Abstract
Interpretation of variants identified during genetic testing is a significant clinical challenge. In this study, we developed a high-throughput CDKN2A functional assay and characterized all possible CDKN2A missense variants. We found that 40% of all missense variants were functionally deleterious. We also used our functional classification to assess the performance of in silico models that predict the effect of variants, including recently reported models based on machine learning. Notably, we found that all in silico models similarly when compared to our functional classifications with accuracies of 54.6 – 70.9%. Furthermore, while we found that functionally deleterious variants were enriched within ankyrin repeats, rarely were all missense variants at a single residue functionally deleterious. Our functional classifications are a resource to aid the interpretation of CDKN2A variants and have important implications for the application of variant interpretation guidelines, particularly the use of in silico models for clinical variant interpretation.
Introduction
Genetic testing of patients with cancer to identify variants associated with an increased cancer risk and sensitivity to targeted therapies is becoming more common as broad testing criteria are integrated into clinical care guidelines (Goggins et al., 2020; Stoffel et al., 2019). American College of Medical Genetics (ACMG) provides a framework to integrate multiple types of evidence, including variant characteristics, disease epidemiology, clinical information, and functional classifications, to interpret variants in any gene (Richards et al., 2015). In silico variant effect predictors are also integrated into AMCG variant interpretation guidelines as supporting evidence to aid classification of variants. While numerous models have been developed, varied accuracy, poor agreement between models, and inflated performance on publicly available data have been reported (Cubuk et al., 2021; Jaffe et al., 2011; Wilcox et al., 2022). Recently developed variant effect predictors aim to overcome these limitations by incorporating deep-learning based protein structure predictions and by not training on human annotated datasets (Brandes et al., 2023; Cheng et al., 2023; Gao et al., 2023). However, post-development assessment of machine learning based variant effect predictors to determine accuracy on novel experimental datasets and suitability for clinical use are limited.
Variants that cannot be classified as either pathogenic or benign are categorized as variants of uncertain significance (VUSs). However, while pathogenic and benign variants identified during genetic testing are clinically actionable, VUSs are the cause of deep uncertainty for patients and their health care providers as an unknown fraction are functionally deleterious and therefore, likely pathogenic. For example, individuals with germline VUSs in a pancreatic cancer susceptibility gene would not be eligible for clinical surveillance programs that are associated with improved patient outcomes, unless they otherwise meet family history criteria (Goggins et al., 2020; Stoffel et al., 2019). Similarly, patients with breast or pancreatic cancer and a germline BRCA2 VUS would not be eligible for treatment with olaparib, a poly (ADP-ribose) polymerase inhibitor (Golan et al., 2019; Tutt et al., 2021). Reclassification of VUSs into pathogenic or benign strata has real-world, life-or-death consequences that necessitate a high degree of accuracy.
Germline VUSs in hereditary cancer genes are a frequent finding in patients with cancer and frequently can be reclassified as pathogenic on the basis of in vitro functional characterization (Kimura et al., 2022). In patients with pancreatic ductal adenocarcinoma (PDAC), germline CDKN2A VUSs affecting p16INK4a, most often rare missense variants, are found in up to 4.3% of patients (Chaffee et al., 2018; Kimura et al., 2021; McWilliams et al., 2018; Roberts et al., 2016; Shindo et al., 2017; Zhen et al., 2015). As functional data from well-validated in-vitro assays are incorporated into ACMG variant interpretation guidelines, we recently determined the functional consequence of 29 CDKN2A VUSs identified in patients with PDAC using an in vitro cell proliferation assay (Kimura et al., 2022; Richards et al., 2015). We found that over 40% of VUSs assayed were functionally deleterious and could reclassified as likely pathogenic.
Functional characterization is time-consuming, expensive, and requires technical and scientific expertise. These limitations hinder assessment of in silico variant effect predictors and patient access to functional data that may allow reclassification of VUSs into clinically actionable strata. As CDKN2A VUSs will continue to be identified in patients with cancer undergoing genetic testing, we developed a multiplexed functional assay to provide a broad interpretation framework for CDKN2A variants. We characterized all possible CDKN2A missense variants and compared our functional classifications to including recently developed in silico models based on machine learning to determine the accuracy of variant effect predictions.
Results
Functional characterization of CDKN2A missense variants
We utilized a codon optimized CDKN2A sequence for our multiplexed functional assay (Appendix 1-table 1). Expression of codon optimized CDKN2A or three synonymous CDKN2A variants, p.L32L, p.G101G, and p.V126V, in PANC-1, a PDAC cell line with a homozygous deletion of CDKN2A, resulted in significant reduction is cell proliferation (P value < 0.0001; Figure 1-figure supplement 1A). Conversely, expression of three pathogenic variants, p.L32P, p.G101W, and p.V126D, in PANC-1 cells did not result in any significant changes in cell proliferation. To determine if there were unappreciated selective effects during in vitro culture, we generated a CellTag library based on the pLJM1 plasmid that contained twenty non-functional 9 base pair barcodes of equal representation. We then transduced PANC-1 cells stably expressing codon optimized CDKN2A with the CellTag library and determined representation of each barcode in the cell pool, before and after in vitro culture. We found no statistically significant changes in barcode representation, indicating that representation of a pool of functionally neutral variants is stable over a period of in vitro culture representing our assay time course (Figure 1-figure supplement 1B).
We next determined whether we could identify functionally deleterious CDKN2A variants at a single residue when all amino acid variants were assayed simultaneously. We generated lentiviral expression libraries for two CDKN2A amino acid residues, p.V126 and p.R144, that include pathogenic and benign variants, respectively. Each lentiviral expression library contained all amino acid variants (19 missense and 1 synonymous variant) at a single residue. We then transduced PANC-1 cells with each of the lentiviral expression libraries and determined the representation of each variant in the resulting cell pool before and after a period of in vitro culture (Figure 1A, B). Synonymous variants, p.V126V and p.R1441R, as well as a previously reported benign variant, p.R144C, either decreased or maintained their representation in the cell pool during in vitro culture. Representation of a previously reported pathogenic variant, p.V126D, increased in the cell pool. Notably, several other variants including p.V126R, p.V126W, p.V126K, and p.V126Y, increased in representation, suggesting that additional amino acid changes at this residue are functionally deleterious (Figure 1A).

Pooled analysis of CDKN2A variants at two residues with previously reported pathogenic and benign variants.
PANC-1 cell stably expressed with a total of 20 CDKN2A variants, 19 missense variants and 1 synonymous variant, at resides were cultured. Variant representation, as percent of reads supporting the variant sequence, before and after a period in vitro cell growth determined by next generation sequencing for two residues, p.V126 (A) or p.R144 (B). CDKN2A variant p.V126D (*) was previously reported as pathogenic and increased representation during in vitro growth. CDKN2A variant p.R144C (**) was previously reported as benign variant and maintained representation during in vitro growth.
Next, to functionally characterize 2,964 CDKN2A missense variants, we generated 156 CDKN2A lentiviral expression libraries where each library contained all possible amino acid substitutions at a single residue. PANC-1 cells were then transduced with each of the lentiviral expression libraries and representation of each CDKN2A variant in the resulting cell pool determined before and after a period of in vitro culture. Variant read counts were then analyzed using a gamma generalized linear model and variants with statistically significant P values were classified as functionally deleterious. Variants with P values that did not reach statistical significance were classified as functionally deleterious.
We found that 1,182 of 2,964 missense variants (39.9%) characterized in our assay were functionally deleterious and that 1,782 variants (60.1%) were functionally neutral (Figure 2A, Appendix 1-table 2). In general, our results were consistent with previously reported classifications. Thirty-two variants identified in patients with cancer and previously reported to be functionally deleterious in published literature and/or reported in ClinVar as pathogenic or likely pathogenic were characterized as functionally deleterious in our assay (Figure 2B, Appendix 1-table 3) (Chaffee et al., 2018; Chang et al., 2016; Horn et al., 2021; Hu et al., 2018; Kimura et al., 2022; McWilliams et al., 2018; Roberts et al., 2016; Zhen et al., 2015). Of 162 benign variants, including 156 synonymous variants and six missense variants previously reported to be functionally neutral in published literature and/or reported in ClinVar as benign or likely benign, all were characterized as functionally neutral in our assay (Figure 2B, Appendix 1-table 3) (Kimura et al., 2022; McWilliams et al., 2018; Roberts et al., 2016). Similarly, of 50 missense variants classified as VUSs in ClinVar that also have previously reported functional data, only two variants, p.G35Q and p.G101R, had divergent functional classifications. Both variants were previously reported to have functionally neutral effects but were characterized as functionally deleterious in our assay (Figure 2C, Appendix 1-table 2, 3).

Functional characterization of all possible CDKN2A missense variants.
(A) Functional classifications of 3,120 CDKN2A variants, including all possible 2,964 missense variants and 156 synonymous variants. Variants were classified as functionally deleterious or neutral based on P value. 1,182 (39.9%) of variants were classified as functionally deleterious. (B) P values for 32 benchmark pathogenic variants and 162 benign variants. All pathogenic variants were classified as functionally deleterious, and all benign variants were classified as functionally neutral, based on P values. (C) High-throughput functional assay P values for 32 CDKN2A VUSs previously reported to have functionally deleterious effects and 18 VUSs previously reported to have functionally neutral effects. (D) Heat map with P values for all 3,120 CDKN2A variants assayed.
Comparison to in silico prediction algorithms
As in silico predictions of variant effect are integrated into ACMG variant interpretation guidelines as supporting evidence, we compared the ability of different algorithms, including recently described algorithms that incorporate deep-learning models of protein structure to predict the functional consequence of CDKN2A missense variants. Using our functional classifications for all CDKN2A missense variants as truth, we compared our functional classifications to predictions from CADD, PolyPhen-2, SIFT, VEST, AlphaMissense, ESM1b, and PrimateAI-3D. Predictions for all missense variants (1,182 functionally deleterious and 1,782 functionally neutral) were available for comparison for all algorithms, except CADD and PrimateAI-3D, where 910 (349 functionally deleterious and 561 functionally neutral) and 904 (349 functionally deleterious and 555 functionally neutral) missense variants had predictions available respectively (Appendix 1-table 4). In silico variant effect predictors performed similarly across a broad range of performance characteristics (Appendix 1-table 5). Accuracy of in silico model predictions were 54.6 – 70.9% (CADD – 56.8%; PolyPhen-2 – 54.6%; SIFT – 61.4%; VEST – 70.8%; AlphaMissense – 70.9%; ESM1b – 64.9%; and PrimateAI-3D; 66.7%) (Figure 3). We also assessed sensitivity, specificity, positive predictive value, and negative predictive value for each model. We found that sensitivity was 0.15 – 0.90 (CADD – 0.86; PolyPhen-2 – 0.9; SIFT – 0.64; VEST – 0.67; AlphaMissense – 0.69; ESM1b – 0.77; and PrimateAI-3D – 0.15), specificity was 0.31 – 0.99 (CADD – 0.39; PolyPhen-2 – 0.32; SIFT – 0.60; VEST – 0.74; AlphaMissense – 0.72; ESM1b – 0.57; and PrimateAI-3D – 0.99), positive predictive value was 0.46 – 0.93 (CADD – 0.47; PolyPhen-2 – 0.46; SIFT – 0.51; VEST – 0.63; AlphaMissense – 0.62; ESM1b – 0.54; and PrimateAI-3D – 0.93), and negative predictive value was 0.65 – 0.82 (CADD – 0.81; PolyPhen-2 – 0.82; SIFT – 0.71; VEST – 0.77; AlphaMissense – 0.78; ESM1b – 0.79; and PrimateAI-3D – 0.65).

Comparison of functional classifications and in silico variant effect predictions for all possible CDKN2A missense variants.
Variant effect predictions for CDKN2A missense variants using CADD, PolyPhen-2, SIFT, VEST, AlphaMissense, ESM1b, and PrimateAI-3D. Predicted deleterious, damaging, or pathogenic effects (black box) and predicted neutral, tolerated, benign, or ambiguous effects (white box) presented as percent of missense variants with available prediction. Number of missense variants with available prediction for each in silico model given in parentheses. CADD; Combined Annotation Dependent Depletion, PolyPhen-2; Polymorphism Phenotyping v2, SIFT; Sorting Intolerant From Tolerant, VEST; Variant Effect Scoring Tool score.
Distribution of functionally deleterious variants
Functionally deleterious missense variants were not distributed evenly across CDKN2A. CDKN2A contains four ankyrin repeats that mediate protein-protein interactions, ankyrin repeat 1 at codon 11-40, ankyrin repeat 2 at codon 44-72, ankyrin repeat 3 at codon 77-106, and ankyrin repeat 4 at codon 110-139 (Goldstein, 2004; Ruas and Peters, 1998; Sun et al., 2010) (Figure 2-figure supplement 1A). Functionally deleterious variants were enriched in ankyrin repeat 1 (44.8%, adjusted P value = 8.5 x 10-4), ankyrin repeat 2 (47.4%, adjusted P value = 1.4 x 10-6), and ankyrin repeat 3 (55.0%, adjusted P value = 6.1 x 10-22), and depleted in ankyrin repeat 4 (27.2%, adjusted P value = 1.6 x 10-8), non-ankyrin repeat residue 1-10 (22.0%, adjusted P value = 1.5 x 10-5), and residues 140-156 (9.1%, adjusted P value = 4.5 x 10-30) (Figure 2-figure supplement 1B). Moreover, functionally deleterious variants were further enriched within 10 residue subregions of ankyrin repeats 1-3, with 59.5% of variants in residues 14 – 23 of ankyrin repeat 1, 63.5% of variants in residues 46-55 of ankyrin repeat 2, and 81.5% of variants in residues 80-89 of ankyrin repeat 3 being classified as functionally deleterious (Figure 2D, Appendix 1-table 2). Furthermore, analysis of functionally deleterious variants may highlight critical and non-critical resides for CDKN2A function. Across all single residues, the mean percent of functionally deleterious missense variants was 39.9% (95% confidence interval: 34.7% – 45.0%) (Figure 2-figure supplement 1C). At six amino acid residues, p.G55, p.P81, p.H83, p.D84, p.G89, and p.P114, all missense variants were functionally deleterious. These residues are conserved between human and murine p16 (Byeon et al., 1998). Furthermore, p.H83 has been reported to stabilized peptide loops connecting the helix-turn-helix structure exhibited by four ankyrin repeats (Byeon et al., 1998), whereas p.D84 and p.G89 are located in a 20- residue region reported to interact with CDK4 and CDK6 (Fåhraeus et al., 1996). Conversely, at 18 residues, no missense variant was characterized as functionally deleterious (Appendix 1-table 2).
Functional effect of CDKN2A somatic mutations
Somatic alterations in CDKN2A are a frequent finding in many types of cancer. However, not all somatic alterations are unequivocally deleterious to protein function. Missense somatic mutations, for example, are particularly challenging to functionally interpret and the presence of a functionally neutral somatic mutation may impact patient care (Tung et al., 2020). To understand the functional effect of missense somatic mutations in CDKN2A, we functionally classified mutations reported in the Catalogue Of Somatic Mutations In Cancer (COSMIC) (Forbes et al., 2009), The Cancer Genome Atlas (TCGA) (Muddabhaktuni and Koyyala, 2021), patients with cancer undergoing sequencing at The Johns Hopkins University School of Medicine (JHU), Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets Clinical Sequencing Cohort (MSK-IMPACT) (Cheng et al., 2015). Overall, 355 unique missense somatic mutations were reported, of which 193 (54.4%) were functionally deleterious (Appendix 1-table 6). The percent of missense somatic mutations that were classified as functionally deleterious was greater than the percent of all possible CDKN2A missense variants that were classified as functionally deleterious, suggesting enrichment of functionally deleterious missense changes among somatic mutations (Figure 2A, Appendix 1-table 6). The prevalence of functionally deleterious missense somatic mutations was similar in COSMIC, TCGA, JHU, and MSK-IMPACT with 55.9%, 68.0%, 65.7%, and 66.7% of mutations being classified as functionally deleterious, respectively (Figure 4A, Appendix 1-table 6). Similar to all functionally deleterious variants, functionally deleterious missense somatic mutations were not distributed evenly across CDKN2A. Functionally deleterious somatic mutations were enriched within the ankyrin repeat 3 (Figure 4B, Appendix 1-table 6), We found that 29.0%, 37.1%, 50.8%, and 42.9% of all functionally deleterious missense somatic mutations occurred within ankyrin repeat 3 in COSMIC, TCGA, JHU, and MSK-IMPACT, respectively, and within this domain, 62.7%, 73.1%, 72.7%, and 70.8% of functionally deleterious mutations were in residues 80-89 in COSMIC, TCGA, JHU, and MSK-IMPACT, respectively (Figure 4B).

Functional classification of missense somatic mutations in CDKN2A.
(A) Missense somatic missense variants in CDKN2A reported in COSMIC, TCGA, JHU, or MSK-IMPACT, by functional classification (deleterious – black box; neutral – white box). (B) Distribution of functionally deleterious missense somatic mutations CDKN2A reported in COSMIC, TCGA, JHU, or MSK-IMPACT by ankyrin (ANK) repeat.
We were also able to assess the contribution of functionally deleterious CDKN2A missense somatic mutations in COSMIC, TCGA, JHU, and MSK-IMAPCT by cancer type, and found that 44.4 – 95.7% of reported CDKN2A missense somatic mutations were functionally deleterious when stratified by cancer type (Figure 4-figure supplement 1A-D). When considering missense somatic mutation reported in all databases, there was enrichment of functionally deleterious mutations in melanoma (84.8%; adjusted P value – 0.019) and depletion of functionally deleterious mutations in colorectal adenocarcinoma (49.0%; adjusted P value = 2.6 x 10-4) (Figure 4-figure supplement 2). As the proportion of missense somatic mutations that were functionally deleterious was less in colorectal carcinoma compared to other types of cancer, we assessed whether somatic mutations in mismatch repair genes (MLH1, MSH2, MSH6, and PMS2) were associated with the functional status of CDKN2A missense somatic mutations. Thirty-six samples in COSMIC had a CDKN2A missense somatic mutation, of which 12 samples (33.3%) had a somatic mutation in a mismatch repair gene. We found that 3 of 12 samples (25%) with a somatic mutation in a mismatch repair gene had a functionally deleterious CDKN2A missense somatic mutation compared to 12 of 24 samples (50%) without a somatic mutation in a mismatch repair gene (Fisher’s exact test; P = 0.2821).
Discussion
VUSs in hereditary cancer susceptibility genes, predominantly rare missense variants, are a frequent finding in patients undergoing genetic testing and the cause of significant uncertainty. ACMG variant interpretation guidelines incorporate functional data, as well as other evidence such as in silico predictions of variant effect, to aid classification of variants as either pathogenic or benign. CDKN2A VUSs are a frequent finding in patients with PDAC. We previously found that over 40% of CDKN2A VUSs were functionally deleterious and therefore could be reclassified as likely pathogenic using ACMG variant interpretation guidelines. In this study, we developed a validated high-throughput in vitro assay and functionally characterized 2,964 CDKN2A missense variants, representing all possible single amino acid variants. We found that 1,182 missense variants (39.9%) were functionally deleterious. These pre-defined functional characterizations are resource for the scientific community and can be integrated into variant interpretation schema, such as those from the ACMG, to aid classification of CDKN2A germline variants and somatic mutations.
Our comprehensive characterization of all possible CDKN2A missense variants allowed us to assess the ability of in silico algorithms – including recently published predictors based on machine learning AlphaMissense, ESM1b, and PrimateAI-3D – to predict the pathogenicity or functional effect of CDKN2A missense variants. We found that all in silico variant effect predictors assessed performed similarly. Overall, PolyPhen-2 had highest sensitivity and negative predictive value at 0.90 and 0.82 respectively. PrimateAI-3D had the highest specificity and positive predictive values at 0.99 and 0.93, respectively. However, while specificity and positive predictive values were high, Primate AI-3D lowest sensitivity and negative predictive values at 0.15 and 0.65 respectively. Highest accuracy was observed with AlphaMissense at 70.9%, closely followed by VEST at 70.8%. Given that reclassification of VUSs in hereditary cancer genes into inappropriate strata has significant implications for patients, integration of in silico models, including those utilizing machine learning, may be premature. Ultimately, our data support current ACMG guidelines that include in silico predictions of variant effect as supporting evidence of pathogenicity or benign impact.
Our study also provides other insight for the implementation of variant interpretation guidelines. ACMG guidelines include presence of a missense variants at a residue with a previously reported pathogenic variant as moderate evidence of pathogenicity. We found that the mean percent of functionally deleterious missense variants per residue was 39.9% and that only six amino acid residues were all missense variants functionally deleterious. These data suggest, at least for CDKN2A, that the presence of a pathogenic missense variant at a residue should be used with caution when classifying other missense variants at the same residue.
Our high-throughput functional assay characterized variants based upon a broad cellular phenotype, cell proliferation, in a single PDAC cell line. However, there appear to be limited cell-specific and assay-specific differences in functional classifications of CDKN2A variants. In our previous study, we characterized 29 CDKN2A VUSs in three PDAC cell lines, using cell proliferation and cell cycle assays, and found agreement between all functional classifications (Kimura et al., 2022). Nevertheless, our assay may not encompass all cellular functions of CDKN2A and underestimate the number of functionally deleterious missense variants. Moreover, in this study, we found that functionally deleterious effects were enriched among somatic missense mutations compared to all CDKN2A missense variants, further supporting the veracity of our functional classifications. Furthermore, in silico models to predict variant effect may characterize function (CADD, PolyPhen-2, and SIFT) or pathogenicity (VEST, AlphaMissense, ESM1b, and PrimateAI-3D). As our assay does not directly characterize pathogenicity, to compare in silico assays, we assumed that predicted pathogenic variants were functionally deleterious.
In this study, we determined functional classifications for all possible CDKN2A missense variants to aid variant classifications. Furthermore, comparison of our functional classifications to in silico variant effect predictors, including recently described algorithms based on machine learning, provides performance benchmarks and supports current recommendations integrating data computational data into variant interpretation guidelines.
Methods
Cell lines
PANC-1 (American Type Culture Collection, Manassas, VA; catalog no. CRL-1469), a human PDAC cell line with a homozygous deletion of CDKN2A (Caldasl et al., 1994) and 293T (American Type Culture Collection; catalog no. CRL-3216), a human embryonic kidney cell line, were maintained in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific Inc., Waltham, MA; catalog no.11995-065) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Inc.; catalog no. 26140-079). Cell line authentication and mycoplasma testing were performed using the GenePrint 10 System (Promega Corporation, Madison, WI; catalog no. B9510) and the PCR-based MycoDtect kit (Greiner Bio-One, Monroe, NC; catalog no. 463 060) (Genetics Resource Core Facility, The Johns Hopkins University, Baltimore, MD).
CDKN2A somatic mutation data
CDKN2A (p16INK4; NP_000068.1) missense somatic mutation data was obtained from the Catalogue Of Somatic Mutations In Cancer (Forbes et al., 2009), The Cancer Genome Atlas (Muddabhaktuni and Koyyala, 2021), patients with cancer undergoing sequencing at The Johns Hopkins University School of Medicine (Baltimore, MD), Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets Clinical Sequencing Cohort (Cheng et al., 2015).
Plasmids
pHAGE-CDKN2A (Addgene, Watertown, MA; plasmid no. 116726) was created by Gordon Mills & Kenneth Scott (Ng et al., 2018). pLJM1 (Addgene; plasmid no. 91980) was created by Joshua Mendell (Golden et al., 2017). pLentiV_Blast (Addgene, plasmid no. 111887) was created by Christopher Vakoc (Tarumoto et al., 2020). psPAX2 (Addgene, plasmid no. 12260) was created by Didier Trono), and pCMV-VSV-G (Addgene, plasmid no. 8454) was created by Bob Weinberg (Stewart et al., 2003).
CDKN2A expression plasmid libraries
CDKN2A cDNA from pHAGE-CDKN2A was subcloned into the pLJM1 plasmid as previously described (Kimura et al., 2022). Codon-optimized CDKN2A cDNA using p16INK4A amino acid sequence (NP_000068.1), was designed (Appendix 1-table 1) and pLJM1 containing codon optimized CDKN2A (pLJM1-CDKN2A) generated (Twist Bioscience, South San Francisco, CA). Then, 156 plasmid libraries were synthesized using pLJM1-CDKN2A such that each library contained all possible 20 amino acids variants (19 missense and 1 synonymous) at a given position.
Single variant CDKN2A expression plasmids
Individual pLJM1-CDKN2A expression constructs for CDKN2A missense variants, p.L32L, p.L32P, p.G101G, p.G101W, p.V126D, and p.V126V were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA; catalog no. E0552). Primers used for site-directed mutagenesis are given in Appendix 1-table 7. Integration of each CDKN2A variant was confirmed using Sanger sequencing (Genewiz, Plainsfield, NJ) using the CMV Forward sequencing primer (CGCAAATGGGCGGTAGGCGTG). The manufacturer’s protocol was followed unless otherwise specified.
CellTag plasmid library
Twenty nonfunctional 9 base pair barcodes “CellTags” were subcloned into pLentiV_Blast using Q5® Site-Directed Mutagenesis kit (New England Biolabs; catalog no. E0552) (Biddy et al., 2018). Primers used to generate each CellTag plasmid are given in Appendix 1-table 7. Integration of each CellTag was confirmed using Sanger sequencing (Genewiz) (sequencing primer: AACTGGGAAAGTGATGTCGTG). The manufacturer’s protocol was followed unless otherwise specified. CellTag plasmids were then pooled to form a CellTag plasmid library with equal representation of each CellTag plasmid.
Lentivirus production
Lentivirus production was performed as previously described with the following modifications (Kimura et al., 2022). pLJM1 lentiviral expression vectors (plasmid libraries and single variant expression plasmids) and lentiviral packaging vectors (psPAX2 and pCMV-VSV-G) were transfected into 293T cells using Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA; catalog no. L3000008). Media was collected at 24 hours and 48 hours, pooled, and lentiviral particles concentrated using Lenti-X Concentrator (Clontech, Mountain View, CA; catalog no. 631231).
Lentiviral transduction
PANC-1 cells were used for CDKN2A plasmid library and single variant CDKN2A expression plasmid transductions. PANC-1 cells previously transduced with pLJM1-CDKN2A (PANC- 1CDKN2A) were used for CellTag library transductions. Briefly, 1 x 105 cells were cultured in media supplemented with 10 ug/ml polybrene and transduced with x 107 transducing units per mL of lentivirus particles. Cells were then centrifuged at 1,200 x g for 1 hour. After 48 hours of culture at 37°C and 5% CO2, transduced cells were selected using 3 µg/ml puromycin (CDKN2A plasmid libraries and single variant CDKN2A expression plasmids) or 5 µg/ml blasticidin (CellTag plasmid library) for 7 days. After selection, cells were trypsinized for passage into T150 flasks and DNA collection. T150 flasks were cultured for 2-5 weeks until confluent and then DNA collected. DNA was extracted from PANC-1 cells using the PureLinkTM Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA; catalog no. K1820-01).
Generation of sequence libraries
Library preparation and sequencing was performed as previously described with the following modifications (Kinde et al., 2011). For the 1st stage PCR, 3 target specific primers were designed to amplify CDKN2A amino acid positions 1 to 53, 54 to 110, and 111 to 156. Forward and reverse 1st stage primers contained 5’ sequence, M13F (GTAAAACGACGGCCAGC) and M13R (CAGGAAACAGCTATGAC) respectively, to enable second stage of amplification and ligation of Illumina adapter sequences (Appendix 1-table 7). DNA was amplified with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs; catalog no. M0494S). For the 1st stage PCR, each DNA sample was amplified in three reactions each containing 66 ng of DNA.1st stage PCR products for each sample were then pooled and purified using the Agencourt AMPure XP system (Beckman Coulter, Inc, Brea, CA; catalog no. A63881) into 50 µL of elution buffer. Purified PCR product was amplified in a 2nd stage PCR to add Illumina adaptor sequences and indexes (Appendix 1-table 7). PCR Amplification was performed with KAPA HiFi HotStart PCR Kit (Kapa Biosystems, Wilmington, MA; catalog no. KK2501) in 25 µL reactions containing 5X KAPA HiFi Buffer - 5 µL, 10 mM KAPA dNTP Mix - 0.75 µL, 10 μM forward primer - 0.75 µL, 10 μM reverse primer - 0.75 µL. For the 1st stage PCR, 66 ng of template DNA and 12.5 µL, Q5 Hot Start High-Fidelity 2X Master Mix was used with the following cycling conditions: 98 °C for 30 seconds; 25 cycles of 98 °C for 10 seconds, 72 °C for 30 seconds, 72 °C for 25 seconds; 72 °C for 2 minutes. For the 2nd stage PCR, 0.25 µL of of 1st stage PCR product and 0.5 µL of 1 U/μL KAPA HiFi HotStart DNA Polymerase was used with the following cycling conditions: 95 °C for 3 minutes; 25 cycles of 98 °C for 20 seconds, 62 °C for 15 seconds, 72 °C for 1 minute. 2nd stage PCR products were purified with the Agencourt AMPure XP system (Beckman Coulter, Inc.; catalog no. A63881) into 30 µL of elution buffer. Samples were quantified by Qubit using dsDNA HS assay kit (Invitrogen; catalog no. Q33230).
Sequencing and analysis
Sequence libraries were pooled into groups of 16 samples and sequenced on the Illumina MiSeq System (Illumina, San Diego, CA) with the MiSeq Reagent Kit v2 (300 cycles) (Illumina catalog no. MS-102-2002) to generate 150 base pair paired-end reads. Samples were demultiplexed and FASTQ sequenced read files were generated with MiSeq control software 2.5.0.5 (Illumina). Paired sequence reads were then combined into a single contiguous sequence using Paired-End Read Merger (Zhang et al., 2014). Reads supporting each variant at a given amino acid position were counted using perl.
Functional characterization of CDKN2A variants using gamma generalized linear model
We determined if a variant has a fitness advantage by assessing the significance of the observed ratio rv,cf at confluence between the number of cells with a missense variant 𝑣 and the number of cells with a synonymous variant at a given amino acid position. Under the assumption that the missense variant is neutral (null model), we assumed that the distribution of rv,cf can be explained by two key covariates: 𝑟𝑣,𝑖𝑛𝑖𝑡, which represent the missense variant-to-synonymous variant ratio at day 9, and 𝑝𝑣,𝑖𝑛𝑖𝑡, the proportion of the missense variant cells among other variants, including the synonymous variant, at the studied position. More specifically, given the variables 𝑟𝑣,𝑖𝑛𝑖𝑡 𝑎𝑛𝑑 𝑝𝑣,𝑖𝑛𝑖𝑡, the ratio at confluence follows a distribution:

where the mean 𝑢𝑣 of the Gamma distribution is such that:

Here, the parameters of the null model to estimate are α, 𝑎, 𝑎𝑛𝑑 𝑏, where α, is the shape parameter of the Gamma distribution and is assumed to be the same for all variants. This model is a Gamma Generalized Linear Model (GLM) over the response variable 𝑟𝑣,𝑐𝑓 with a log-link function and covariates 𝑙𝑜𝑔(𝑟𝑣,𝑖𝑛𝑖𝑡) and 𝑙𝑜𝑔(𝑝𝑣,𝑖𝑛𝑖𝑡). Estimating the parameters will provide a null distribution of 𝑟𝑣,𝑐𝑓, generating a p-value for every observed 𝑟𝑣,𝑐𝑓 for any variant at a given position.
To estimate the parameters α, a, and 𝑏, we utilized three control experiments where the CellTag plasmid library was transduced into PANC-1CDKN2Aco cells so that each CellTag represented a neutral variant. For a single experiment, every variant can be considered as wild-type, and we test the other 19 variants against it, knowing that they are neutral and therefore follow the null distribution. This provides us with 19 x 20 triplets 
After the estimation of parameters α, a, and 𝑏, every observation for a tested variant 𝑣 at a given position of the triplet 
Data visualization
Heat map of individual variant p-values by amino position was generated using R with the heatmaply package (Galili et al., 2018).
Cell proliferation assay
Cell proliferation assay were performed as previously described with the following modifications (Kimura et al., 2022). 1 × 105 cells were seeded into in vitro culture on day 0. Cell were counted on day 14 using a TC20 Automated Cell Counter (Bio-Rad Laboratories, Herclues, CA; catalog no. 1450102). Relative cell proliferation value was calculated as cell number normalized to empty vector control. Assays were repeated in triplicate. Mean cell proliferation value and standard deviation (s.d.) were calculated.
Variant effect predictions
Publicly available algorithms were used to predict the consequence of CDKN2A missense variants. Prediction algorithms used included: Combined Annotation Dependent Depletion (CADD) (Kircher et al., 2014), Polymorphism Phenotyping v2 (PolyPhen-2) (Adzhubei et al., 2010), Sorting Intolerant From Tolerant (SIFT) (Kumar et al., 2009), Variant Effect Scoring Tool score (VEST) (Carter et al., 2013), AlphaMissense (18), ESM1b (Brandes et al., 2023), and PrimateAI-3D (Gao et al., 2023) (Appendix 1-table 4). PolyPhen-2, SIFT, VEST, AlphaMissense, and ESM1b prediction were available for all missense variants. CADD scores were available for 910 missense variants and where multiple CADD scores were possible, mean values were used. PrimateAI-3D prediction scores were available for 904 assayed missense variants.
Statistical analyses
Statistical analyses were performed using JMP v.11 (SAS, Cary, NC) and Python statsmodel package (version 0.14.0). Cell proliferation value means were compared with the Student’s t-test. Proportions of functionally deleterious missense variants and somatic mutations were compared with the Z-test and multiple test correction performed with the Bonferroni method. P values < 0.05 were considered statistically significant.
Acknowledgements
Funding
National Institutes of Health grant P50CA62924 (NJR) Susan Wojcicki and Dennis Troper (NR)
The Sol Goldman Pancreatic Cancer Research Center (NJR) The Rolfe Pancreatic Cancer Foundation (NJR)
The Japanese Society of Gastroenterology Support for Young Gastroenterologists Studying in the United States (HK)
The Japan Society for the Promotion of Science Overseas Research Fellowships (HK)
Competing interests
Authors declare that they have no competing interests.
Data and materials availability
All data are available in the main text or the supplementary materials.
Supplementary Information
Figures
Figure 1-figure supplement 1. Development and validation of high-throughput CDKN2A functional assay.
Figure 2-figure supplement 1. Functional characterization of all possible CDKN2A missense variants.
Figure 4-figure supplement 1. Functional classification of missense somatic mutations in CDKN2A.
Figure 4-figure supplement 2. Aggregate functional classifications for missense somatic mutations in CDKN2A
Tables
Appendix 1-table 1. Codon optimized CDKN2A sequence.
Appendix 1-table 2. Assay outputs and functional classifications for all possible CDKN2A missense and synonymous variants.
Appendix 1-table 3. Benchmark pathogenic variants, benchmark benign variants, and variants of uncertain significance with previously reported function data.
Appendix 1-table 4. In silico variant effect predictions for CDKN2A missense variants. Appendix 1-table 5. Assessment of in silico variant effect prediction models.
Appendix 1-table 6. Missense somatic mutations in CDKN2A reported in COSMIC, TCGA, JHU, MSK-IMPACT.
Appendix 1-table 7. Sequences of primers used in study.
Source data
Figure 1-source data Raw data in Figure 1
Figure 1-figure supplement 1-source data 1 Raw data in Figure 1-figure supplement 1A Figure 1-figure supplement 1-source data 2 Raw data in Figure 1-figure supplement 1B Figure 2-source data 1
Raw data in Figure 2A Figure 2-source data 2
Raw data in Figure 2B and C Figure 2-source data 3
Raw data in Figure 2D
Figure 2-figure supplement 1-source data 1
Raw data in Figure 2-figure supplement 1B
Figure 2- figure supplement 1-source data 2
Raw data in Figure 2- figure supplement 1C
Figure 3-source data 1
Raw data in Figure 3
Figure 4-source data 1
Raw data in Figure 4
Figure 4-figure supplement 1-source data 1
Raw data in Figure 4-figure supplement 1
Figure 4-figure supplement 2-source data 1
Raw data in Figure 4-figure supplement 2

Development and validation of high-throughput CDKN2A functional assay.
(A) Cell proliferation of PANC-1 cells stably expressing empty expression vector, one of three synonymous variants (p.L32L, p.G101G, p.V126V), or one of three pathogenic variants (p.L32P, p.G101W, p.V126D) over 14 days in culture. Cell proliferation values are given as mean of three repeats ± standard deviation normalized to PANC-1 cells that stably express empty vector. Statistically significant inhibition of cell proliferation inhibition in PANC-1 cells that stably express synonymous variants *; Student’s t test, P value < 0.001). (B) PANC-1 cells stably express codon optimized CDKN2A transduced with a CellTag lentiviral library of 20 nonfunctional barcodes were cultured and representation (percent of reads supporting each barcode) before and after a period of in vitro cell proliferation was measured determined by next generations sequencing. Percent values are given as the mean of three repeats ± standard deviation.

Functional characterization of all possible CDKN2A missense variants.
(A) Schematic representation of CDKN2A ankyrin repeats. (B) Percent of functionally deleterious (black box) and functionally neutral variants (white box) within ankyrin repeats and non-ankyrin repeat regions of CDKN2A. Ank; Ankyrin repeat. (C) Box plot showing distribution of percent functionally deleterious missense variants per residue.

Functional classification of missense somatic mutations in CDKN2A.
(A - D) Percent of missense somatic mutations in CDKN2A reported in COSMIC (A), TCGA (B), JHU (C), or MSK-IMPACT (D) that were classified as functionally deleterious (black box) or functionally neutral (white box) group by tumor type. Cancer types with 10 or more missense somatic mutations in COSMIC are presented. The number of missense somatic mutations for each tumor type given in parentheses. COSMIC; the Catalogue Of Somatic Mutations In Cancer, TCGA; The Cancer Genome Atlas, JHU; The Johns Hopkins University School of Medicine, MSK-IMPACT; Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets.

Aggregate functional classifications for missense somatic mutations in CDKN2A.
Percent of missense somatic mutations in CDKN2A that were classified as functionally deleterious (black box) or functionally neutral (white box) group by tumor type. Missense somatic mutations reported in COSMIC, TCGA, JHU, and MSK-IMPACT were combined. Cancer types with 10 or more missense somatic mutations in COSMIC are presented. The number of missense somatic mutations for each tumor type given in parentheses. COSMIC; the Catalogue Of Somatic Mutations In Cancer, TCGA; The Cancer Genome Atlas, JHU; The Johns Hopkins University School of Medicine, MSK-IMPACT; Memorial Sloan Kettering-Integrated Mutation Profiling of Actionable Cancer Targets.

Codon optimized CDKN2A sequence.

Assessment of in silico variant effect prediction models.
References
- A method and server for predicting damaging missense mutationsNat Methods 7:248–249https://doi.org/10.1038/nmeth0410-248Google Scholar
- Single-cell mapping of lineage and identity in direct reprogrammingNature 564:219–224https://doi.org/10.1038/s41586-018-0744-4Google Scholar
- Genome-wide prediction of disease variant effects with a deep protein language modelNat Genet 55:1512–1522https://doi.org/10.1038/s41588-023-01465-0Google Scholar
- Tumor suppressor p16INK4A: Determination of solution structure and analyses of its interaction with cyclin-dependent kinase 4Mol Cell 1:421–431https://doi.org/10.1016/S1097-2765(00)80042-8Google Scholar
- Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinomaNat Genet 8:27–32Google Scholar
- Identifying Mendelian disease genes with the variant effect scoring toolBMC Genomics 14:S3https://doi.org/10.1186/1471-2164-14-s3-s3Google Scholar
- Prevalence of Germline Mutations in Cancer GenesGenet Med 20:119–127https://doi.org/10.1038/gim.2017.85.PREVALENCEGoogle Scholar
- Identifying recurrent mutations in cancer reveals widespread lineage diversity and mutational specificityNat Biotechnol 34:155–163https://doi.org/10.1038/nbt.3391Google Scholar
- Memorial sloan kettering-integrated mutation profiling of actionable cancer targets (MSK-IMPACT): A hybridization capture-based next-generation sequencing clinical assay for solid tumor molecular oncologyJ Mol Diagnostics 17:251–264https://doi.org/10.1016/j.jmoldx.2014.12.006Google Scholar
- Accurate proteome-wide missense variant effect prediction with AlphaMissenseScience (80-) 7492https://doi.org/10.1126/science.adg7492Google Scholar
- Clinical likelihood ratios and balanced accuracy for 44 in silico tools against multiple large-scale functional assays of cancer susceptibility genesGenet Med 23:2096–2104https://doi.org/10.1038/s41436-021-01265-zGoogle Scholar
- Inhibition of pRb phosphorylation and cell-cycle progression by a 20-residue peptide derived from P16CDKN2/INK4ACurr Biol https://doi.org/10.1016/s0960-9822(02)00425-6Google Scholar
- COSMIC (the Catalogue of Somatic Mutations In Cancer): A resource to investigate acquired mutations in human cancerNucleic Acids Res 38:652–657https://doi.org/10.1093/nar/gkp995Google Scholar
- Heatmaply: An R package for creating interactive cluster heatmaps for online publishingBioinformatics 34:1600–1602https://doi.org/10.1093/bioinformatics/btx657Google Scholar
- The landscape of tolerated genetic variation in humans and primatesScience (80-) 380https://doi.org/10.1126/science.abn8197Google Scholar
- Management of patients with increased risk for familial pancreatic cancer: updated recommendations from the International Cancer of the Pancreas Screening (CAPS) ConsortiumGut 69:7–17https://doi.org/10.1136/gutjnl-2019-319352Google Scholar
- Maintenance Olaparib for Germline BRCA-Mutated Metastatic Pancreatic CancerN Engl J Med 381:317–327https://doi.org/10.1056/nejmoa1903387Google Scholar
- An Argonaute phosphorylation cycle promotes microRNA-mediated silencingNature 542:197–202https://doi.org/10.1038/nature21025Google Scholar
- Familial melanoma, pancreatic cancer and germline CDKN2A mutationsHum Mutat 23:630https://doi.org/10.1002/humu.9247Google Scholar
- A rare germline CDKN2A variant (47T>G; p16-L16R) predisposes carriers to pancreatic cancer by reducing cell cycle inhibitionJ Biol Chem 296:1–11https://doi.org/10.1016/J.JBC.2021.100634Google Scholar
- Association between inherited germline mutations in cancer predisposition genes and risk of pancreatic cancerJAMA 319:2401–2409https://doi.org/10.1001/jama.2018.6228Google Scholar
- Identification of functional genetic variation in exome sequence analysisBMC Proc 5:9–13https://doi.org/10.1186/1753-6561-5-S9-S13Google Scholar
- The Role of Inherited Pathogenic CDKN2A Variants in Susceptibility to Pancreatic CancerPancreas 50:1123–1130https://doi.org/10.1097/MPA.0000000000001888Google Scholar
- Functional CDKN2A assay identifies frequent deleterious alleles misclassified as variants of uncertain significanceElife 11:1–16https://doi.org/10.7554/eLife.71137Google Scholar
- Detection and quantification of rare mutations with massively parallel sequencingProc Natl Acad Sci U S A 108:9530–9535https://doi.org/10.1073/pnas.1105422108Google Scholar
- A general framework for estimating the relative pathogenicity of human genetic variantsNat Genet 46:310–315https://doi.org/10.1038/ng.2892Google Scholar
- Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithmNat Protoc 4:1073–1082https://doi.org/10.1038/nprot.2009.86Google Scholar
- CDKN2A germline rare coding variants and risk of pancreatic cancer in minority populationsCancer Epidemiol Biomarkers Prev 27:1364–1370https://doi.org/10.1158/1055-9965.EPI-17-1065Google Scholar
- The Cancer Genome AtlasIndian J Med Paediatr Oncol 42:353–355https://doi.org/10.1055/s-0041-1735440Google Scholar
- Systematic Functional Annotation of Somatic Mutations in CancerCancer Cell 33:450–462https://doi.org/10.1016/j.ccell.2018.01.021Google Scholar
- Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular PathologyGenet Med 17:405–424https://doi.org/10.1038/gim.2015.30Google Scholar
- Whole genome sequencing defines the genetic heterogeneity of familial pancreatic cancerCancer Discov 6:166–175https://doi.org/10.1158/2159-8290.CD-15-0402Google Scholar
- The p16(INK4a)/CDKN2A tumor suppressor and its relativesBiochim Biophys Acta - Rev Cancer 1378https://doi.org/10.1016/S0304-419X(98)00017-1Google Scholar
- Deleterious germline mutations in patients with apparently sporadic pancreatic adenocarcinomaJ Clin Oncol 35:3382–3390https://doi.org/10.1200/JCO.2017.72.3502Google Scholar
- Lentivirus-delivered stable gene silencing by RNAi in primary cellsRna 9:493–501https://doi.org/10.1261/rna.2192803Google Scholar
- Evaluating Susceptibility to Pancreatic Cancer: ASCO Provisional Clinical OpinionJ Clin Oncol 37:153–164https://doi.org/10.1200/JCO.18.01489Google Scholar
- GRIM-19 and p16INK4a synergistically regulate cell cycle progression and E2F1- responsive gene expressionJ Biol Chem 285:27545–27552https://doi.org/10.1074/jbc.M110.105767Google Scholar
- Salt-inducible kinase inhibition suppresses acute myeloid leukemia progression in vivoBlood 135:56–70https://doi.org/10.1182/blood.2019001576Google Scholar
- TBCRC 048: Phase II Study of Olaparib for Metastatic Breast Cancer and Mutations in Homologous Recombination-Related GenesJ Clin Oncol 38:4274–4282https://doi.org/10.1200/JCO.20.02151Google Scholar
- Adjuvant Olaparib for Patients with BRCA1 - or BRCA2-Mutated Breast CancerN Engl J Med 384:2394–2405https://doi.org/10.1056/nejmoa2105215Google Scholar
- Evaluating the impact of in silico predictors on clinical variant classificationGenet Med 24:924–930https://doi.org/10.1016/j.gim.2021.11.018Google Scholar
- PEAR: A fast and accurate Illumina Paired-End reAd mergeRBioinformatics 30:614–620https://doi.org/10.1093/bioinformatics/btt593Google Scholar
- BRCA1, BRCA2, PALB2, and CDKN2A Mutations in Familial Pancreatic Cancer (FPC): A PACGENE Study HHS PublicGenet Med 17:569–577https://doi.org/10.1038/gim.2014.153Google Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.95347. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Kimura et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 2,014
- downloads
- 289
- citations
- 4
Views, downloads and citations are aggregated across all versions of this paper published by eLife.