Genome-wide mapping of native co-localized G4s and R-loops in living cells
- Key Laboratory of Birth Defects and Related Disease of Women and Children of MOE, Department of Pediatrics, West China Second University Hospital, State Key Laboratory of Biotherapy and Collaborative Innovation Center of Biotherapy, Sichuan University, China
- Department of Hematology and Institute of Hematology, State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University, China
- Development and Related Diseases of Women and Children Key Laboratory of Sichuan Province, China
Figures
Figure 1 with 1 supplement
Mapping of the native DNA G-quadruplex (G4) through the G4-hemin-mediated proximal biotinylation.
(A) Immunofluorescence staining of the HEK293 cells treated with indicated conditions using the Alexa Fluor 647 labeled recombinant streptavidin (Strep-647). Nuclei were stained with the …
-
Figure 1—source data 1
PDF file containing original microscope images displayed in Figure 1A and G, indicating the selected regions.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig1-data1-v1.pdf
-
Figure 1—source data 2
Original files of microscope images are displayed in Figure 1A and G.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig1-data2-v1.zip
Figure 1—figure supplement 1
Comparison between the BG4-seq and HepG4-seq.
(A) The Coomassie blue stained SDS-PAGE gel showing the purified recombinant mSA-scFV (mSA and anti-GP41 scFV), GP41-pG-Tn5 (GP41 tag, protein G and Tn5), BG4-V5 (G4 scFV BG4 and V5 tag), and HBD-V5 …
-
Figure 1—figure supplement 1—source data 1
PDF file containing original gel pictures for Figure 1—figure supplement 1A, indicating the selected regions.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig1-figsupp1-data1-v1.pdf
-
Figure 1—figure supplement 1—source data 2
Original files for gel pictures are displayed in Figure 1—figure supplement 1A.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig1-figsupp1-data2-v1.zip
Figure 2
Mapping of the co-localized G-quadruplex (G4) and R-loop in the HEK 293 cells by combining the HepG4-seq and hybrid-binding domain (HBD)-seq.
(A) Schematic of the HBD-seq procedure. HBD-V5, the recombinant fusion protein of the N-terminal hybrid-binding domain (HBD) of RNase H1 and V5 tag; GP41-pG-Tn5, the recombinant fusion protein of …
Figure 3
The co-localized G-quadruplexes (G4s) and R-loops-mediated transcriptional regulation in HEK293 cells.
(A) Cumulative distribution plot showing comparisons of FPKMs of G-quadruplexe (G4), R-loop, co-localized G4 & R-loop associated genes and all genes in HEK293 cells. (B) Scatter plot showing the …
Figure 4 with 1 supplement
Mapping of the co-localized G-quadruplexes (G4s) and R-loops in the mouse embryonic stem cells.
(A) Heatmap showing the signal of HepG4-seq and hybrid-binding domain (HBD)-seq ±1.5 kb around the center of peaks in mouse embryonic stem cells (mESCs). Two biologically independent replicates are …
Figure 4—figure supplement 1
Distribution of co-localized G4 & R-loop peak sizes.
(A) Bar chart showing the distribution of co-localized G-quadruplex (G4) & R-loop peak sizes in mouse embryonic stem cells (mESCs). Different, the strand of PQS localized is the same as the template …
Figure 5
The co-localized G-quadruplexes (G4s) & R-loops are mainly localized in active promoters and enhancers.
(A) Cumulative distribution plot showing comparisons of FPKMs of G4-, R-loop-, and co-localized G4 & R-loop-associated genes and all genes in mouse embryonic stem cells (mESCs). (B) Scatter plot …
Figure 6 with 1 supplement
Modulation of the co-localized G-quadruplexes (G4s) & R-loops by the helicase Dhx9.
(A) Western blot showing the protein levels of Dhx9 and Gapdh in the wild-type (WT) and dhx9KO mouse embryonic stem cells (mESCs). The non-specific band is labeled with a star. This experiment was …
-
Figure 6—source data 1
PDF file containing original western blots for Figure 6A and original microscope images for Figure 6B, indicating the selected regions.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig6-data1-v1.pdf
-
Figure 6—source data 2
Original files for western blots are displayed in Figure 6A and microscope images are displayed in Figure 6B.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig6-data2-v1.zip
Figure 6—figure supplement 1
This figure is linked to both Figure 6 and Figure 7.
(A) Volcano plot showing distributions of differential G-quadruplexes (G4s) and R-loops in wild-type (WT) and dhx9KO mouse embryonic stem cells (mESCs). Significantly up-regulated (p-value <0.05, …
Figure 7
Characterization of the co-localized G-quadruplexes (G4s) & R-loops directly bound by Dhx9.
(A) Heatmap showing expression levels of resolving helicases or regulators of G4s and/or R-loops differentially expressed in wild-type (WT) and dhx9KO mouse embryonic stem cells (mESCs). Color …
Figure 8
Dhx9 regulates the cell fate of mouse embryonic stem cells.
(A) Relative RNA levels of indicated genes in the wild-type (WT) and dhx9KO mouse embryonic stem cells (mESCs) that were measured by quantitative RT-PCR (qRT-PCR). Data are means ± SD; n=3 (three …
-
Figure 8—source data 1
PDF file containing original western blots for Figure 8B and original microscope images for Figure 8C and F, indicating the selected regions.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig8-data1-v1.pdf
-
Figure 8—source data 2
Original files for western blots are displayed in Figure 8B and microscope images are displayed in Figure 8C and F.
- https://cdn.elifesciences.org/articles/99026/elife-99026-fig8-data2-v1.zip
Figure 9
Comparisons of HepG4-seq and hybrid-binding domain (HBD)-seq with previous methods.
(A) Pie charts showing the percentages of HepG4-seq peaks overlapping with peaks identified by BG4 CUT&Tag; Venn diagrams comparing HepG4-seq peaks and BG4 CUT&Tag seqs. (B) Heatmap showing the …
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | anti-Dhx9 (Rabbit monoclonal) | ABclonal | Cat# A4563; RRID:AB_2863296 | IF(1:100), WB (1:1000) |
| Antibody | anti-GAPDH (Mouse monoclonal) | Proteintech | Cat# 60004–1-Ig; RRID:AB_2107436 | WB (1:200000) |
| Antibody | anti-Nanog (Rabbit monoclonal) | Proteintech | Cat#: 14295–1-AP; RRID:AB_1607719 | WB (1:2000) |
| Antibody | anti-Nanog (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DHSB) | Cat#: PCRP-NANOGP1-2D8; RRID:AB_2722264 | IF (1:50) |
| Antibody | anti-Oct4 (Mouse monoclonal) | Santa Cruz | Cat#: sc-5279; RRID:AB_628051 | IF (1:200), WB (1:1000) |
| Antibody | anti-Lin28a (Rabbit monoclonal) | Proteintech | Cat#: 11724–1-AP; RRID:AB_2135039 | WB (1:1000) |
| Antibody | anti-rabbit IgG (H+L) HRP (Goat Polyclonal) | Bioss | Cat#: bs-0295G-HRP; RRID:AB_10923693 | WB (1:2000) |
| Antibody | anti-mouse IgG (H+L) HRP (Goat Polyclonal) | SinoBiological | Cat#: SSA007; RRID:AB_2917997 | WB (1:2000) |
| Antibody | anti-mouse IgG (H+L) Alexa Fluor 488 (Donkey Polyclonal) | Invitrogen | Cat#: A-21202; RRID:AB_141607 | IF (1:2000) |
| Recombinant protein | Streptavidin-Alexa647 | Bioss | Cat#: bs-0437P-AF647 | IF (1:200) |
| Sequence-based reagent | Dhx9 sgRNA1 | This paper | CRISPR sgRNA targeting Sequence | ATCAGAGGTGTCGCTAAGTA |
| Sequence-based reagent | Dhx9 sgRNA2 | This paper | CRISPR sgRNA targeting Sequence | GAAGGGTTACCAGCACCAAT |
Additional files
-
Supplementary file 1
G-quadruplex (G4) and R-loop peaks in HEK293 cells.
(a) HepG4-seq peaks in HEK293 cells (b) Merged HepG4-seq peaks in HEK293 cells treated with DMSO, ML216, NSC617145 (c) HBD-seq peaks in HEK293 cells (d) Co-localized G4 and R-loop peaks in HEK293 cells € Co-localized G4 and R-loop peaks-associated genes with differential expression after treatment with G4 Inhibitor.
- https://cdn.elifesciences.org/articles/99026/elife-99026-supp1-v1.xlsx
-
Supplementary file 2
G-quadruplex (G4) and R-loop peaks in mouse embryonic stem cells (mESCs).
(a) HepG4-seq peaks in mESCs (b) HBD-seq peaks in mESCs (c) Co-localized G4s and R-loops in mESCs (d) Co-localized G4s and R-loops in the promoters of mESCs (e) Co-localized G4s and R-loops in the enhancers of mESCs (f) Differential G4 and R-loop peaks in dhx9KO mESCs compared to WT mESCs (g) Genes with differential expression levels in dhx9KO mESCs compared to wild-type (WT) mESCs (h) Dhx9 CUT&Tag peaks in mESCs (i) Co-localized G4s and R-loops bound by Dhx9 in mESCs.
- https://cdn.elifesciences.org/articles/99026/elife-99026-supp2-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/99026/elife-99026-mdarchecklist1-v1.docx
