Hox genes control vertebrate body elongation by collinear Wnt repression
- University of Strasbourg, France
- Stowers Institute for Medical Research, United States
- Ehime University, Japan
- Howard Hughes Medical Institute, United States
- University of Kansas Medical Center, United States
- Brigham and Woman's Hospital, United States
- Harvard Medical School, United States
Figures
Figure 1
Slowing down of axis elongation correlates with decreasing cell ingression in the PSM.
(A) Velocity of axis elongation and of somite formation. (B) PSM cell number. (C–D) Tiling of confocal sections of 20-somite (C) and 25-somite (D) stage embryos. EdU positive cells are labeled in …
Figure 2
Collinear activation of Hox genes in paraxial mesoderm precursors.
(A) Table showing the collinear onset of Hox genes expression in the epiblast/tail-bud generated from (B) Chicken embryos hybridized in whole-mount with Hoxa (blue), Hoxb (yellow), Hoxc (red), and Ho…
Figure 3 with 1 supplement
Posterior Hox genes can regulate cell ingression in a collinear fashion.
(A) Consecutive electroporation protocol. The ratio of the green domain (green bar, Hox expressing) over the red domain (red bar, control vector) measures the ingression delay. (B) Embryos …
Figure 3—figure supplement 1
The posterior Hox genes regulate cell ingression with increasing strength.
(A) Embryos consecutively electroporated with Hoxd10-Cherry and Hoxc11-Venus (left) and with Hoxc11-Cherry and Hoxa13-Venus (right). Arrowheads: anterior boundary of Cherry (red) and Venus (green) …
Figure 4
Epiblast cells overexpressing Hox genes do not convert to a neural fate.
(A) Transverse section of a stage 7 HH chicken embryo labeled with phalloidin (white) to highlight the actin network and with laminin (red) to identify the epiblast basal membrane. Colored boxes …
Figure 5
Posterior Hox genes control the axis elongation velocity in a collinear fashion.
(A–B) Time-lapse series of chicken embryos electroporated either with control (A) or Hoxa13 (B). Red line: position of Hensen's node. ss = somite-stage. (C) Velocity of axis elongation of embryos …
Figure 6
Posterior prevalence of posterior Hox genes.
(A) Embryos consecutively electroporated first with Hoxc11-Cherry + Hoxc11mutH-Cherry and with Hoxd10-Venus + Hoxc11-Venus shown 24 hr after reincubation. (B) Embryos consecutively electroporated …
Figure 7
Control of ingression of PM precursors by anterior Hox genes is dependent on Pbx1.
(A) Pbx1 expression during somitogenesis. Red squares: region of PM progenitors. White dashed line: level of transverse section shown in bottom left. (B–C) Pbx1 expression in stage 6–7 HH chicken …
Figure 8 with 2 supplements
Collinear repression of Wnt/βcatenin signaling by posterior Hox genes.
(A) Design of the microarray experiment. (B) Validation by Q-RT PCR of selected Hoxa13 targets identified in the microarray experiment. (C-E) Q-RT PCR for (C) T/Brachyruy, (D) Axin2, and (E) Fgf8 at …
Figure 8—figure supplement 1
The Wnt signaling is repressed when posterior Hox genes are activated.
(A–F) In situ hybridization of 15-somite (left panels) and 25-somite stage (right panels) embryos hybridized with Hoxa13 (A), Axin2(B), Fgf8 intronic (C), T intronic (D), Fzd2 (E), and Dact2 (F) …
Figure 8—figure supplement 2
Collinear repression of Wnt signaling and cell motility by posterior Hox genes.
(A) Graph showing Figure 8I samples after removal of control and Hoxd10 and Hoxd11 (which have a weaker effect) to highlight the collinear trend of this set of Hox genes on Wnt repression. (B) Cell …
Figure 9 with 1 supplement
Hox genes effect on axis elongation involves Brachyury regulation downstream of the Wnt/βcatenin pathway.
(A) Consecutive electroporation of PM precursors with Cherry and then with Venus together with T (left panel), Hoxa13 (middle), or a combination of the two vectors (right). Arrowheads: anterior …
Figure 9—figure supplement 1
Overexpression of T has no effect on Wnt activity.
Luciferase assay measuring Wnt/βcatenin pathway activity 20 hr after over-expression of BATLuc and Renilla constructs together with control, T, Hoxa13, or Hoxa13+T. Stars represent the p-value of …
Figure 10 with 1 supplement
The N-terminal region of posterior Hox genes contains the repressive domain.
(A, C, E) Design of the Hox chimeras. N-ter is in blue, the homeodomain in white, and the C-ter in red. (B, D, F) Luciferase assay measuring T/brachyury expression 20 hr after over-expression of …
Figure 10—figure supplement 1
The N-ter region of posterior Hox genes is poorly conserved at the amino-acid level.
ClustalW alignment of the N-ter region of Hoxa9, Hoxd10, Hoxc11, and Hoxa13 shows poor conservation at the amino acid level.
Figure 11
Model representing the 3 phases (I, II, and III) of Hox action in PM precursors in the epiblast/tail-bud during axis elongation.
Model representing the 3 phases (I, II, and III) of Hox action in PSM precursors in the epiblast/tail-bud during body axis elongation. Anterior Hox genes (paralogs 1–9) are expressed during phase I. …
Author response image 1
Videos
Video 1
Time-lapse video of an embryo from Stage 5 HH to 29 somites showing the different phases of axis elongation (Bright-field, ventral view, anterior is up).
https://doi.org/10.7554/eLife.04379.003
Video 2
Time-lapse videos showing axis elongation slow-down around the 25-somite stage.
Bright-field imaging of chicken embryos at 15–17 somites (left panel), 20–22 somites (middle panel), and 25–27 somites (right panel) (ventral view, anterior is up).
Video 3
Time-lapse video showing the precise targeting of PSM progenitors and the ingression of the epiblast cells to form the PSM.
Bright-field (purple) merged with fluorescent images of PSM cell progenitors electroporated with a control H2B-Venus (ventral view, anterior is up) from stage 6 HH onwards.
Video 4
Effect of Hoxa9, Hoxc11, and Hoxa13 electroporation on axis elongation and ingression.
Bright-field (purple) merged with fluorescent images of PSM cell progenitors electroporated with either a control H2B-Venus (first panel from the left), Hoxa9-ires2-H2B-Venus (second panel from the …
Video 5
Effect of Pbx1 over-expression between the 5- and 9-somite stage.
Bright-field (purple) merged with fluorescent images of PSM cell progenitors electroporated with either a control pBIC (left panel) or a Pbx1pBIC (right panel) construct (green) (ventral view, …
Video 6
Activation of Wnt/βcatenin signaling and T over-expression rescue Hoxa13 axis elongation phenotype.
Bright-field (purple) merged with fluorescent images of PSM cell progenitors electroporated with Hoxa13mutH-ires2-H2B-Venus (left panel), Hoxa13-ires2-H2B-Venus (second panel), T and Hoxa13-ires2-H2B…
Video 7
Activation of the Wnt/βcatenin pathway rescues the axis elongation phenotype due to Hoxd10 over-expression.
Bright-field (purple) merged with fluorescent images of PSM cell progenitors electroporated with Hoxd10mutH-ires2-H2B-Venus (left panel), Hoxd10-ires2-H2B-Venus (middle panel) or βcatLEF and Hoxd10-i…
Video 8
Activation of the Wnt/βcatenin pathway rescues the axis elongation phenotype due to Hoxc11 over-expression.
Brightfield (purple) merged with fluorescent images of PSM cell progenitors electroporated with Hoxc11mutH-ires2-H2B-Venus (left panel), Hoxc11-ires2-H2B-Venus (middle panel), or βcatLEF and Hoxc11-i…
Tables
Table 1
List of selected genes of the Wnt and FGF pathways down-regulated or up-regulated following over-expression of Hoxa13 in tail-bud cells
| Gene | Average (control) | Standard Dev (control) | Average (Hoxa13) | Standard dev (Hoxa13) | Fold change |
|---|---|---|---|---|---|
| Sp8 | 949.9 | 279.2 | 483.8 | 21.4 | 0.51 |
| Fzd2 | 139.7 | 10.7 | 78.5 | 8.6 | 0.56 |
| Axin2 | 857.8 | 42.5 | 677.0 | 99.1 | 0.79 |
| Dact2 | 415.8 | 134.4 | 989.8 | 270.1 | 2.38 |
| Cyp26a1 | 625.1 | 258 | 102.9 | 13 | 0.16 |
| Fgf8 | 1523.9 | 159.3 | 591.2 | 65 | 0.39 |
| Etv1 | 296.6 | 113.2 | 155.1 | 23.8 | 0.52 |
| Fgfr1 | 145.9 | 5.8 | 80 | 0.6 | 0.55 |
| Rasgrp3 | 1441.3 | 671.8 | 362.8 | 218.8 | 0.25 |
Table 2
List of primers used for Q-RT PCR
| Gene name | Gene reference | Primers sequence 5′→3′ | Size of the amplicon |
|---|---|---|---|
| Gapdh | NM_204305.1 | F: GCTGAGAACGGGAAACTTGTG | 62 bp |
| R: GGGTCACGCTCCTGGAAGA | |||
| T | NM_204940.1 | F: CGAGGAGATCACAGCTTTAAAAATT | 75 bp |
| R: TCATTTCTTTCCTTTGCGTCAA | |||
| Axin2 | NM_204491.1 | F: GCGCAAACGATAGTGAGATATCC | 76 bp |
| R: CCATCTACACTGCTGTCTGTCATTG | |||
| Sp8 | NM_001198666.1 | F: CATGGCGCACCCCTACGAGTC | 131 bp |
| R: CGTTGGGGGCACGTCGATCCA | |||
| Fzd2 | NM_204222.1 | F: CCCTGCCCGCTGCACTTCAC | 190 bp |
| R: CCGCTCACACCGTGGTCTCG | |||
| Cyp26a1 | NM_001001129.1ik | F: AGGAGCCCGAGGGTGGCTACA | 138 bp |
| R: TGGCAGTGGTTTCATGACCTCCAA | |||
| Fgf8 | NM_001012767.1 | F: CGCTCTTCAGCTACGTGTTCATGC | 108 bp |
| R: TGGTAGGTGCGCACGAGCC | |||
| Etv1 | NM_204917.1 | F: ATGGACCACAGATTTCGCCGCC | 145 bp |
| R: TTGGACGTCCTTCCCTCGGCA | |||
| Fgfr1 | NM_205510.1 | F: CACGCTGCCCGACCAAGCTC | 168 bp |
| R: GTGATGCGCGTGCGGTTGTT | |||
| Rasgrp3 | NM_001006401.1 | F: AACGGCATCTCCAAGTGGGTCCA | 111 bp |
| R: GAGATGAAGGAGCTTCTGTGCAACA |
Additional files
-
Supplementary file 1
List of genes regulated by Hoxa13 in our microarray screen. (A) List of genes upregulated in the PSM precursors after Hoxa13 overexpression. (B) List of genes downregulated in the PSM precursors after Hoxa13 overexpression.
- https://doi.org/10.7554/eLife.04379.029
