VGLL2 and TEAD1 fusion proteins identified in human sarcoma drive YAP/TAZ-independent tumorigenesis by engaging EP300
- Department of Clinical Laboratory, Shanghai Chest Hospital, Shanghai Jiao Tong University School of Medicine, China
- Department of Molecular, Cell and Cancer Biology, University of Massachusetts Chan Medical School, United States
- Program in Molecular Medicine, University of Massachusetts Chan Medical School, United States
- Cutaneous Biology Research Center, Massachusetts General Hospital, Harvard Medical School, United States
Figures
Figure 1 with 2 supplements
VGLL2-NCOA2 and TEAD1-NCOA2 Induce TEAD-mediated transcriptional activation.
(A) Schematic representation of protein structure of VGLL2, TEAD1, NCOA2, VGLL2-NCOA2, and TEAD1-NCOA2. Tondu motif (TDU), TEA DNA binding domain (TEA), YAP binding domain (YBD), basic Helix-Loop-Helix (bHLH), Per-Arnt-Sim domain (PAS), nuclear receptor interaction domain (NID), and transcriptional activation domain (TAD). Arrows point to the break points. (B) Immunoblot analysis of YAP5SA, VGLL2-NCOA2, TEAD1-NCOA2, TAZ4SA, TEAD1, VGLL2, and NCOA2 in HEK293T cells transfected with the expression constructs carrying the HA tag. The figure shows the representative results of three biological replicates. (C) YAP5SA, VGLL2-NCOA2, TEAD1-NCOA2, TAZ4SA, TEAD1, VGLL2, and NCOA2 induce transcriptional activation of TBS (TEAD-binding site)-luciferase reporter (TBS-Luc) in HEK293T cells. Data were expressed as mean ± SD. n=3. ****p<0.0001. (D) Heatmap showing expression levels of the core genes including CCN2, CCN1, ANKRD1, and AMOTL2 significantly regulated in HEK293T cells expressing YAP5SA, VGLL2-NCOA2, and TEAD1-NCOA2. N=3. (E) mRNA expression levels of CCN2, ANKRD1, and CCN1 in HEK293T cells expressing YAP5SA, VGLL2-NCOA2, TEAD1-NCOA2, TEAD1, VGLL2, or NCOA2. Data were expressed as mean ± SD. n=3; ****p<0.0001. NS, no significance.
-
Figure 1—source data 1
Original western blot membranes corresponding to Figure 1B indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig1-data1-v1.zip
-
Figure 1—source data 2
Original western blot membranes corresponding to Figure 1B indicating the relevant bands.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig1-data2-v1.zip
Figure 1—figure supplement 1
VGLL2-NCOA2 regulates TEAD-dependent reporter activity.
(A) Schematic representation of the exons and breaking points of the VGLL2, TEAD1, and NCOA2 genes involved in generating VGLL2-NCOA2 and TEAD1-NCOA2 gene arrangement. (B) EdU staining showing cell proliferation of HEK293T cells transfected with VGLL2-NCOA2 or TEAD1-NCOA2. Bar chart showing the percentage of EdU-positive cells. Scale bars, 200 μm. Data were expressed as mean ± SD. n=3; **p<0.01. (C) Immunoblot analysis of VGLL2-NCOA2, VGLL2-NCOA2∆VGLL2, and VGLL2-NCOA2∆NCOA2 in HEK293T cells transfected with the expression constructs carrying the V5 tag. (D) TBS-Luc reporter activity in HEK293T cells expressing VGLL2-NCOA2, VGLL2-NCOA2∆VGLL2, and VGLL2-NCOA2∆NCOA2. Data were expressed as mean ± SD. n=3. ****p<0.0001. (E) Immunoblot analysis of VGLL2-NCOA2-V5 in HEK293T cells transfected with different amount of expression constructs. (F) VGLL2-NCOA2 promotes the activation of TBS-Luc reporter in dose-dependent manner. Data were expressed as mean ± SD. n=3. ***p<0.001; ****p<0.0001. (G–H) Relative mRNA levels of CCN2, ANKRD1, and CCN1 in HEK293T cells expressing VGLL2-NCOA2 (G) or TEAD1-NCOA2 (H) with HA (5′ end), FLAG (3′ end), or V5 (3′ end) tag. Data were expressed as mean ± SD. n=3; NS, no significance.
-
Figure 1—figure supplement 1—source data 1
Original western blot membranes corresponding to Figure 1—figure supplement 1C and E indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Original western blot membranes corresponding to Figure 1—figure supplement 1C and E indicating the relevant bands.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig1-figsupp1-data2-v1.zip
Figure 1—figure supplement 2
Analysis of VGLL2-NCOA2, TEAD1-NCOA2, and YAP5SA -induced transcriptomes.
(A) Volcano maps of RNA-seq data sets of HEK293T cells expressing VGLL2-NCOA2, TEAD1-NCOA2, or YAP5SA. Red dots represent upregulated mRNAs. Blue dots represent downregulated mRNAs. p<0.05, Log2FoldChange >1 or < –1. (B) Venn diagram showing the overlaps of differentially regulated genes identified by RNA-seq in HEK293T cells expressing VGLL2-NCOA2, TEAD1-NCOA2, or YAP5SA. (C) KEGG pathway enrichment analysis of differentially regulated genes identified by RNA-seq in HEK293T cells expressing VGLL2-NCOA2, TEAD1-NCOA2 or YAP5SA. ‘Hippo signaling pathway’ is highlighted in red.
Figure 2
VGLL2-NCOA2 and TEAD1-NCOA2-induced transcription does not require YAP and TAZ.
(A) Co-IP assays showing VGLL2-NCOA2 binding to TEAD1 but not YAP5SA. YAP5SA-Flag or TEAD1-Flag was co-expressed with VGLL2-NCOA2-HA in HEK293T cells and immunoprecipitated with an anti-HA antibody. (B) VGLL2-NCOA2 binds to endogenous TEAD but not YAP/TAZ. Endogenous YAP/TAZ and TEAD proteins in HEK293T cells were detected by anti-YAP/TAZ and panTEAD antibodies, respectively. (C) Co-IP assays showing endogenous YAP/TAZ binding to TEAD1 but not TEAD1-NCOA2. TEAD1-Flag or TEAD1-NCOA2-Flag was expressed in HEK293T cells and immunoprecipitated with an anti-Flag antibody. Endogenous YAP/TAZ proteins were detected by anti-YAP/TAZ antibodies. (D) The activity of TBS-Luc reporter in HEK293T cells expressing YAP5SA, VGLL2-NCOA2, or TEAD1-NCOA2, with TEAD inhibitor CP1 (5 μM) treatment or co-expression of TEAD-ENR repressor construct. Data were expressed as mean ± SD. n=3; ****p<0.0001. NS, no significance. (E) Schematic representation of TEAD-ENR. TEA DNA-binding domain (TEA) and Engrailed repressor domain (ENR). (F) Immunoblot analysis of TEAD-ENR expression in HEK293T cells. (G) Co-IP assays showing YAP/TAZ were not essential for VGLL2-NCOA2 binding to endogenous TEADs. VGLL2-NCOA2-HA was expressed in HEK293T cells with or without YAP/TAZ knockdown and immunoprecipitated with an anti-HA antibody. (H) Relative mRNA levels of CCN2, ANKRD1, and CCN1 in HEK293T cells with YAP/TAZ knockdown and expressing VGLL2-NCOA2 or TEAD1-NCOA2. Data were expressed as mean ± SD. n=3; ****p<0.0001.
-
Figure 2—source data 1
Original western blot membranes corresponding to Figure 2A, B, C, F and G indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig2-data1-v1.zip
-
Figure 2—source data 2
Original western blot membranes corresponding to Figure 2A, B, C, F and G.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig2-data2-v1.zip
Figure 3 with 1 supplement
Characterization of VGLL2-NCOA2- and YAP-controlled transcriptional and chromatin landscapes.
(A) Intersection of ATAC-seq (n=2), RNA-seq (n=3), and CUT&RUN (n=2) datasets in HEK293T cells expressing VGLL2-NCOA2 or YAP5SA. (B) Venn diagrams showing the overlaps of ATAC-seq peaks, CUT&RUN peaks, and differentially regulated genes from RNA-seq in HEK293T cells expressing VGLL2-NCOA2 or YAP5SA. (C) KEGG pathway enrichment analysis of ATAC-seq peaks identified in HEK293T cells expressing VGLL2-NCOA2 or YAP5SA. The ‘Hippo signaling pathway’ is highlighted in red. (D) Distribution of CUT&RUN binding sites for VGLL2-NCOA2 and YAP5SA. (E) Motif enrichment analysis of VGLL2-NCOA2 and YAP5SA CUT&RUN Peaks. (F) Genomic tracks showing VGLL2-NCOA2 and YAP5SA occupancy at the CCN2, ANKRD1, and CCN1 loci.
Figure 3—figure supplement 1
ATAC-seq and CUT&RUN data characterization in VGLL2-NCOA2 and YAP5SA-expressing cells.
(A) Heatmaps of TEAD-motif containing ATAC-seq peaks in HEK293T cells expressing VGLL2-NCOA2 or YAP5SA. (B) Distribution of ATAC-seq peaks in HEK293T cells expressing VGLL2-NCOA2 or YAP5SA. For VGLL2-NCOA2 ATAC-seq peaks, Promoter (≤ 1 kb) 50.57%, promoter (1–2 kb) 6.59%, 5′ UTR 0.13%, 3' UTR 1.44%, exon 1.52%, intron 18.39%, and distal and Intergenic 21.35%. For YAP5SA ATAC-seq peaks, promoter (≤ 1 kb) 51.4%, promoter (1–2 kb) 6.89%, 5′ UTR 0.13%, 3′ UTR 1.45%, exon 1.58%, intron 17.28%, and distal and intergenic 21.26%. n=2. (C) VGLL2-NCOA2 promotes chromatin accessibility. Scatter diagrams of ATAC-seq peaks show more upregulated (red) than downregulated (blue) in HEK293T cells transfected with VGLL2-NCOA2 or YAP5SA. (D) Heatmaps of VGLL2-NCOA2 and YAP5SA CUT&RUN peaks. (E) VGLL2-NCOA2 and YAP genomic occupancy. Scatter diagrams showing more upregulated CUT&RUN peaks (red) than downregulated CUT&RUN peaks (blue) of VGLL2-NCOA2 and YAP5SA. (F) KEGG pathway enrichment analysis of VGLL2-NCOA2 and YAP5SA CUT&RUN peaks. ‘Hippo signaling pathway’ is highlighted in red.
Figure 4
VGLL2-NCOA2 and TEAD1-NCOA2 engage EP300 epigenetic regulators.
(A) Diagram showing the BioID proteomic analyses of BirA*-VGLL2-NCOA2, BirA*-TEAD1-NCOA2, BirA*-YAP5SA, and BirA*-TAZ4SA. (B) Co-IP assays showing endogenous EP300 binding to VGLL2-NCOA2 and TEAD1-NCOA2 but not YAP5SA. (C) KEGG enrichment analysis of EP300 CUT&RUN peaks in control HEK293T cells and HEK293T cells expressing VGLL2-NCOA2 or TEAD1-NCOA2. The ‘Hippo signaling pathway’ is highlighted in red. (D) Motif enrichment analysis of EP300 CUT&RUN peaks in control HEK293T cells and HEK293T cells expressing VGLL2-NCOA2 or TEAD1-NCOA2. (E) Genomic tracks showing EP300 occupancy at the CCN1, ANKRD1, CCN2, and CREB3 loci in control HEK293T cells and HEK293T cells expressing VGLL2-NCOA2 or TEAD1-NCOA2.
-
Figure 4—source data 1
Original western blot membranes corresponding to Figure 4B indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig4-data1-v1.zip
-
Figure 4—source data 2
Original western blot membranes corresponding to Figure 4B indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig4-data2-v1.zip
Figure 5
EP300 is required for VGLL2-NCOA2- and TEAD1-NCOA2-induced tumorigenesis in vitro.
(A) Co-IP assays showing the NCOA2 fusion part of VGLL2-NCOA2 was essential for EP300 binding. VGLL2-NCOA2-V5, VGLL2-NCOA2∆NCOA2-V5, and VGLL2-NCOA2∆VGLL2-V5 were expressed in HEK293T cells and immunoprecipitated using an anti-V5 antibody. Endogenous EP300 proteins were detected by anti-EP300 antibody. (B–D) mRNA levels of Ccn2, Ankrd1, and Ccn1 in C2C12 cells expressing YAP5SA, VGLL2-NCOA2, or TEAD1-NCOA2 with or without treatment of A485 (5 μM). Data were expressed as mean ± SD. n=3; ****p<0.0001. NS, no significance. (E) Representative image of colony formation of C2C12 cells expressing YAP5SA, VGLL2-NCOA2, or TEAD1-NCOA2 with or without treatment of A485 (5 μM) for 2 weeks. Scale bars, 100 μm. (F, G) Colony size (F) and number of colonies (G) formed by C2C12 cells expressing YAP5SA, VGLL2-NCOA2, or TEAD1-NCOA2 with or without treatment of A485 (5 μM). Data were expressed as mean ± SD. **p<0.01; ****p<0.0001. NS, no significance.
-
Figure 5—source data 1
Original western blot membranes corresponding to Figure 5A indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig5-data1-v1.zip
-
Figure 5—source data 2
Original western blot membranes corresponding to Figure 5A indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig5-data2-v1.zip
Figure 6
EP300 is essential for VGLL2-NCOA2- and TEAD1-NCOA2-induced tumorigenesis in vivo.
(A) Representative H&E and IHC staining of Desmin and Ki67 in C2C12-control allograft, C2C12-VGLL2-NCOA2 tumor allograft, and C2C12-TEAD1-NCOA2 tumor allograft. Scale bars, 200 μm. (B) Immunoblot analysis of VGLL2-NCOA2-FLAG and TEAD1-NCOA2-FLAG expression in C2C12 cells, detected by an anti-FLAG antibody. (C, D) Allograft leg volume of C2C12-VGLL2-NCOA2 (C) and C2C12-TEAD1-NCOA2 (D) after intramuscular injection into the leg of Nude mice with or without intraperitoneal injection of A485 (100 mg/kg). The error bars represent the mean leg volume ± SEM. n=6. ****p<0.0001. (E) Representative H&E and IHC staining of Ki67 in C2C12-VGLL2-NCOA2 and C2C12-TEAD1-NCOA2 tumor allografts with or without A485 (100 mg/kg) treatment. Scale bars, 200 μm. (F) Percentage of Ki67-positive cells in (E). Data were expressed as mean ± SD. n=6; ***p<0.001. (G, H) mRNA levels of Ccn2, Ankrd1, and Ccn1 in C2C12-VGLL2-NCOA2 and C2C12-TEAD1-NCOA2 tumor allografts with or without A485 (100 mg/kg) treatment. Data were expressed as mean ± SD. **p<0.01; ***p<0.001; ****p<0.0001.
-
Figure 6—source data 1
Original western blot membranes corresponding to Figure 6B indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig6-data1-v1.zip
-
Figure 6—source data 2
Original western blot membranes corresponding to Figure 6B indicating the relevant bands.
The molecular weight markers are indicated.
- https://cdn.elifesciences.org/articles/98386/elife-98386-fig6-data2-v1.zip
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-Flag (mouse monoclonal) | Invitrogen | MA1-91878 | CUT&RUN (0.5 μg) |
| Antibody | Anti-GAPDH (rabbit monoclonal) | Cell Signaling Technology | 2118 | WB (1:10,000) |
| Antibody | Anti-YAP/TAZ (rabbit monoclonal) | Cell Signaling Technology | 8418 | WB (1:1000) |
| Antibody | Anti-panTEAD (rabbit monoclonal) | Cell Signaling Technology | 13295 | WB (1:1000) |
| Antibody | Anti-V5 (rabbit monoclonal) | Cell Signaling Technology | 13202 | WB (1:1000) |
| Antibody | Anti-EP300 (rabbit monoclonal) | Cell Signaling Technology | 86377 | WB (1:1000); CUT&RUN (0.5 μg) |
| Antibody | Anti-Flag (rabbit monoclonal) | Cell Signaling Technology | 2368 | WB (1:1000); IP (1:50) |
| Antibody | Anti-Flag (mouse monoclonal) | Cell Signaling Technology | F9291 | WB (1:1000); IP (1:50) |
| Antibody | Anti-HA (rabbit monoclonal) | Cell Signaling Technology | 3724 | WB (1:1000); IP (1:50) |
| Antibody | Anti-HA (mouse monoclonal) | Cell Signaling Technology | 2367 | WB (1:1000); IP (1:50) |
| Antibody | HRP-conjugated secondary antibodies | Jackson Laboratories | WB (1:2000) | |
| Antibody | Anti-Ki67 (rabbit monoclonal) | Cell Signaling Technology | 12202 | IHC (1:500) |
| Antibody | Anti-Desmin (rabbit monoclonal) | Cell Signaling Technology | 5332 | IHC (1:100) |
| Strain, strain background (NU/J nude mice) | NU/J nude mice | The Jackson Laboratory | 002019 | |
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-3216 | |
| Cell line (mouse-sapiens) | C2C12 | ATCC | CRL-1772 | |
| Chemical compound, drug | A485 | SelleckChem | S8740 | |
| Chemical compound, drug | Streptavidin Sepharose beads | GE Healthcare | 17511301 | |
| Chemical compound, drug | SignalStain Antibody Diluent | Cell Signaling Technology | 8112 | |
| Chemical compound, drug | Lipofectamine 2000 | Invitrogen | 11668019 | |
| Chemical compound, drug | CP1 | MCE | HY-139330 | |
| Commercial assay or kit | CUTANA ChIC/CUT&RUN Kit | EpiCypher | 14-1048 | |
| Commercial assay or kit | CUT&RUN Library Prep Kit | EpiCypher | 14-1001 | |
| Commercial assay or kit | RNeasy Mini Kit | QIAGEN | 74104 | |
| Commercial assay or kit | Vectastain Elite ABC kit | Vector Laboratories | PK-6105 | |
| Commercial assay or kit | In-Fusion HD Cloning | Clontech | Clontech: 639647 | |
| commercial assay or kit | Dual-luciferase reporter kit | Promega | E1910 | |
| Commercial assay or kit | iTaq Universal One-Step RT-qPCR Kit | Bio-Rad | 1725150 | |
| Commercial assay or kit | BeyoClick EdU Cell Proliferation Kit with Alexa Fluor 488 | Beyotime | C0071 | |
| Commercial assay or kit | iTaq Universal One-Step RT-qPCR Kit | Bio-Rad | 1725150 | |
| Recombinant DNA reagent | GAPDH-F' | This paper | PCR primers | GGAGCGAGATCCCTCCAAAAT |
| Recombinant DNA reagent | GAPDH-R' | This paper | PCR primers | GGCTGTTGTCATACTTCTCATGG |
| Recombinant DNA reagent | CCN2-F' | This paper | PCR primers | CAGCATGGACGTTCGTCTG |
| Recombinant DNA reagent | CCN2-R' | This paper | PCR primers | AACCACGGTTTGGTCCTTGG |
| Recombinant DNA reagent | ANKRD1-F' | This paper | PCR primers | GCCTACGTTTCTGAAGGCTG |
| Recombinant DNA reagent | ANKRD1-R' | This paper | PCR primers | GTGGATTCAAGCATATCACGGAA |
| Recombinant DNA reagent | CCN1-F' | This paper | PCR primers | CAGGACTGTGAAGATGCGGT |
| Recombinant DNA reagent | CCN1-R' | This paper | PCR primers | GCCTGTAGAAGGGAAACGCT |
| Recombinant DNA reagent | Actb-F' | This paper | PCR primers | GTGACGTTGACATCCGTAAAGA |
| Recombinant DNA reagent | Actb-R' | This paper | PCR primers | GCCGGACTCATCGTACTCC |
| Recombinant DNA reagent | Ccn2-F' | This paper | PCR primers | GACCCAACTATGATGCGAGCC |
| Recombinant DNA reagent | Ccn2-R' | This paper | PCR primers | CCCATCCCACAGGTCTTAGAAC |
| Recombinant DNA reagent | Ankrd1-F' | This paper | PCR primers | GGATGTGCCGAGGTTTCTGAA |
| Recombinant DNA reagent | Ankrd1-R' | This paper | PCR primers | GTCCGTTTATACTCATCGCAGAC |
| Recombinant DNA reagent | Ccn1-F' | This paper | PCR primers | TAAGGTCTGCGCTAAACAACTC |
| Recombinant DNA reagent | Ccn1-R' | This paper | PCR primers | CAGATCCCTTTCAGAGCGGT |
Additional files
-
Supplementary file 1
RNA-seq analysis showing the genes whose expression was significantly changed in HEK293T cells expressing VGLL2-NCOA2, p-value <0.05, Log2 Fold Change >1 or Log2 Fold Change < –1.
- https://cdn.elifesciences.org/articles/98386/elife-98386-supp1-v1.xlsx
-
Supplementary file 2
RNA-seq analysis showing the genes whose expression was significantly changed in HEK293T cells expressing TEAD1-NCOA2, p-value <0.05, Log2 Fold Change >1 or Log2 Fold Change < –1.
- https://cdn.elifesciences.org/articles/98386/elife-98386-supp2-v1.xlsx
-
Supplementary file 3
RNA-seq analysis showing the genes whose expression was significantly changed in HEK293T cells expressing YAP5SA, p-value <0.05, Log2 Fold Change >1 or Log2 Fold Change < –1.
- https://cdn.elifesciences.org/articles/98386/elife-98386-supp3-v1.xlsx
-
Supplementary file 4
List of specific BioID hits obtained with BirA*-YAP5SA, BirA*-TAZ4SA, BirA*-VGLL2-NCOA2, and BirA*-TEAD1-NCOA2.
- https://cdn.elifesciences.org/articles/98386/elife-98386-supp4-v1.xls
-
MDAR checklist
- https://cdn.elifesciences.org/articles/98386/elife-98386-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
VGLL2 and TEAD1 fusion proteins identified in human sarcoma drive YAP/TAZ-independent tumorigenesis by engaging EP300
eLife 13:RP98386.
https://doi.org/10.7554/eLife.98386.3
