKN2A that were classified as functionally deleterious (black box), indeterminate function (gray box), or functionally neutral (white box) group by tumor type. Missense somatic mutations reported in COSMIC, TCGA, JHU, and MSK-IMPACT were combined. The number of missense somatic mutations for each tumor type given in parentheses. COSMIC; the Catalogue Of Somatic Mutations In Cancer, TCGA; The Cancer Genome Atlas, JHU; The Johns Hopkins University School of Medicine, MSK-IMPACT; Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets.

When considering unique missense somatic mutations, 26 of 355 (7.3%) would be classified as pathogenic or likely pathogenic by ACMG classification guidelines and these were found in 263 of 1176 (22.4%) patients in COSMIC, 45 of 185 (24.3%) patients in TCGA, 40 of 184 (21.7%) patients in JHU, and 46 of 174 (26.4%) patients in MSK-IMPACT (Figure 4—figure supplement 1A and B). In each cohort, the most prevalent of these somatic mutations were p.His83Tyr and p.Asp84Asn, with more than half of the patients with a somatic mutation that could be classified as pathogenic or likely pathogenic having either the p.His83Tyr or p.Asp84Asn alteration (Figure 4—figure supplement 1C). In our functional assays, these somatic mutations were both classified as functionally deleterious.

We were also able to determine the functional classification of CDKN2A missense somatic mutations in COSMIC, TCGA, JHU, and MSK-IMAPCT by cancer type. We found that 22.2–100% of CDKN2A missense somatic mutations were functionally deleterious depending on cancer type (Figure 4—figure supplement 2A–D). When considering missense somatic mutation reported in any database, there was a statistically significant depletion of functionally deleterious mutations in colorectal adenocarcinoma (20.4%; adjusted p-value=5.4 × 10–9) (Figure 4C). As the proportion of missense somatic mutations that were functionally deleterious was less in colorectal carcinoma compared to other types of cancer, we assessed whether somatic mutations in mismatch repair genes (MLH1, MLH3, MSH2, MSH6, PMS1, and PMS2) were associated with the functional status of CDKN2A missense somatic mutations. Thirty-five patients in COSMIC had a CDKN2A missense somatic mutation, of which 12 (34.3%) had a somatic mutation in a mismatch repair gene. We found that no patients with a somatic mutation in a mismatch repair gene had a functionally deleterious CDKN2A missense somatic mutation compared to 6 of 23 samples (26.1%) without a somatic mutation in a mismatch repair gene (p-value=0.062).

CDKN2A variants in variant databases

The Genome Aggregation Database (gnomAD) v4.1.0 reports 287 missense variants in CDKN2A, including the 13 pathogenic, 4 likely pathogenic, 3 likely benign, 3 benign, and 264 VUSs classified using ACMG variant interpretation guidelines (Figure 5A and B, Supplementary file 10). Of the 264 missense VUSs, 177 were functionally neutral (67.0%), 56 (21.2%) were indeterminate function, and 31 (11.7%) were functionally deleterious in our assay using the gamma GLM for classification (Figure 5C). Similarly, ClinVar reports 395 CDKN2A missense VUSs, of which 256 (64.8%) were functionally neutral, 94 (23.8%) were indeterminate function, and 45 (11.4%) were functionally deleterious in our assay (Figure 5D, Supplementary file 11).

CDKN2A synonymous and missense variants reported in gnomAD and ClinVar.

(A) Synonymous and missense variants in CDKN2A reported in gnomAD. (B) 287 CDKN2A missense variants reported in gnomAD, by American College of Medical Genetics (ACMG) guideline classification. (C) 264 missense variants in CDKN2A reported in gnomAD, by functional classification (deleterious – black box; indeterminate – gray box; neutral – white box). (D) 395 missense variants in CDKN2A reported in ClinVar, by functional classification (deleterious – black box; indeterminate – gray box; neutral – white box).

Discussion

VUSs in hereditary cancer susceptibility genes, predominantly rare missense variants, are a frequent finding in patients undergoing genetic testing and the cause of significant uncertainty. ACMG variant interpretation guidelines incorporate functional data, as well as other evidence such as in silico predictions of variant effect, to aid classification of variants as either pathogenic or benign. CDKN2A VUSs are a frequent finding in patients with PDAC. We previously found that over 40% of CDKN2A VUSs identified in patients with PDAC were functionally deleterious and therefore could be reclassified as likely pathogenic. In this study, we developed, a high-throughput, in vitro assay and functionally characterized 2964 CDKN2A missense variants, representing all possible single amino acid variants. We found that 525 missense variants (17.7%) were functionally deleterious. These predefined functional characterizations are resource for the scientific community and can be integrated into variant interpretation schema to aid classification of CDKN2A germline variants and somatic mutations.

We classified CDKN2A missense variants using a gamma GLM as either functionally deleterious, indeterminate functional, or functionally neutral. However, we did not classify variants that may have gain-of-function effects, resulting in decreased representation in the cell pool. Future studies are necessary to determine the prevalence and significance of CDKN2A gain-of-function variants.

Importantly, variant classifications using a gamma GLM were not biased by assay outputs for previously reported – benchmark – pathogenic or begin variants to determine thresholds. Classification thresholds were determined using the change in representation of 20 nonfunctional barcodes in a pool of PANC-1 cells stably expressing CDKN2A after a period of in vitro proliferation. Even so, CDKN2A missense variant classifications were remarkably similar using a gamma GLM or normalized fold change with thresholds determined using benchmark pathogenic and begin variants. Of missense variants classified as functionally deleterious using a gamma GLM, 98.5% were similarly classified using normalized fold change.

We repeated our functional assay twice for 28 CDKN2A residues. For the remaining 128 residues of CDKN2A, the functional assay was completed once. While we found general agreement between functional classifications from each replicate for the 28 residues assayed in duplicate, additional repeats for each residue are necessary to determine variability in variant functional classifications.

Our characterization of all possible CDKN2A missense variants allowed us to assess the ability of in silico algorithms – including recently published predictors based on machine learning AlphaMissense, ESM1b, and PrimateAI-3D – to predict the pathogenicity or functional effect of CDKN2A missense variants. We found that all in silico variant effect predictors assessed performed similarly. Highest accuracy was observed with PrimateAI-3D at 85.4%, followed by VEST at 71.9% and AlphaMissense at 71.6%. Importantly, even in silico predictors performing best in one metric may perform poorly in others. For example, PrimateAI-3D had the highest specificity (0.98) and positive predictive values (0.68), but the lowest sensitivity (0.25) and negative predictive value (0.87). Given that reclassification of VUSs in hereditary cancer genes into inappropriate strata has significant implications for patients, use of in silico models for clinical variant interpretation, including those utilizing machine learning, may be premature. Ultimately, our data support current ACMG guidelines that include in silico predictions of variant effect as supporting evidence of pathogenicity or benign impact.

Our study also provides other insights for the implementation of variant interpretation guidelines. ACMG guidelines include presence of a missense variant at a residue with a previously reported pathogenic variant as moderate evidence of pathogenicity. We found that functionally deleterious missense variants were not evenly distributed across CDKN2A. We found enrichment of functionally deleterious missense variants in ankyrin repeats 1–3 and depletion in ankyrin repeat 4. Notably, no CDKN2A residue was completely intolerant of amino acid changes. Suggesting, at least for CDKN2A, that the presence of a pathogenic missense variant at a residue should be used with caution when classifying other missense variants at the same residue.

We characterized variants based upon a broad cellular phenotype, cell proliferation, in a single PDAC cell line. It is possible that CDKN2A variant functional classifications are cell-specific and assay-specific. Our assay may not encompass all cellular functions of CDKN2A and an alternative assay of a specific CDKN2A function, such as CDK4 binding, may result in different variant functional classifications. Furthermore, CDKN2A variants may have different effects if alternative cell lines are used for the functional assay. However, cell-specific effects appear to be limited. In our previous study, we characterized 29 CDKN2A VUSs in three PDAC cell lines, using cell proliferation and cell cycle assays, and found agreement between all functional classifications (Kimura et al., 2022).

This study supports the utility of our in vitro functional assay. In general, we found that benchmark pathogenic variants, benchmark benign variants, and VUSs previously reported to be functionally deleterious had congruent functional classifications in our assay. Moreover, we found that functionally deleterious effects were enriched among somatic missense mutations, and depleted in missense VUSs in gnomAD, compared to all CDKN2A missense variants. Importantly, our functionally assay provides evidence to reclassify 301 of 395 (76.2%) missense VUSs reported in ClinVar and 208 of 264 (78.8%) missense VUSs reported in gnomAD. These include 45 (11.4%) VUSs in ClinVar and 31 missense VUSs in gnomAD that could be reclassified as likely pathogenic variants.

In this study, we determined functional classifications for all possible CDKN2A missense variants. Comparison of our functional classifications to in silico variant effect predictors, including recently described algorithms based on machine learning, provides performance benchmarks and supports current recommendations integrating data computational data into variant interpretation guidelines.

Methods

Key resources table
Reagent type (species) or resourceDesignationSource or
reference
IdentifiersAdditional
information
Gene (Homo sapiens)CDKN2AGenBankGene ID: 1029 NM_000077.5 NP_000068.1
Cell line (H. sapiens)PANC-1American Type
Culture Collection
Cat. #: CRL-1469
RRID:CVCL_0480
Cell line (H. sapiens)293TAmerican Type
Culture Collection
Cat. #: CRL-3216
RRID:CVCL_0063
Recombinant
DNA reagent
pHAGE-CDKN2A (plasmid)AddgeneRRID:Addgene_116726Lentiviral vector expressing
CDKN2A
Recombinant
DNA reagent
pLentiV_
Blast (plasmid)
AddgeneRRID:Addgene_111887
Recombinant
DNA reagent
pLJM1-Empty
(plasmid)
AddgeneRRID:Addgene_91980
Recombinant
DNA reagent
psPAX2
(plasmid)
AddgeneRRID:Addgene_12260
Recombinant
DNA reagent
pCMV-VSV-G
(plasmid)
AddgeneRRID:Addgene_8454
Recombinant
DNA reagent
pLJM1-CDKN2A
(plasmid)
Twist
Bioscience
Lentiviral vector expressing
codon-optimized CDKN2A
Recombinant
DNA reagent
pLJM1-CDKN2A-Leu32Leu (plasmid)This paperLentiviral vector expressing
CDKN2A-Leu32Leu
Recombinant
DNA reagent
pLJM1-CDKN2A-Leu32Pro (plasmid)This paperLentiviral vector expressing
CDKN2A-
Leu32Pro
Recombinant
DNA reagent
pLJM1-CDKN2A- Gly101Gly (plasmid)This paperLentiviral vector expressing
CDKN2A-
Gly101Gly
Recombinant
DNA reagent
pLJM1-CDKN2A- Gly101Trp (plasmid)This paperLentiviral vector expressing
CDKN2A-
Gly101Trp
Recombinant
DNA reagent
pLJM1-CDKN2A- Val126Asp (plasmid)This paperLentiviral vector expressing
CDKN2A-
Val126Asp
Recombinant
DNA reagent
pLJM1-CDKN2A- Val126Val (plasmid)This paperLentiviral vector expressing
CDKN2A-
Val126Val
Recombinant
DNA reagent
pLentiV-Blast-CellTag (plasmid)This paperLentiviral vector expressing
CellTAg
Sequence-based reagentPCR primersThis paperSee Supplementary file 7
Commercial
assay or kit
GenePrint 10 SystemPromega
Corporation
Cat. #: B9510
Commercial
assay or kit
PCR-based MycoDtect kitGreiner
Bio-One
Cat. #: 463 060
Commercial
assay or kit
Q5 Site-Directed Mutagenesis kitNew England
Biolabs
Cat. #: E0552
Commercial
assay or kit
PureLink Genomic DNA Mini KitInvitrogenCat. #: K1820-01
Commercial
assay or kit
KAPA HiFi HotStart PCR KitKapa
Biosystems
Cat. #: KK2501
Commercial
assay or kit
Qubit dsDNA HS assay kitInvitrogenCat. #: Q33230
Commercial
assay or kit
MiSeq Reagent Kit v2 (300 cycles)IlluminaCat. #: MS-102-2002
Chemical
compound, drug
Dulbecco’s modified Eagle’s mediumGibco/Thermo
Fisher
Cat. #: 11995-065
Chemical
compound, drug
Lipofectamine 3000 Transfection ReagentThermo Fisher ScientificCat. #: L3000008
Chemical
compound, drug
Q5 Hot Start High-Fidelity 2X Master MixNew England
Biolabs
Cat. #: M0494S
Chemical
compound, drug
Agencourt AMPure XP systemBeckman
Coulter, Inc
Cat. #: A63881
Chemical
compound, drug
Lenti-X ConcentratorClontechCat. #: 631231
Chemical
compound, drug
FxCycle Violet Ready Flow ReagentInvitrogenCat. #: R37166
Software,
algorithm
TC20 Automated Cell CounterBio-Rad
Laboratories
Cat. #: 1450102
Software, algorithmMiSeq SystemIllumina
Software, algorithmMiSeq control softwareIllumina Version 2.5.0.5
Software, algorithmRThe R FoundationRRID:SCR_001905 Version 4.2.0
Software, algorithmJMPSASRRID:SCR_014242 Version 11
Software, algorithmPython statsmodel packageThe Python Software FoundationRRID:SCR_016074 Version 0.14.0

Cell lines

PANC-1 (American Type Culture Collection, Manassas, VA, USA; catalog no. CRL-1469), a human PDAC cell line with a homozygous deletion of CDKN2A (Caldas et al., 1994) and 293T (American Type Culture Collection; catalog no. CRL-3216), a human embryonic kidney cell line, were maintained in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific Inc, Waltham, MA, USA; catalog no. 11995-065) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Inc; catalog no. 26140-079). Cell line authentication and mycoplasma testing were performed using the GenePrint 10 System (Promega Corporation, Madison, WI, USA; catalog no. B9510) and the PCR-based MycoDtect kit (Greiner Bio-One, Monroe, NC, USA; catalog no. 463 060) (Genetics Resource Core Facility, The Johns Hopkins University, Baltimore, MD, USA).

CDKN2A somatic mutation data

CDKN2A (p16INK4; NP_000068.1) missense somatic mutation data was obtained from the Catalogue Of Somatic Mutations In Cancer (Forbes et al., 2010), The Cancer Genome Atlas (Muddabhaktuni and Koyyala, 2021), patients with cancer undergoing sequencing at The Johns Hopkins University School of Medicine (Baltimore, MD, USA), Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets Clinical Sequencing Cohort (Cheng et al., 2015). CDKN2A variant data was obtained from gnomAD v.4.1.0 and ClinVar (Landrum et al., 2014).

Plasmids

pHAGE-CDKN2A (Addgene, Watertown, MA, USA; plasmid no. 116726) was created by Gordon Mills & Kenneth Scott (Ng et al., 2018). pLJM1 (Addgene; plasmid no. 91980) was created by Joshua Mendell (Golden et al., 2017). pLentiV_Blast (Addgene, plasmid no. 111887) was created by Christopher Vakoc (Tarumoto et al., 2020). psPAX2 (Addgene, plasmid no. 12260) was created by Didier Trono, and pCMV-VSV-G (Addgene, plasmid no. 8454) was created by Bob Weinberg (Stewart et al., 2003).

CDKN2A expression plasmid libraries

Codon-optimized CDKN2A cDNA using p16INK4A amino acid sequence (NP_000068.1) was designed (Supplementary file 12) and pLJM1 containing codon-optimized CDKN2A (pLJM1-CDKN2A) generated by Twist Bioscience (South San Francisco, CA, USA). 156 plasmid libraries were then synthesized by using pLJM1-CDKN2A, such that each library contained all possible 20 amino acids variants (19 missense and 1 synonymous) at a given position, generating 500 ng of each plasmid library (Twist Bioscience, South San Francisco, CA, USA). The proportion of variant in each library was shown in Supplementary file 2. Variants with a representation of less than 1% in a plasmid library were individually generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA; catalog no. E0552), and added to each library to a calculated proportion of 5%. Primers used for site-directed mutagenesis are given in Supplementary file 13. Each library was then amplified to generate at least 5 µg of plasmid DNA using QIAGEN Plasmid Midi Kit (QIAGEN, Germantown, MD, USA; catalog no. 12143).

Single variant CDKN2A expression plasmids

Individual pLJM1-CDKN2A expression constructs for CDKN2A missense variants, p.L32L, p.L32P, p.G101G, p.G101W, p.V126D, and p.V126V, were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA; catalog no. E0552). Primers used for site-directed mutagenesis are given in Supplementary file 13. Integration of each CDKN2A variant was confirmed using Sanger sequencing (Genewiz, Plainsfield, NJ, USA) using the CMV Forward sequencing primer (CGCAAATGGGCGGTAGGCGTG). The manufacturer’s protocol was followed unless otherwise specified.

CellTag plasmid library

Twenty nonfunctional 9 base pair barcodes ‘CellTags’ were subcloned into pLentiV_Blast using the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA; catalog no. E0552) (Biddy et al., 2018). Primers used to generate each CellTag plasmid are given in Supplementary file 13. Integration of each CellTag was confirmed using Sanger sequencing (Genewiz) (sequencing primer: AACTGGGAAAGTGATGTCGTG). The manufacturer’s protocol was followed unless otherwise specified. CellTag plasmids were then pooled to form a CellTag plasmid library with equal representation of each CellTag plasmid.

Lentivirus production

Lentivirus production was performed as previously described with the following modifications (Kimura et al., 2022). pLJM1 lentiviral expression vectors (plasmid libraries and single variant expression plasmids) and lentiviral packaging vectors (psPAX2 and pCMV-VSV-G) were transfected into 293T cells using Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA; catalog no. L3000008). Media was collected at 24 hr and 48 hr, pooled, and lentiviral particles concentrated using Lenti-X Concentrator (Clontech, Mountain View, CA, USA; catalog no. 631231) using the manufacturer’s protocol.

Lentiviral transduction

PANC-1 cells were used for CDKN2A plasmid library and single variant CDKN2A expression plasmid transductions. PANC-1 cells previously transduced with pLJM1-CDKN2A (PANC-1CDKN2A) and selected with puromycin were used for CellTag library transductions. Briefly, 1×105 cells were cultured in media supplemented with 10 µg/mL polybrene and transduced with 4×107 transducing units per mL of lentivirus particles. Cells were then centrifuged at 1200 × g for 1 hr. After 48 hr of culture at 37°C and 5% CO2, transduced cells were selected using 3 µg/mL puromycin (CDKN2A plasmid libraries and single variant CDKN2A expression plasmids) or 5 µg/mL blasticidin (CellTag plasmid library) for 7 days. Expected MOI was one. After selection, cells were trypsinized and 5×105 cells were seeded into T150 flasks. DNA was collected from remaining cells and this sample was named as day 9. T150 flasks were cultured until confluent and then DNA was collected. The time for cells to become confluent varied for each amino acid residue (days 16–40, Supplementary file 5). DNA was extracted from PANC-1 cells using the PureLink Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA; catalog no. K1820-01). The assay for CellTag library was repeated in triplicate. We repeated our CDKN2A assay in duplicate for 28 residues. For the remaining 128 CDKN2A residues the assay was completed once.

Generation of sequence libraries

Library preparation and sequencing was performed as previously described with the following modifications (Kinde et al., 2011). For the first stage PCR, three target specific primers were designed to amplify CDKN2A amino acid positions 1–53, 54–110, and 111–156 (Supplementary file 13). Forward and reverse first stage primers contained 5’ M13F (GTAAAACGACGGCCAGC) and M13R (CAGGAAACAGCTATGAC) sequence, respectively, to enable amplification and ligation of Illumina adapter sequences in a second stage PCR (Supplementary file 13). DNA was amplified with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs; catalog no. M0494S). For the first stage PCR, each DNA sample was amplified in three reactions each containing 66 ng of DNA for 18 cycles. First stage PCR products for each sample were then pooled and purified using the Agencourt AMPure XP system (Beckman Coulter, Inc, Brea, CA, USA; catalog no. A63881), eluting into 50 µL of elution buffer. Purified PCR product was amplified in a second stage PCR to add Illumina adaptor sequences and indexes (Supplementary file 13). Second stage PCR Amplification was performed with KAPA HiFi HotStart PCR Kit (Kapa Biosystems, Wilmington, MA, USA; catalog no. KK2501) in 25 µL reactions containing 5X KAPA HiFi Buffer – 5 µL, 10 mM KAPA dNTP Mix – 0.75 µL, 10 μM forward primer – 0.75 µL, 10 μM reverse primer – 0.75 µL. For the first stage PCR, 66 ng of template DNA and 12.5 µL, Q5 Hot Start High-Fidelity 2X Master Mix was used with the following cycling conditions: 98°C for 30 s; 18 cycles of 98°C for 10 s, 72°C for 30 s, 72°C for 25 s; 72°C for 2 min. For the second stage PCR, 0.25 µL of first stage PCR product and 0.5 µL of 1 U/μL KAPA HiFi HotStart DNA Polymerase was used with the following cycling conditions: 95°C for 3 min; 25 cycles of 98°C for 20 s, 62°C for 15 s, 72°C for 1 min. Second stage PCR products were purified with the Agencourt AMPure XP system (Beckman Coulter, Inc; catalog no. A63881) into 30 µL of elution buffer. Samples were quantified by Qubit using dsDNA HS assay kit (Invitrogen; catalog no. Q33230).

Sequencing and analysis

Sequence libraries were pooled in equimolar amounts into groups of 16 samples and sequenced on the Illumina MiSeq System (Illumina, San Diego, CA, USA) with the MiSeq Reagent Kit v2 (300 cycles) (Illumina catalog no. MS-102-2002) to generate 150 base pair paired-end reads. Samples were demultiplexed and FASTQ sequence read files were generated with MiSeq control software 2.5.0.5 (Illumina). Paired sequence reads were then combined into a single contiguous sequence using Paired-End Read Merger (Zhang et al., 2014). Reads supporting each variant at a given amino acid position were counted using Perl.

Functional characterization of CDKN2A variants using a gamma GLM

We determined if a variant has a fitness advantage by assessing the significance of the observed ratio rv,cf at confluence between the number of cells with a missense variant v and the number of cells with a synonymous variant at a given amino acid position. Using the missense variant as a benchmark variant, we assumed that the distribution of rv,cf can be explained by two key covariates: rv,init, which represent the missense variant-to-synonymous variant ratio at day 9, and pv,init, the proportion of the missense variant cells among other variants, including the synonymous variant, at the studied position. More specifically, given the variables rv,initpv,init, the ratio at confluence follows a distribution:

rv,cfΓ(α,βv)

where the mean uv of the Gamma distribution is such that:

uv=αβv=rv,initapv,initb.

Here, the parameters of the null model to estimate are α,a,andb, where α is the shape parameter of the Gamma distribution and is assumed to be the same for all variants. This model is a gamma GLM over the response variable rv,cf with a log-link function and covariates logrv,init and logpv,init. Estimating the parameters will provide a null distribution of rv,cf, generating a p-value for every observed rv,cf for any variant at a given position.

To estimate the parameters α,a, and b, we utilized three control experiments where the CellTag plasmid library was transduced into PANC-1CDKN2Aco cells so that each CellTag represented a neutral variant. For a single experiment, every variant can be considered as wild-type, and we test the other 19 variants against it, knowing that they are neutral and therefore follow the null distribution. This provides us with 19×20 triplets rv,cf,pvinit,rvinit, for every experiment, yielding 1140 data points when considering all three experiments together. To estimate the parameters using these 1140 data points, we fit the GLM corresponding GLM model using the sklearn.linear_model module.

After the estimation of parameters α,a, and b, every observation for a tested variant v at a given position of the triplet (rv,cf,pvinit,rvinit) yields a p-value, defined as the probability of observing a ratio at confluence that is at least rv,cf given pv,init,rv,init under the null Gamma model. As some variants were tested in repeated experiments, we combined their associated p-values into a single p-value using Fisher’s method. Finally, to determine if a variant presents a fitness advantage, we apply a Benjamini-Hochberg estimator on all the tested variants p-values, fixing the false discovery rate at a level of 0.05.

Functional characterization of CDKN2A variants using log2 normalized fold change

Fold change for each variant was calculated using the proportion of total reads representing a variant at confluency (days 16–40, Supplementary file 5) to the proportion of total reads representing a variant on day 9 after transfection. Fold change was then normalized to the synonymous variant at each residue and then log2 normalized fold change values calculated (Supplementary file 4, Supplementary file 6). Variants with log2 normalized fold change values greater than or equal to the minimum value of benchmark pathogenic variants were characterized as functionally deleterious, while variants with values smaller than or equal to the maximum value of benchmark benign variants were characterized as functionally neutral (Supplementary file 6). Log2 normalized fold change values between these defined thresholds were classified as indeterminate. Mean values were used for replicated variants.

Data visualization

Heatmap of individual variant p-values by amino position was generated using R with the heatmaply package (Galili et al., 2018).

Cell proliferation assay

Cell proliferation assay was performed as previously described with the following modifications (Kimura et al., 2022). 1×105 cells were seeded into in vitro culture (day 0). Cells were counted on day 14 using a TC20 Automated Cell Counter (Bio-Rad Laboratories, Hercules, CA, USA; catalog no. 1450102). Relative cell proliferation value was calculated as cell number normalized to empty vector control. Assays were repeated in triplicate. Mean cell proliferation value and standard deviation (s.d.) were calculated.

Variant effect predictions

Publicly available algorithms were used to predict the consequence of CDKN2A missense variants. Prediction algorithms used included: CADD (Kircher et al., 2014), PolyPhen-2 (Adzhubei et al., 2010), SIFT (Kumar et al., 2009), VEST (Carter et al., 2013), AlphaMissense (Cheng et al., 2023), ESM1b (Brandes et al., 2023), and PrimateAI-3D (Gao et al., 2023; Supplementary file 7). PolyPhen-2, SIFT, VEST, AlphaMissense, and ESM1b prediction were available for all missense variants. CADD scores were available for 910 missense variants and where multiple CADD scores were possible, mean values were used. PrimateAI-3D prediction scores were available for 904 assayed missense variants.

Statistical analyses

Statistical analyses were performed using JMP v.11 (SAS, Cary, NC, USA) and Python statsmodel package (version 0.14.0). Student’s t-tests was used to compare mean cell proliferation values. A chi-square test was used to compare the proportion of functionally deleterious variants for variants present in <2% and ≥2% of the cell pool at day 9. A Fisher’s exact test was used to compare prevalence of functionally deleterious CDKN2A variants in colorectal cancer cases from COSMIC with and without somatic mutations in mismatch repair genes. Z-tests with multiple test correction performed with the Bonferroni method was used in the following comparisons: (1) proportion of functionally deleterious variants present in <2% of the cell pool and ≥2% of the cell pool at day 9 binned in 1% intervals, (2) proportion of variants in each domain predicted to have deleterious or pathogenic effect by the majority of algorithms, (3) proportion of functionally deleterious variants in each domain, and (4) proportion of functionally deleterious missense variants and somatic mutations.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files; source data files have been provided.

References

    1. Muddabhaktuni BMC
    2. Koyyala VPB
    (2021) The cancer genome atlas
    Indian Journal of Medical and Paediatric Oncology 42:353–355.
    https://doi.org/10.1055/s-0041-1735440

Article and author information

Author details

  1. Hirokazu Kimura

    Department of Pathology, the Johns Hopkins University School of Medicine, Baltimore, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
  2. Kamel Lahouel

    1. Division of Integrated Genomics, Translational Genomics Research Institute, Phoenix, United States
    2. Department of Computational and Quantitative Medicine, Beckman Research Institute, City of Hope, Duarte, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  3. Cristian Tomasetti

    1. Division of Integrated Genomics, Translational Genomics Research Institute, Phoenix, United States
    2. Department of Computational and Quantitative Medicine, Beckman Research Institute, City of Hope, Duarte, United States
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    Receives royalties from Exact Science; is a founder of C2T, a scientific advisor for PrognomiQ, and a consultant for Bayer
  4. Nicholas Jason Roberts

    1. Department of Pathology, the Johns Hopkins University School of Medicine, Baltimore, United States
    2. Department of Oncology, the Johns Hopkins University School of Medicine, Baltimore, United States
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    nrobert8@jhmi.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8709-0664

Funding

National Cancer Institute (P50CA62924)

  • Nicholas Jason Roberts

Susan Wojcicki and Dennis Troper

  • Nicholas Jason Roberts

The Sol Goldman Pancreatic Cancer Research Center

  • Nicholas Jason Roberts

Rolfe Pancreatic Cancer Foundation

  • Nicholas Jason Roberts

Japanese Society of Gastroenterology (Support for Young Gastroenterologists Studying in the United States)

  • Hirokazu Kimura

Japan Society for the Promotion of Science (Overseas Research Fellowships)

  • Hirokazu Kimura

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

National Institutes of Health grant P50CA62924 (NJR). Susan Wojcicki and Dennis Troper (NJR). The Sol Goldman Pancreatic Cancer Research Center (NJR). The Rolfe Pancreatic Cancer Foundation (NJR). The Japanese Society of Gastroenterology Support for Young Gastroenterologists Studying in the United States (HK). The Japan Society for the Promotion of Science Overseas Research Fellowships (HK).

Version history

  1. Preprint posted:
  2. Sent for peer review:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Reviewed Preprint version 3:
  6. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.95347. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2024, Kimura et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,643
    views
  • 178
    downloads
  • 4
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Hirokazu Kimura
  2. Kamel Lahouel
  3. Cristian Tomasetti
  4. Nicholas Jason Roberts
(2025)
Functional characterization of all CDKN2A missense variants and comparison to in silico models of pathogenicity
eLife 13:RP95347.
https://doi.org/10.7554/eLife.95347.4

Share this article

https://doi.org/10.7554/eLife.95347