Micro-scale control of oligodendrocyte morphology and myelination by the intellectual disability-linked protein acyltransferase ZDHHC9
- Center for Neural Development and Repair, Lewis Katz School of Medicine at Temple University, United States
- Department of Biomedical Sciences, Seoul National University College of Medicine, Republic of Korea
- Department of Cellular and Physiological Sciences, Life Sciences Institute and Djavad Mowafaghian Centre for Brain Health, University of British Columbia, Canada
- Department of Neural Sciences, Lewis Katz School of Medicine at Temple University, United States
Figures
Figure 1
Oligodendrocyte-specific transcriptomics reveals oligodendrocyte (OL)-enriched expression of ZDHHC9 and GOLGA7.
(A) Fluorescent image of widespread EGFP expression in the brain of Mobp-EGFP mice (Left). Confocal images of EGFP and other cell-specific markers (NG2 for OPC, CC1 for OLs, and NeuN for neurons) (Right). White arrowheads indicate colocalization of EGFP+ cells and CC1-immunoreactivities. Boxed area in left panel corresponds to the region used to acquire confocal images for NG2 and CC1 in right panel. Scale bars: 500 (left) and 20 (right) µm. (B) Heatmap for expression levels of previously reported cell type-specific gene clusters from the OL-specific RNA-Seq results. EGFP+ OLs were isolated from cortices of three Mobp-EGFP mice with fluorescence-activated cell sorting (FACS), and their RNAs were used for RNA-seq. (C, D) Fragments per kilobase per million (FPKM) values of ZDHHC-protein acyltransferases (PATs) (C) and Golgin subfamily A members (D) expressed in OLs. Both graphs show mean + SEM. (E) Heatmap of relative expression of all protein acyltransferase (PATs) and Golgin subfamily A member genes in mouse OLs and other brain cells according to data from this study (left) and Zhang et al., 2014 (right). (F) Heatmap of relative expression of all PATs and Golgin subfamily A member genes in human OLs and other brain cells according to Zhang et al., 2016.
Figure 2 with 2 supplements
HA-ZDHHC9WT localizes to puncta in oligodendrocyte (OL) processes, but other protein acyltransferases (PATs), and X-linked intellectual disability (XLID) mutant forms of ZDHHC9, are restricted to OL cell bodies.
(A) Experimental timeline. (B) Images of morphologically mature OLs transfected as in A to express the indicated HA-tagged PATs and immunostained with the indicated antibodies. Scale bar: 20 μm. Lower panels show enlarged images of the boxed regions in upper panels. Scale bar: 10 μm. (C) Images as in lower panels of B of OLs transfected to express WT HA-ZDHHC9 or the indicated XLID mutant forms of ZDHHC9. (D) Quantified data confirms that HA-ZDHHC9 WT occupies a greater percentage of the total OL area (GFP +area) compared with other PATs, or with HA-ZDHHC9 XLID mutants. *p=0.032 (HA-ZDHHC9WT vs HA-ZDHHC3); p=0.0053 (HA-ZDHHC9WT vs HA-ZDHHC7); p=0.004 (HA-ZDHHC9WT vs HA-ZDHHC17); p=0.0036 (HA-ZDHHC9WT vs HA-ZDHHC9-R96W); p=0.0058 (HA-ZDHHC9WT vs HA-ZDHHC9-P150S); pP=0.0047 (HA-ZDHHC9WT vs HA-ZDHHC9-R148W), Data are from 3 to 5 cells per condition, pooled from n=3 cultures. Data are plotted as mean + SEM.
Figure 2—figure supplement 1
In oligodendrocyte (OL) cell bodies, ZDHHC9 localizes to somatic Golgi.
(A) Left: Experimental timeline for OL transfection experiments (duplicated from Figure 2A). Center, right: Images (maximum intensity projection of confocal z-stacks of cultured OLs after 3 days’ incubation in differentiation medium (‘OL3D’)). Note extensively ramified morphology and myelin basic protein (MBP) positivity, both of which are even more apparent after 6 days’ differentiation (‘OL6D’). (B) Images of cultured OL (maximum intensity projection of confocal z-slices) transfected to express mGFP and HA-ZDHHC9 (timeline as in Figure 2A) and immunostained as indicated. (C) Images of individual z-slices (planes 1–4) of the cell from A confirms colocalization of HA-ZDHHC9WT with Golgi marker GM130. (D) Representative image of OL transfected to express HA-ZDHHC9WT (HA-9) and immunostained to detect HA, MBP, and Golgi marker TGN38. (E) As D, but for OL immunostained to detect HA, MBP, and Golgi marker Giantin.
Figure 2—figure supplement 2
ZDHHC9-positive puncta in oligodendrocyte (OL) processes are Golgi outposts/satellites.
(A) Representative image of mature OL, transfected with the indicated cDNAs (timeline as in Figure 7A) and immunostained with the indicated antibodies. HA-ZDHHC9 WT colocalizes extensively with Golga7-myc in puncta in OL processes (arrows in zoomed images). (B) As A, but for OLs transfected to express HA-ZDHHC9 WT, Golgi outpost marker ManII-GFP, and mCherry. HA-ZDHHC9 colocalizes extensively with ManII-GFP in OL processes (arrows). (C) As A, but for OLs transfected to express HA-ZDHHC9 WT, Golgi outpost marker TPPP-Flag, and mGFP HA-ZDHHC9 WT also colocalizes with TPPP-Flag in OL processes (arrows).
Figure 3 with 1 supplement
No detectable gross abnormality in oligodendrocyte development in Zdhhc9 KO mice.
(A) Fluorescent (upper) and confocal (bottom) images of myelin basic protein (MBP) immunostaining in the brain of 6-week-old WT and Zdhhc9 KO mice. MBP confocal images were taken from layers IV/V of CTX. Scale bars: 500 (upper panel) and 20 (bottom) µm. (B) Fluorescent (upper) and confocal (bottom) images of EGFP in the brain of 8-week-old control (Mobp-EGFP) and Zdhhc9 KO (Mobp-EGFP; ZDHHC9y/-) male mice. EGFP confocal images were taken from the CC. Scale bars: 500 (upper panel) and 50 (bottom) µm. (C1-C3) Quantification of EGFP+ OLs in CTX, CC, and spinal cord (SC) from 3 week (P21), 4 week (P28), and 8 week (P56)-old control and Zdhhc9 KO Mobp-EGFP mice (n=3–5 mice for each group). (D) Confocal images of cortical PDGFRα+ OPCs from 3-week-old male mice (upper panel) and NG2+ OPCs from 8-week-old male mice (lower panel). Scale bar: 50 µm. (E) Quantification of the density of NG2+ OPCs in CTX of 3 week and 4-week-old WT and Zdhhc9 KO mice (n=3 per group). (F-1) Experimental scheme for OPC fate tracing. Pdgfra-CreER; RCE and Pdgfra-CreER; RCE; Zdhhc9 KO mice received tamoxifen injections starting at P21 for a duration of 3 days, and their brains were collected at P42. (F-2) Schematic diagram illustrating the stepwise changes in genetically labeled OPCs during fate tracing. (G) Confocal images of EGFP, NG2, and ASPA in CTX of control and Zdhhc9 KO Pdgfra-CreER; RCE mice (P21 + 21). Yellow arrowheads: overlapping signals between EGFP and NG2; white arrows: overlapped signals between EGFP and ASPA. Scale bars: 50 µm. (H) Quantification of EGFP+NG2+ OPCs and EGFP+ASPA+ OLs. (I) Percentage of NG2+ OPCs and ASPA+ OLs among EGFP+ cells. Data are mean ± SEM (E, H, I). For H and I, N=10 (control) or 7 (Zdhhc9 KO) male and female mice. Two-way ANOVA and subsequent pair-wise comparisons were performed with Šidák’s multiple comparison tests for (C, E, H, I). ns: not significant.
Figure 3—figure supplement 1
No alteration of oligodendrocyte density in Zdhhc9 KO mice.
(A) Fluorescent images of aspartoacylase (ASPA+) oligodendrocyte (OLs) in wild-type (WT) and Zdhhc9 KO mice. Scale bar: 500 μm. (B) Confocal images of ASPA, CC1, and Olig2 in the CTX and CC. Scale bar 25 μm. (C) Quantified ASPA+ OL densities. Data are mean + SEM. Students t-test. ns: non-significant. P56 WT (n=4) and Zdhhc9 KO (n=3) male mice. (D) Representative confocal images of BCAS1 in the CTX of 3-week-old WT and Zdhhc9 KO mice. Scale bar: 50 μm.
Figure 4
Genetic sparse cell labeling reveals altered complexity of oligodendrocyte processes in Zdhhc9 KO mice.
(A) Experimental flow of the sparse genetic labeling of oligodendrocytes (OLs), from acquisition of confocal images of mEGFP from cerebral cortex (CTX) in P56 Mobp-iCreER; mT/mG mice to 3D OL process tracing to Sholl analysis. mEGFP signal allows for detailed process morphology of individual OLs, compared to more complex ‘bulk’ MBP signal. (B) Representative results from tracing of OL processes. Scale bars: 20 µm. (C, D) Branch numbers (C) and process length (D) were compared between control (Mobp-iCreER; mT/mG) and Zdhhc9 KO (Mobp-iCreER; mT/mG; Zdhhc9 KO) mice. N=15 OLs (five OLs per mouse, three mice per group). Two-way ANOVA and pair-wise comparisons were performed with Šidák’s multiple comparison tests (C and D). ns: not significant. *p<0.05; **p<0.01. Data are mean ± SEM.
Figure 5 with 1 supplement
Abnormal oligodendrocyte processes in Zdhhc9 KO mice.
(A) Confocal microscopy of mEGFP in P56 Mobp-iCreER; mT/mG mice reveals morphological abnormalities, such as non-homogenous EGFP+ cell processes and spheroid-like membrane folding (yellow arrowheads). Scale bar: 20 µm. (B) 3D-reconstruction of EGFP+ oligodendrocytes (OLs) and DAPI+ nuclei from the images shown in (A) with the Imaris software. Scale bar: 7 µm. (C) OL processes and connected OL cell body were traced. Two different cells are shown in magenta and green. Arrowheads indicate spheroid-like swelling. (D, E) Quantification of process abnormalities per field (D) and per cell (E). N=15 cells from 3 mice per group. Student’s t-test. ***p<0.001.
Figure 5—figure supplement 1
Spheroid-like abnormal structures in Zdhhc9 KO mice are distinct from Olig2+ OL cell bodies.
Representative stacked confocal images of EGFP+ OLs and Olig2 in control (A-1) and Zdhhc9 KO (B-1) mice. Orthogonal views of the confocal images shown in A-1 (A-2) or in B-1 (B-2, B-3, and B-4). Scale bars: 20 μm. Asterisks denote Olig2+ cell bodies. Yellow arrowheads indicate abnormal swellings.
Figure 6
Altered myelination in Zdhhc9 KO corpus callosum in vivo.
(A) Electron micrographs of corpus callosum axons from P56 male mice of the indicated genotypes. Wild-type axons are uniformly myelinated, but in Zdhhc9 KO, some large axons are hypomyelinated (red dotted outline), while a subset of small axons appear hypermyelinated (blue dotted outline). There is also frequent dysmyelination (green asterisk). (B) Quantification of images from A reveal no change in total number of axons in Zdhhc9 KO. n.s.: not significant (p=0.7117, t test, N=3 mice per genotype). (C) Percentage of unmyelinated axons from mice of the indicated genotypes (N=3 mice per genotype; *p=0.0036, t-test). (D) Number of hypermyelinated small axons per field in corpus callosum images from mice of the indicated genotypes (N=3 mice per genotype; *p=0.0150, t test). (E) G-ratio of small diameter axons (0.1–0.5 μm) from mice of the indicated genotypes. (F) Average G-ratio from E confirms hypermyelination of small diameter axons in P50 Zdhhc9 KO mice. (G) as A, but from P30 mice. Deficits in myelination are already evident at this time. (H) As E, but for all axons from G. (I) Increased heterogeneity of myelination in Zdhhc9 KO corpus callosum at P30, represented by an increased interquartile range of G-ratios (*p=0.0425, t-test). Data in B, C, D, F, I are mean ± SEM.
Figure 7 with 1 supplement
ZDHHC9 loss cell-autonomously impairs maturation of cultured oligodendrocytes (OLs).
(A) Timeline of experiment. (B) Immunofluorescent images of cultured OLs, after infection with the indicated lentiviruses and fixation as in A. (C) Quantified data from B reveal that Zdhhc9 knockdown reduces the percentage of GFP-expressing (virally infected) MBP+ cells i.e., mature OLs (**p=0.0067, t-test, n=4 individual cultures per condition). (D) Likewise, Zdhhc9 knockdown reduces the percentage of myelin basic protein (MBP)-expressing GFP + cells. (*p=0.0359, t-test, n=4 individual cultures per condition). (E) Left: Images of individual OLs after infection and fixation as in B. Middle column: reconstructed outline of individual OLs. Right column: Images from middle column with superimposed concentric circles for Sholl analysis. (F) Sholl analysis from OLs reconstructed as in E confirms reduced morphological complexity of Zdhhc9 knockdown OLs. n=8 cells per condition. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001, individual t-tests. Data are mean ± SEM.
Figure 7—figure supplement 1
Zdhhc9 knockdown causes morphological immaturity of committed OLs.
(A): Images of cultured OLs immunostained with the indicated antibodies. Scale bar: 50 µm. (B): Quantified data from A confirm that Zdhhc9 knockdown increases the percentage of immature (CNP+, MBP-) virally infected OLs, n=15 fields of view per condition from 2 coverslips per condition, from a single culture.
Figure 8 with 1 supplement
ZDHHC9 palmitoylates myelin basic protein (MBP) in cultured cells and in vivo, and certain ZDHHC9 X-linked intellectual disability (XLID) mutants display residual protein acyltransferase (PAT) activity towards MBP.
(A) Western blots of palmitoyl- and total proteins from HEK293T cells transfected to express the indicated cDNAs. (B) Quantified data from C confirms that co-transfection of HA-ZDHHC9 and myc-Golga7 greatly increases MBP palmitoylation. No signal for palmitoyl-MBP is seen in the absence of the key reagent hydroxylamine (NH2OH), confirming assay specificity. ****p<0.0001, ANOVA with Dunnett’s multiple comparison test. (C) Western blots to detect MBP in total lysates and acyl biotin exchange (ABE) fractions from forebrain white matter (WM) (corpus callosum, CC and striatum) from mice of the indicated genotype. (D) Quantified data from C confirms that Zdhhc9 loss reduces palmitoyl, but not total, levels of 17 kDa and 21.5 kDa MBP isoforms. palmitoyl:total 17.5 kDa isoform, n=15–16 per genotype; **p=0.0078, palmitoyl:total 21 kDa isoform, n=8 per genotype,. ‘N’ number is lower for 21.5 kDa MBP because in a subset of experiments this isoform was not efficiently extracted and was hence undetectable. (E) As A, expect that HEK293T cells were transfected to express HA-tagged ZDHHC9wt or XLID mutant forms from Figure 2, plus the indicated additional proteins. Western blots of palmitoyl fractions (isolated by ABE assay) and total proteins are shown. (F) Quantified data from E for palmitoylation of MBP confirm that palmitoylation of MBP by ZDHHC9-P150S and ZDHHC9wt do not differ significantly and that palmitoylation of MBP by ZDHHC9-R96W is less impaired than that by ZDHHC9-R148W (****p<0.0001; ***p<0.001; *p<0.05; n.s.; not significant, ANOVA with Dunnett’s multiple comparison test). (G) Quantified data from E for autopalmitoylation of ZDHHC9 confirm that ZDHHC9wt and ZDHHC9-P150S autopalmitoylate to broadly similar extents but that autopalmitoylation of both ZDHHC9-R96W and ZDHHC9-R148W is significantly lower than that of ZDHHC9wt (****p<0.0001; ***p<0.001; *p<0.05; n.s.; not significant, ANOVA with Dunnett’s multiple comparison test). Data in B, D, F, G are mean + SEM.
-
Figure 8—source data 1
Original western blots for images shown in Figure 8A, C and E.
- https://cdn.elifesciences.org/articles/97151/elife-97151-fig8-data1-v1.zip
-
Figure 8—source data 2
PDF showing original western blots for images shown in Figure 8A, with relevant conditions and cropped regions marked.
- https://cdn.elifesciences.org/articles/97151/elife-97151-fig8-data2-v1.pdf
-
Figure 8—source data 3
PDF showing original western blots for images shown in Figure 8C, with relevant genotypes and cropped regions marked.
- https://cdn.elifesciences.org/articles/97151/elife-97151-fig8-data3-v1.pdf
-
Figure 8—source data 4
PDF showing original western blots for images shown in Figure 8E, with relevant conditions and cropped regions marked.
- https://cdn.elifesciences.org/articles/97151/elife-97151-fig8-data4-v1.pdf
Figure 8—figure supplement 1
Zdhhc9 loss impacts the palmitoyl-protein myelin-associated glycoprotein (MAG) but not Cadm4.
(A) Western blots to detect MAG in total lysates and ABE fractions from forebrain white matter (WM) (CC and striatum) from mice of the indicated genotype. (B) Quantified data from A confirm that Zdhhc9 loss significantly reduces palmitoyl and total levels of MAG, but palmitoyl:total level is not significantly affected. (C) As A, but blotted to detect Cadm4. (D) Quantified data from C confirm that Zdhhc9 loss does not significantly affect palmitoyl-, total or palmitoyl:total levels of Cadm4. *p<0.05, n.s.; not significant, unpaired t-test, N=12 per genotype. Data in B and D are mean + SEM.
-
Figure 8—figure supplement 1—source data 1
Original western blots for images shown in Figure 8—figure supplement 1.
- https://cdn.elifesciences.org/articles/97151/elife-97151-fig8-figsupp1-data1-v1.zip
-
Figure 8—figure supplement 1—source data 2
PDF showing original western blots for images shown in Figure 8—figure supplement 1, with relevant genotypes and cropped regions marked.
- https://cdn.elifesciences.org/articles/97151/elife-97151-fig8-figsupp1-data2-v1.pdf
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | B6;129S5-Zdhhc9tm1Lex/Mmucd | PMID:31747610 | MMRRC:032714-UCD | Extensively back-crossed against C57Bl/6 |
| Genetic reagent (Mus musculus) | Mobp-EGFP BAC Tg | MMRRC and Dr. D Bergles | GENSAT; RRID:MMRRC_030483-UCD | |
| Genetic reagent (Mus musculus) | Mobp-iCreER | Dr. D Bergles | ||
| Genetic reagent (Mus musculus) | Pdgfra-CreER BAC Tg | Jackson Laboratory | Strain #:018280, RRID:IMSR_JAX:018280 | |
| Genetic reagent (Mus musculus) | ROSA26-CAG-LSL-EGFP (RCE) | MMRRC and Dr. D. Bergles | MMRRC:032037-JAX, RRID:MMRRC_032037-JAX | |
| Genetic reagent (Mus musculus) | ROSA26-LSL-EGFP (mT/mG) | Jackson Laboratory; PMID:11299042 | MMRRC:032037-JAX, RRID:MMRRC_032037-JAX | |
| Antibody | Anti-HA-Tag (Rb monoclonal IgG) | Cell Signaling Technology | #3724 (C29F4) RRID:AB_1549585 | 1:100 (ICC) |
| Antibody | anti-HA.11 Epitope Tag (mouse IgG1) | Covance/Biolegend | HA.11 #MMS-101P RRID:AB_2314672 | 1:100 (ICC), 1:5000 (western blot) |
| Antibody | Anti-GFP (rabbit IgG) | ProteinTech | # 50430–2-AP, RRID:AB_11042881 | 1:500 (IF) |
| Antibody | Anti-GFP (rabbit IgG) | Invitrogen | #A11122 RRID:AB_221569 | 1:1000 (ICC) |
| Antibody | Anti-myc (mouse IgG1) | Cell Signaling Technology | #92013 (E7F9B) RRID:AB_2800176 | 1:200 (ICC) |
| Antibody | Anti-MBP (chicken IgY) | Aves Lab | #MBP RRID:AB_2313550 | 1:1000 (ICC) |
| Antibody | Anti-CNP (rabbit IgG) | Phosphosolutions | #325-CNP RRID:AB_2492062 | 1:1000 (ICC) |
| Antibody | Anti-APC (CC1) Mouse monoclonal IgG2b | EMD Millipore | #OP80 RRID:AB_2057371 | 1:50, with antigen retrieval |
| Antibody | anti-BCAS1 (rabbit IgG) | Synaptic Systems | # 445 003, RRID:AB_2864793 | 1:300 (IF) |
| Antibody | anti-BCAS1 (guinea pig IgG) | Synaptic Systems | # 445 004, RRID:AB_2905591 | 1:300 (IF) |
| Antibody | anti-ASPA (Rabbit IgG) | GeneTex | #GTX113389 RRID:AB_2036283 | 1:500, with antigen retrieval |
| Antibody | Anti-GFP (goat IgG) | Rockland | #600-101-215 RRID:AB_218182 | 1:500 (IF) |
| Antibody | Anti-MBP (mouse monoclonal IgG) | Biolegend | #808401 | 1:700 (IF) |
| Antibody | Anti-MBP (rabbit monoclonal IgG) | Cell Signaling Technology | #78896 (D8X4 Q) RRID:AB_2799920 | 1:700 (IF), 1:500 (western blot) |
| Antibody | anti-NG2 (guinea pig IgG) | Gift from Dr. D. Bergles | PMID:23542689 | 1:4000 (IF) |
| Antibody | Anti-Olig2 (goat IgG) | R&D | #AF2418 RRID:AB_2157554 | |
| Antibody | Anti-MAG (rabbit IgG) | Cell Signaling Technology | #9043 RRID:AB_2665480 | 1:500 (western blot) |
| Antibody | Anti-Myc (rabbit IgG) | Cell Signaling Technology | #2278 (71D10) RRID:AB_490778 | 1:500 (western blot) |
| Antibody | Anti-Cadm4 (mouse monoclonal IgG) | Antibodies Inc. | #75–247 RRID:AB_10676101 | 1:100 (western blot) |
| Antibody | anti-PDGFRa (goat IgG) | R&D Systems | #AF1062, RRID:AB_2236897 | 1:500 (IF) |
| Antibody | Alexa Fluor 488-conjugated anti-rabbit (donkey IgG) | Jackson ImmunoResearch | # 711-545-152, RRID:AB_2313584 | 1:500 (IF) |
| Antibody | Cy3-conjugated anti-rabbit | Jackson ImmunoResearch | # 711-165-152, RRID:AB_2307443 | 1:500 (IF) |
| Antibody | Alexa Fluor 647-conjugated anti-rabbit (donkey IgG) | Jackson ImmunoResearch | # 711-605-152, RRID:AB_2492288 | 1:500 (IF) |
| Antibody | Cy3-conjugated anti-goat (donkey IgG) | Jackson ImmunoResearch | # 705-165-147, RRID:AB_2307351 | 1:500 (IF) |
| Antibody | Alexa Fluor 647-conjugated anti-goat (donkey IgG) | Jackson ImmunoResearch | # 705-605-147, RRID:AB_2340437 | 1:500 (IF) |
| Antibody | Cy3-conjugated anti-mouse | Jackson ImmunoResearch | # 715-165-151, RRID:AB_2315777 | 1:500 (IF) |
| Antibody | Alexa Fluor 647-conjugated anti-mouse (donkey IgG) | Jackson ImmunoResearch | # 715-605-151,RRID:AB_2340863 | 1:500 (IF) |
| Antibody | Alexa Fluor 647-conjugated anti-guinea pig (donkey IgG) | Jackson ImmunoResearch | # 706-605-148,RRID:AB_2340476 | 1:500 (IF) |
| Antibody | Donkey anti-rabbit IgG, HRP-linked | Jackson ImmunoResearch | #711–0350152 | WB (1:5000) |
| Antibody | AlexaFluor 488 goat anti-chicken polyclonal | Thermo Fisher Scientific | #A-11039 (RRID:AB_142924) | 1:500 (IF) |
| Antibody | AlexaFluor 488 goat anti-rabbit polyclonal | Thermo Fisher Scientific | #A-11032 (RRID:AB_2534091) | 1:500 (IF) |
| Antibody | AlexaFluor 568 goat anti-rabbit polyclonal | Thermo Fisher Scientific | #A-11011 (RRID:AB_143157) | 1:500 (IF) |
| Antibody | AlexaFluor 568 goat anti-IgG2a polyclonal | Thermo Fisher Scientific | #A-21134 (RRID:AB_2535773) | 1:500 (IF) |
| Antibody | AlexaFluor 647 goat anti-IgG2a polyclonal | Thermo Fisher Scientific | #A-21241 (RRID:AB_141698) | 1:500 (IF) |
| Antibody | AlexaFluor 647 goat anti-IgG1 polyclonal | Thermo Fisher Scientific | #A-21240 (RRID:AB_141658) | 1:500 (IF) |
| Antibody | AlexaFluor 647 goat anti-IgG2b polyclonal | Thermo Fisher Scientific | #A-21242 (RRID:AB_2535811) | 1:500 (IF) |
| Chemical compound, drug | MMTS | Thermo Fisher Scientific | #23011 | |
| Chemical compound, drug | Hydroxylamine | Thermo Fisher Scientific | #26103 | |
| Chemical compound, drug | Biotin-HPDP | Soltec Ventures | #B106 | |
| Other | LTX with Plus reagent | Thermo Fisher Scientific | #15338100 | See Materials and methods ‘Transfection of Cultured OPCs’ |
| Other | High capacity neutravidin-conjugated beads | Thermo Fisher Scientific | #29202 | See Materials and methods ‘Acyl Biotinyl Exchange Assay’ |
| Other | Published RNA-Seq dataset – mouse CNS cell types | PMID:25186741 | See also brainrnaseq.org | |
| Other | Published RNA-Seq dataset – human CNS cell types | PMID:26687838 | See also brainrnaseq.org | |
| Recombinant DNA reagent | pMDLg | Addgene | Cat #12251 (RRID:Addgene_12251) | Lentiviral plasmid Gag and Pol expressing plasmid |
| Recombinant DNA reagent | pRSV-Rev | Addgene | Cat #12253 (RRID:Addgene_12253) | Lentiviral Rev expressing plasmid |
| Recombinant DNA reagent | pMD2.G | Addgene | Cat #12259 (RRID:Addgene_12259) | Lentiviral VSV-G envelope expressing plasmid |
| Recombinant DNA reagent | FEGW-Zdhhc9 sh | This study (Thomas Lab) | Lentiviral plasmid to transduce OPCs and express eGFP plus Zdhhc9 shRNA sequence from PMID:31747610 | |
| Recombinant DNA reagent | FEGW | PMID: 26719418 (Thomas Lab) | Lentiviral plasmid to transduce OPCs and express eGFP | |
| Sequence-based reagent | shRNA sequence matching rat and mouse Zdhhc9 | PMID:31747610 | Subcloned into FEGW-Zdhhc9 sh vector, described above | |
| Sequence-based reagent | MOBP-EGFP-BAC forward primer for genotyping | This study (Kang lab) | MOBP-EGFP (F) | Sequence: TTACTTGCCATAGCCGTTCC |
| Sequence-based reagent | MOBP-EGFP-BAC reverse primer for genotyping | This study (Kang lab) | MOBP-EGFP (R) | Sequence: GAACTTCAGGGTCAGCTTGC |
| Sequence-based reagent | MOBP-iCreER forward primer for genotyping | This study (Kang lab) | MOBP-iCreER (F) | Sequence: GTCCATCCCTGAAATCATGC |
| Sequence-based reagent | MOBP-iCreER reverse primer for genotyping | This study (Kang lab) | MOBP-iCreER (R) | Sequence: AGGATCTCTAGCCAGGCACA |
| Sequence-based reagent | Pdgfra-CreER forward primer for genotyping | This study (Kang lab) | PDGFRa ex2 (F) | Sequence: TCAGCCTTAAGCTGGGACAT |
| Sequence-based reagent | Pdgfra-CreER reverse primer for genotyping | This study (Kang lab) | Cre (R) | Sequence: ATGTTTAGCTGGCCCAAATG |
| Sequence-based reagent | ROSA26-EGFP (RCE) forward primer for genotyping | Dr. D Bergles | RCE-Rosa1 (F) | Sequence: CCCAAAGTCGCTCTGAGTTGTTATC |
| Sequence-based reagent | ROSA26-EGFP (RCE) reverse primer for genotyping | Dr. D Bergles | RCE-Rosa1 (R) | Sequence: GAAGGAGCGGGAGAAATGGATATG |
| Sequence-based reagent | ROSA26-EGFP (RCE) reverse primer for genotyping | Dr. D Bergles | RCE-CAG (R) | Sequence: CCAGGCGGGCCATTTACCGTAAG |
| Sequence-based reagent | ROSA26-mGFP (mT/mG) forward primer for genotyping | This study (Kang lab) | ROSA-M (F) | Sequence: CTCTGCTGCCTCCTGGCTTCT |
| Sequence-based reagent | ROSA26-mGFP (mT/mG) reverse primer for genotyping | This study (Kang lab) | ROSA-T (R) | Sequence: CGAGGCGGATCACAAGCAATA |
| Sequence-based reagent | ROSA26-mGFP (mT/mG) reverse primer for genotyping | This study (Kang lab) | ROSA-CAG (R) | Sequence: TCAATGGGCGGGGGTCGTT |
| Sequence-based reagent | ZDHHC9 KO forward primer for genotyping | This study (Kang lab) | DNA196-5 (ZDH9-F) | Sequence: GAAAGAAGGTGACACGGAAATG |
| Sequence-based reagent | ZDHHC9 KO reverse primer for genotyping | This study (Kang lab) | DNA196-6 (ZDH9-R) | Sequence: CAAATGCCCAGGAGGTACTGT |
| Sequence-based reagent | ZDHHC9 KO forward primer for genotyping | This study (Kang lab) | Neo 2 (F) | Sequence: CGATGCCTGCTTGCCGAATA |
| Software, algorithm | Fiji | PMID:22743772 | RRID:SCR_002285 | https://imagej.net/software/fiji/ |
| Software, algorithm | GraphPad Prism | GraphPad Software | RRID:SCR_002798 | https://www.graphpad.com/ |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Micro-scale control of oligodendrocyte morphology and myelination by the intellectual disability-linked protein acyltransferase ZDHHC9
eLife 13:RP97151.
https://doi.org/10.7554/eLife.97151.3
