1. Cell Biology
  2. Neuroscience

Neurons enhance blood–brain barrier function via upregulating claudin-5 and VE-cadherin expression due to glial cell line-derived neurotrophic factor secretion

  1. Lu Yang
  2. Zijin Lin
  3. Ruijing Mu
  4. Wenhan Wu
  5. Hao Zhi
  6. Xiaodong Liu  Is a corresponding author
  7. Hanyu Yang  Is a corresponding author
  8. Li Liu  Is a corresponding author
  1. Department of Pharmacology, School of Pharmacy, China Pharmaceutical University, China
https://doi.org/10.7554/eLife.96161.3
Share this article
Cite this article
  1. Lu Yang
  2. Zijin Lin
  3. Ruijing Mu
  4. Wenhan Wu
  5. Hao Zhi
  6. Xiaodong Liu
  7. Hanyu Yang
  8. Li Liu
(2024)
Neurons enhance blood–brain barrier function via upregulating claudin-5 and VE-cadherin expression due to glial cell line-derived neurotrophic factor secretion
eLife 13:RP96161.
https://doi.org/10.7554/eLife.96161.3
  2. Download BibTeX
  3. Download .RIS
9 figures, 6 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
The effects of co-culture with U251 and/or SH-SY5Y cells on the integrity of hCMEC/D3 and blood–brain barrier (BBB) function.

(A) Four different types of BBB models were prepared from hCMEC/D3 cells (h), SH-SY5Y cells (S), and U251 cells (U). (B) The transendothelial electrical resistance (TEER) of four models, and the TEER values in day 6 were compared. Blank: no cells. Four biological replicates per group. (C) The TEER of hCMEC/D3 and U251 cells monolayer. Four biological replicates per group. (D, E) The apparent permeability coefficient (Papp, ×10−6 cm/s) of fluorescein (NaF) and FITC-Dextran 3–5 kDa (FITC-Dex) of four BBB models. Four biological replicates per group. (F) The Papp (×10−6 cm/s) of NaF and FITC-Dex across the blank inserts, and hCMEC/D3 or U251 mono-culture models. Four biological replicates per group. The cell density (G), EdU incorporation (H) of hCMEC/D3 cells after mono/co-culturing. Three biological replicates per group. (I) Cell viability of hCMEC/D3 cells after mono/co-culturing. Four biological replicates per group. (J, K) The mRNA levels of tight junction proteins, adherent junction proteins, and transporters. Four biological replicates per group. The protein expression levels of claudin-5 (CLDN-5), ZO-1, occluding (L, M), VE-cadherin (VE-Cad), β-catenin, and BCRP (N, O) in hCMEC/D3 cells. Four biological replicates per group. The correlations between the Papp (×10−5 cm/s) of NaF and claudin-5 expression (P), or VE-cadherin expression (Q). The correlation between Papp (×10−5 cm/s) of FITC-Dex and claudin-5 expression (R), or VE-cadherin expression (S). The above data are shown as the mean ± SEM. For J and K, two technical replicates per biological replicate. One technical replicate per biological replicate for the rest. *p < 0.05; **p < 0.01 by one-way ANOVA test followed by Fisher’s LSD test, Welch’s ANOVA test, or Kruskal–Wallis test. The simple linear regression analysis was used to examine the presence of a linear relationship between two variables.

Figure 1—source data 1

The western blot raw images in Figure 1.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig1-data1-v1.zip
Figure 1—source data 2

The labeled western blot images in Figure 1.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig1-data2-v1.zip
Figure 1—source data 3

Excel file containing summary data and data analysis of Figure 1.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig1-data3-v1.xlsx
Figure 1—figure supplement 1
Download asset Open asset
The induced proliferation of hCMEC/D3 cells by basic fibroblast growth factor (bFGF) slightly reduced the permeability of cell layers.

EdU incorporation (A), cell viability (B), and apparent permeability coefficient (Papp, ×10−6 cm/s) of fluorescein (C) or FITC-Dextran 3–5 kDa (D) of hCMEC/D3 cells treated with bFGF (6, 20, and 60 ng/ml) for 6 days. The above data are shown as the mean ± SEM. Four biological replicates per group. One technical replicate for each biological replicate. Statistical significance was determined using one-way ANOVA test followed by Fisher’s LSD test or Welch’s ANOVA test.

Figure 2
Download asset Open asset
Neurons and astrocytes upregulated claudin-5 and VE-cadherin expression in hCMEC/D3 cells due to glial cell line-derived neurotrophic factor (GDNF) secretion.

(A) Effects of conditioned medium (CM) on claudin-5 and VE-cadherin expression. Con: the normal medium; S-CM: the CM from SH-SY5Y cells; U-CM: the CM from U251 cells; US-CM: the CM from SH-SY5Y cells co-culture with U251 cells. (B) The mRNA expression levels of neurotrophic factors in hCMEC/D3, U251, and SH-SY5Y cells. (C) Concentrations of GDNF, basic fibroblast growth factor (bFGF), insulin-like growth factor-1 (IGF-1), and transforming growth factor-β (TGF-β) in the CMs. H-CM: the CM from hCMEC/D3 cells. Effects of GDNF (D), IGF-1 (E), bFGF (F), and TGF-β (G) on the expression of claudin-5 and VE-cadherin. The dosages have been marked in the figure. Effects of anti-GDNF antibody on the upregulation of claudin-5 and VE-cadherin expression induced by US-CM (H) or 200 pg/ml GDNF (I). (J) Effects of 200 pg/ml GDNF and US-CM on claudin-5 and VE-cadherin expression in primary rat brain microvascular endothelial cells. Effects of 3 μM RET tyrosine kinase inhibitor SSP-86 (SPP), and 5 μM Src family kinases inhibitor PP2 on the upregulation of claudin-5 and VE-cadherin induced by 200 pg/mL GDNF (K) and US-CM (L). Effects of SPP on the transendothelial electrical resistance (TEER) on day 6 (M), the permeability of NaF, and FITC-Dex (N) of the hCMEC/D3 mono-culture blood–brain barrier (BBB) model treating 200 pg/ml GDNF. Effects of PP2 on the TEER on day 6 (O), the permeability of NaF, and FITC-Dex (P) of the hCMEC/D3 mono-culture BBB model treating 200 pg/ml GDNF. Effects of SPP on the TEER on day 6 (Q), the permeability of NaF, and FITC-Dex (R) of the triple co-culture BBB model. Effects of PP2 on the TEER on day 6 (S), the permeability of NaF, and FITC-Dex (T) of the triple co-culture BBB model. The above data are shown as the mean ± SEM. Four biological replicates per group. For B and C, two technical replicates per biological replicate. One technical replicate per biological replicate for the rest. *p < 0.05; **p < 0.01 by one-way ANOVA test followed by Fisher’s LSD test, Welch’s ANOVA test, or Kruskal–Wallis test.

Figure 2—source data 1

The western blot raw images in Figure 2.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig2-data1-v1.zip
Figure 2—source data 2

The labeled western blot images in Figure 2.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig2-data2-v1.zip
Figure 2—source data 3

Excel file containing summary data and data analysis of Figure 2.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig2-data3-v1.xlsx
Figure 3
Download asset Open asset
Glial cell line-derived neurotrophic factor (GDNF)-induced claudin-5 and VE-cadherin expression in hCMEC/D3 cells by activating the PI3K/AKT and MAPK/ERK signaling.

(A) Effects of 3 μM LY294002 (LY) on the levels of claudin-5, VE-cadherin, and p-AKT/AKT in hCMEC/D3 cells stimulated by 200 pg/ml GDNF. (B) Effects of 2 μM U0126 (U0) on the levels of claudin-5, VE-cadherin, and p-ERK/ERK in hCMEC/D3 cells stimulated by 200 pg/ml GDNF. (C) Effects of 5 μM SP600125 (SP) on the levels of claudin-5, VE-cadherin, and p-JNK/JNK in hCMEC/D3 cells stimulated by 200 pg/ml GDNF. (D) Effects of 2 μM SB203580 (SB) on the levels of claudin-5, VE-cadherin, and p-p38/p38 in hCMEC/D3 cells stimulated by 200 pg/ml GDNF. (E) Effects of anti-GDNF antibody on the GDNF-induced p-AKT/AKT and p-ERK/ERK ratios. (F) Effects of 3 μM LY on the levels of claudin-5, VE-cadherin, and p-AKT/AKT in hCMEC/D3 cells stimulated by US-CM. (G) Effects of 2 μM U0 on the levels of claudin-5, VE-cadherin, and p-ERK/ERK in hCMEC/D3 cells stimulated by US-CM. (H) Effects of 5 μM SP on the levels of claudin-5, VE-cadherin, and p-JNK/JNK in hCMEC/D3 cells stimulated by US-CM. (I) Effects of 2 μM SB on the levels of claudin-5, VE-cadherin, and p-p38/p38 in hCMEC/D3 cells stimulated by US-CM. (J) Effects of anti-GDNF antibody on the US-CM-induced p-AKT/AKT and p-ERK/ERK ratios. The above data are shown as the mean ± SEM. Four biological replicates per group. One technical replicate for each biological replicate. *p < 0.05; **p < 0.01 by one-way ANOVA test followed by Fisher’s LSD test or Welch’s ANOVA test.

Figure 3—source data 1

The western blot raw images in Figure 3.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig3-data1-v1.zip
Figure 3—source data 2

The labeled western blot images in Figure 3.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig3-data2-v1.zip
Figure 3—source data 3

Excel file containing summary data and data analysis of Figure 3.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig3-data3-v1.xlsx
Figure 4 with 1 supplement
Download asset Open asset
Glial cell line-derived neurotrophic factor (GDNF) induced the claudin-5 expression in hCMEC/D3 cells by activating the PI3K/AKT/FOXO1 pathway.

Effects of US-CM and GDNF on the phosphorylated FOXO1 (p-FOXO1)/FOXO1 ratio, total FOXO1 expression (A), cytoplasmic p-FOXO1, cytoplasmic FOXO1, and nuclear FOXO1 expression (B). The expression levels of total and nuclear FOXO1 (C), claudin-5, and VE-cadherin (D) in hCMEC/D3 cells transfected with FOXO1 siRNA (siFOXO1). NC: negative control. (E) Effects of FOXO1 overexpression (FOXO1-OE) and GDNF on the expression levels of claudin-5, total FOXO1, and nuclear FOXO1. FOXO1-NC: negative control plasmids. (F) Effects of LY and U0 on GDNF-induced alterations of total p-FOXO1/FOXO1 ratio, cytoplasmic p-FOXO1, cytoplasmic FOXO1, and nuclear FOXO1 expression. (G) Effects of LY on the claudin-5 expression upregulated by siFOXO1. The above data are shown as the mean± SEM. Four biological replicates per group. One technical replicate for each biological replicate. *p < 0.05; **p < 0.01 by one-way ANOVA test followed by Fisher’s LSD test, Welch’s ANOVA test, or Kruskal–Wallis test.

Figure 4—source data 1

The western blot raw images in Figure 4.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig4-data1-v1.zip
Figure 4—source data 2

The labeled western blot images in Figure 4.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig4-data2-v1.zip
Figure 4—source data 3

Excel file containing summary data and data analysis of Figure 4.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
Download asset Open asset
The contribution of VE-cadherin on the glial cell line-derived neurotrophic factor (GDNF)-induced claudin-5 expression.

Effects of the VE-cadherin siRNA (siVE-Cad) on mRNA expression of VE-cadherin (A) and claudin-5 (B). Effects of siVE-Cad and GDNF on claudin-5 and VE-cadherin protein expression (C). NC: negative control plasmids. The above data are shown as the mean ± SEM. Four biological replicates per group. Two technical replicates for A and B and one technical replicate for C. Statistical significance was determined using unpaired t-test or one-way ANOVA test followed by Fisher’s LSD test.

Figure 4—figure supplement 1—source data 1

The western blot raw images in Figure 4—figure supplement 1.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig4-figsupp1-data1-v1.zip
Figure 4—figure supplement 1—source data 2

The labeled western blot images in Figure 4—figure supplement 1.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig4-figsupp1-data2-v1.zip
Figure 4—figure supplement 1—source data 3

Excel file containing summary data and data analysis of Figure 4—figure supplement 1.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig4-figsupp1-data3-v1.xlsx
Figure 5
Download asset Open asset
Glial cell line-derived neurotrophic factor (GDNF)-induced VE-cadherin expression in hCMEC/D3 cells by activating the PI3K/AKT/ETS1 and MAPK/ERK/ETS1 pathways.

Effects of US-CM and GDNF on total (A) and nuclear (B) ETS1 expression. Effects of LY and U0 on 200 pg/ml GDNF-induced total (C) and nuclear (D) ETS1 expression. Expression levels of total (E) and the nuclear ETS1 (F) in hCMEC/D3 cells after knocking down ETS1 with siRNA (siETS1). (G) Effects of GDNF and siETS1 on the expression of VE-cadherin and claudin-5. The above data are shown as the mean ± SEM. Four biological replicates per group. One technical replicate for each biological replicate. *p < 0.05; **p < 0.01 by one-way ANOVA test followed by Fisher’s LSD test.

Figure 5—source data 1

The western blot raw images in Figure 5.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig5-data1-v1.zip
Figure 5—source data 2

The labeled western blot images in Figure 5.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig5-data2-v1.zip
Figure 5—source data 3

Excel file containing summary data and data analysis of Figure 5.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig5-data3-v1.xlsx
Figure 6
Download asset Open asset
The deficiency of brain glial cell line-derived neurotrophic factor (GDNF) in mice increased the permeability of blood–brain barrier (BBB) and reduced claudin-5 and VE-cadherin expression in mice brains.

(A) Experimental configuration of AAV-GFP (shNC) or AAV-shGdnf (shGdnf) intracerebroventricular injection. (B) Effects of brain-specific Gdnf silencing on the expression levels of GDNF, claudin-5, and VE-cadherin in the brains. Effects of brain-specific Gdnf silencing on NaF levels in plasma (C), brain (D), and the ratio of brain to plasma (E). Effects of brain-specific Gdnf silencing on FITC-Dex levels in plasma (F), brain (G), and the ratio of brain to plasma (H). The expression ratios of p-AKT/AKT (I), p-ERK/ERK (J), and p-FOXO1/FOXO1 (K) in the brains of Gdnf silencing mice. (L) The expression level of ETS1 in the brains of Gdnf silencing mice. The above data are shown as the mean ± SEM. Six biological replicates per group. One technical replicate for each biological replicate. *p < 0.05; **p < 0.01 by unpaired t-test, unpaired t-test with Welch’s correction, or Mann–Whitney test.

Figure 6—source data 1

The western blot raw images in Figure 6.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig6-data1-v1.zip
Figure 6—source data 2

The labeled western blot images in Figure 6.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig6-data2-v1.zip
Figure 6—source data 3

Excel file containing summary data and data analysis of Figure 6.

https://cdn.elifesciences.org/articles/96161/elife-96161-fig6-data3-v1.xlsx
Figure 7
Download asset Open asset
In vitro/in vivo correlation assay of blood–brain barrier (BBB) permeability.

(A) The comparison of the estimated permeability coefficient-surface area product (PSPre, Mono) recalculated from Papp, Mono with the observed in vivo PS values (PSObs). (B) The comparison of the estimated permeability coefficient-surface area product (PSPre, Triple) recalculated from Papp, Triple with the observed in vivo PS values (PSObs). The solid line represents a perfect prediction, and the dashed lines represent the 0.5- to 2-folds of their observations. The PSObs values were determined by in situ brain perfusion in rodents, which were collected from the literature.

Figure 8
Download asset Open asset
The mechanism of neurons and astrocytes induced the integrity of brain endothelial cells.

Neurons but also astrocytes trigger the activation of PI3K/AKT and MAPK/ERK pathways in brain endothelial cells by glial cell line-derived neurotrophic factor (GDNF) secretion, which in turn regulates transcription factors of claudin-5 (FOXO1) and VE-cadherin (ETS1) to promote claudin-5 and VE-cadherin expression and leads to the enhancement of blood–brain barrier (BBB) integrity. Meanwhile, with the increase in barrier integrity, the in vitro BBB model also obtained a stronger in vivo correlation.

Figure 9
Download asset Open asset
Schematic diagram of the establishment process of the triple co-culture blood–brain barrier (BBB) model.

Tables

Table 1
The unbound fraction in brain (fu, brain), the observed PSObs, and the predicted PS (PSPre), Papp across the hCMEC/D3 mono-culture model (Papp, Mono) and triple co-culture model (Papp, Triple) of the tested drugs.
Compoundsfu, brainPSObsμl/min/gPapp, Mono cm/s × 10−6PSPre, Monoμl/min/gPapp, Triple cm/s × 10−6PSPre, Tripleμl/min/g
Amantadine0.1985*116.10†6.84 ± 0.95310.223.64 ± 0.26165.23
Amitriptyline0.01‡4608.00***15.24 ± 0.6413,716.0014.61 ± 0.2713,149.00
Bupropion0.12§1519.20†15.19 ± 0.201139.5811.34 ± 0.44850.58
Carbamazepine0.116959.40†34.37 ± 1.262666.8911.71 ± 0.15908.69
Clozapine0.014**2260.80†38.97 ± 0.5425,052.5712.87 ± 2.068272.72
Donepezil0.07††1581.30†20.91 ± 0.752688.4314.47 ± 0.841860.43
Doxepin0.025†2192.40†16.88 ± 1.086076.8010.66 ± 0.923837.60
Fluoxetine0.004†2698.20†11.48 ± 0.8525,830.009.97 ± 1.0322,430.25
Gabapentin0.782†162.90†16.75 ± 1.62192.778.78 ± 0.23101.05
Lamotrigine0.273†126.00†14.26 ± 0.37470.115.97 ± 0.11196.88
Metoclopramide0.365†125.10†14.14 ± 1.44348.666.63 ± 0.42163.41
Midazolam0.045‡ ‡2727.00†25.30 ± 1.005060.0019.09 ± 0.243818.00
Mirtazapine0.08†1912.50†23.44 ± 0.442637.0017.86 ± 0.212009.25
Olanzapine0.034†2279.70†22.91 ± 3.806064.4112.49 ± 0.533306.18
Prazosin0.09§ §169.20¶ ¶5.61 ± 0.38560.932.81 ± 0.52280.99
Risperidone0.099†849.60†16.10 ± 2.871463.6411.70 ± 0.251063.64
Venlafaxine0.205*584.10†9.58 ± 0.28420.608.25 ± 0.36362.02
Verapamil0.033 ‡335.70 ‡7.21 ± 0.411965.245.56 ± 0.061517.67

  1. One technical replicate of four biological replicates per group.

  2. *

    (Esaki et al., 2019).

  3. †

    (Summerfield et al., 2007).

  4. ‡

    (Fridén et al., 2011).

  5. §

    (Bhattacharya et al., 2021).

  6. (Maurer et al., 2005).

  7. **

    (Cremers et al., 2012).

  8. ††

    (Di et al., 2011).

  9. ‡ ‡

    (Kodaira et al., 2011).

  10. § §

    (Zhou et al., 2009).

  11. ¶ ¶

    (Di Marco et al., 2019).

  12. ***

    (Avdeef and Sun, 2011).

Table 1—source data 1

The apparent permeability coefficients of 18 tested drugs from mono- or triple- culture blood–brain barrier (BBB) model.

https://cdn.elifesciences.org/articles/96161/elife-96161-table1-data1-v1.xlsx
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Antibodyβ-Actin
(mouse monoclonal)		Proteintech66009
RRID:AB_2883475		1:10,000
AntibodyGAPDH
(mouse monoclonal)		AbsinAbs830030ss
RRID:AB_2811228		1:50,000
Antibodyβ-Tubulin
(mouse monoclonal)		Fdbio ScienceFD0064
RRID:AB_3076327		1:10,000
AntibodyLamin B
(mouse monoclonal)		Proteintech66095
RRID:AB_2721256		1:10,000
AntibodyClaudin-5
(rabbit polyclonal)		WanleibioWL03731
RRID:AB_3076320		1:1000
AntibodyOccludin
(rabbit polyclonal)		WanleibioWL01996
RRID:AB_3076325		1:500
AntibodyZO-1
(mouse polyclonal)		Proteintech21773-1-AP
RRID:AB_10733242		1:5000
AntibodyVE-cadherin
(rabbit polyclonal)		WanleibioWL02033
RRID:AB_3076321		1:1000
Antibodyβ-Catenin
(rabbit polyclonal)		WanleibioWL0962a
RRID:AB_3076323		1:5000
AntibodyBCPR
(rabbit polyclonal)		CST4477S
RRID:AB_10544928		1:1000
AntibodyP-gp
(rabbit monoclonal)		CST13978S
RRID:AB_2798357		1:1500
Antibodyp-AKT
(mouse monoclonal)		Huaan BiotechnologyET1607
RRID:AB_2940863		1:2000
AntibodyAKT
(mouse monoclonal)		Huaan BiotechnologyET1609
RRID:AB_3069857		1:2000
Antibodyp-ERK
(rabbit polyclonal)		Proteintech28733-1-AP
RRID:AB_2881202		1:1000
AntibodyERK
(rabbit polyclonal)		Proteintech11257-1-AP
RRID:AB_2139822		1:1000
Antibodyp-p38
(rabbit monoclonal)		CST4511S
RRID:AB_10890701		1:250
Antibodyp38
(rabbit monoclonal)		CST8690S
RRID:AB_10999090		1:250
Antibodyp-JNK
(rabbit polyclonal)		WanleibioWL01813
RRID:AB_2910628		1:1000
AntibodyJNK
(rabbit polyclonal)		WanleibioWL01295
RRID:AB_3064853		1:1000
AntibodyFOXO1
(rabbit polyclonal)		Proteintech18592
RRID:AB_2934932		1:1000
Antibodyp-FOXO1
(rabbit polyclonal)		WanleibioWL03634
RRID: AB_3076326		1:1000
AntibodyETS1
(mouse monoclonal)		Santa Cruzsc-55581
RRID:AB_831289		1:500
AntibodyETS1
(mouse monoclonal)		Proteintech66598
RRID:AB_2881958		1:3000
Cell line (Homo sapiens)hCMEC/D3 cellsJENNIO
Biological Technology, Guangzhou, China		Cat#JNO-H0520
RRID:CVCL_U985		Authenticated
(STR profiling)
Cell line (H. sapiens)U251 cellsCellcook Biological Technology, Guangzhou, ChinaCat#CC1701
RRID:CVCL_0021		Authenticated
(STR profiling)
Cell line (H. sapiens)SH-SY5Y cellsCellcook Biological Technology, Guangzhou, ChinaCat#CC2101
RRID:CVCL_0019		Authenticated
(STR profiling)
Software, algorithmGraphPad PrismVersion 8.0.2RRID:SCR_002798
Software, algorithmBioTek Cytation 5 Cell Imaging Multi-Mode ReaderBioTek Cytation 5RRID:SCR_019732
Software, algorithmQuantStudio 3 Real Time PCR SystemQuantStudio 3RRID:SCR_018712
Software, algorithmFACS Celesta Flow CytometerBD BiosciencesRRID:SCR_019597
Software, algorithmFlowjo softwareVersion 10.4RRID:SCR_008520
Commercial assay or kitGDNF-Elisa kitR&D system
RRID:SCR_006140		Cat#212-GD
Commercial assay or kitbFGF-Elisa kitElabscience
RRID:SCR_025982		Cat#E-EL-H6042
Commercial assay or kitIGF-1-Elisa kitElabscience
RRID:SCR_025982		Cat#E-EL-H0086
Commercial assay or kitTGF-β-Elisa kitElabscience
RRID:SCR_025982		Cat#E-EL-0162
Peptide, recombinant proteinGDNFR&D system
RRID:SCR_006140		Cat#212-GD
Peptide, recombinant proteinbFGFMedChemExpress
RRID:SCR_025062		Cat#HY-P7331
Peptide, recombinant proteinIGF-1MedChemExpress
RRID:SCR_025062		Cat#HY-P70783
Peptide, recombinant proteinTGF-βMedChemExpress
RRID:SCR_025062		Cat#HY-P70543
Chemical compound, drugSPP-86MedChemExpress
RRID:SCR_025062		Cat#HY-110193
Chemical compound, drugPP2MedChemExpress
RRID:SCR_025062		Cat#HY-13805
Chemical compound, drugLY294002MedChemExpress
RRID:SCR_025062		Cat#HY-10108
Chemical compound, drugU0126MedChemExpress
RRID:SCR_025062		Cat#S1102
Chemical compound, drugSP600125Selleck
RRID:SCR_003823		Cat#HY-12041
Chemical compound, drugSB203580MedChemExpress
RRID:SCR_025062		Cat#HY-10256
Table 2
Initial concentrations in donor chamber and chromatographic conditions of prazosin, verapamil, and lamotrigine.
CompoundConcentration (μM)Wavelength (nm)
Prazosin5Ex: 250
Em: 390
Verapamil5Ex: 280
Em: 310
Lamotrigine6220
Table 3
The summary of mass charge ratio, extraction, initial concentrations in donor chamber.
CompoundConcentration (μM)Mass charge ratio[M+H]+Extraction
Amantadine3181Water-saturated N-butanol
Amitriptyline1.5278Ethyl acetate
Bupropion3240Ethyl acetate
Carbamazepine3237Ethyl acetate
Clozapine4327Ethyl acetate
Donepezil3380Methyl tert-butyl ether
Doxepin4317Methyl tert-butyl ether
Fluoxetine3310Ethyl acetate
Gabapentin10172Ethyl acetate
Metoclopramide4301Ethyl acetate
Midazolam3327Ethyl acetate
Mirtazapine3266Methyl tert-butyl ether
Olanzapine3313Methyl tert-butyl ether
Risperidone4427Methyl tert-butyl ether
Venlafaxine10278Ethyl acetate
Table 4
Primer sequences for quantitative real-time PCR (qPCR) for indicted genes.
Gene (protein)Forwards primer, 5′→3′Reverse primer, 3′→5′
ACTB (β-actin)GGACTTCGAGCAAGAGATGGAGCACTGTGTTGGCGTACAG
GAPDH (GAPDH)TGTGGGCATCAATGGATTTGGACACCATGTATTCCGGGTCAAT
CLDN5 (claudin-5)CTCTGCTGGTTCGCCAACATCAGCTCGTACTTCTGCGACA
OCLN (occludin)ACAAGCGGTTTTATCCAGAGTCGTCATCCACAGGCGAAGTTAAT
TJP1 (ZO-1)ACCAGTAAGTCGTCCTGATCCTCGGCCAAATCTTCTCACTCC
CDH5 (VE-cadherin)AAGCGTGAGTCGCAAGAATGTCTCCAGGTTTTCGCCAGTG
ABCB1 (P-gp)TTGCTGCTTACATTCAGGTTTCAAGCCTATCTCCTGTCGCATTA
ABCG2 (BCRP)ACGAACGGATTAACAGGGTCACTCCAGACACACCACGGAT
SLC22A1 (OCT1)ACGGTGGCGATCATGTACCCCCATTCTTTTGAGCGATGTGG
SLC22A2 (OCT2)CATCGTCACCGAGTTTAACCTGAGCCGATACTCATAGAGCCAAT
SLC22A8 (OAT3)ATGGCCCAGTCTATCTTCATGGGACGGTGCTCAGGGTAATGC
SLCO1A1 (OATP1A1)TAATGTGGGTGTACGTCCTAGTGCTCCTGTTTCTACAAGCCCAA
GDNF (GDNF)GCAGACCCATCGCCTTTGATCCACACCTTTTAGCGGAATGC
BDNF (BDNF)CTACGAGACCAAGTGCAATCCAATCGCCAGCCAATTCTCTTT
NGF (NGF)TGTGGGTTGGGGATAAGACCAGCTGTCAACGGGATTTGGGT
IGF1 (IGF-1)GCTCTTCAGTTCGTGTGTGGAGGTCATGGATGGACCTTACTGT
VEGFA (VEGF)CCCACTGAGGAGTCCAACATAAATGCTTTCTCCGCTCTGA
FGF2 (bFGF)AGAAGAGCGACCCTCACATCACGGTTAGCACACACTCCTTTG
TGFB1 (TGF-β)GGCCAGATCCTGTCCAAGCGTGGGTTTCCACCATTAGCAC
Table 5
The target sequences for small interfering RNA (siRNA) or short hairpin RNA (shRNA).
GeneTarget sequence
ETS1CGCTATACCTCGGATTACT
FOXO1AATCTCCTAGGAGAAGAGCTG
GdnfGCCAGTGTTTATCTGATAC
CDH5GCCTCTGTCATGTACCAAA

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/96161/elife-96161-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Lu Yang
  2. Zijin Lin
  3. Ruijing Mu
  4. Wenhan Wu
  5. Hao Zhi
  6. Xiaodong Liu
  7. Hanyu Yang
  8. Li Liu
(2024)
Neurons enhance blood–brain barrier function via upregulating claudin-5 and VE-cadherin expression due to glial cell line-derived neurotrophic factor secretion
eLife 13:RP96161.
https://doi.org/10.7554/eLife.96161.3