Cochlear progenitor number is controlled through mesenchymal FGF receptor signaling
Abstract
The sensory and supporting cells (SCs) of the organ of Corti are derived from a limited number of progenitors. The mechanisms that regulate the number of sensory progenitors are not known. Here, we show that Fibroblast Growth Factors (FGF) 9 and 20, which are expressed in the non-sensory (Fgf9) and sensory (Fgf20) epithelium during otic development, regulate the number of cochlear progenitors. We further demonstrate that Fgf receptor (Fgfr) 1 signaling within the developing sensory epithelium is required for the differentiation of outer hair cells and SCs, while mesenchymal FGFRs regulate the size of the sensory progenitor population and the overall cochlear length. In addition, ectopic FGFR activation in mesenchyme was sufficient to increase sensory progenitor proliferation and cochlear length. These data define a feedback mechanism, originating from epithelial FGF ligands and mediated through periotic mesenchyme that controls the number of sensory progenitors and the length of the cochlea.
https://doi.org/10.7554/eLife.05921.001eLife digest
Mammalian ears contain several structures that are involved in hearing. Within the inner ear is a spiral-shaped structure called the cochlea. This contains an array of cells called sensory hair cells that convert sound vibrations into electrical signals, which are then conveyed to the brain. Sounds of differing pitch are detected at different points along the cochlea, so its overall length helps to determine the range of sounds that an individual can hear.
In the embryo, sensory hair cells and their associated supporting cells develop from ‘cochlear progenitor’ cells. The final length of the cochlea is determined by the numbers of progenitor cells that commit to becoming either sensory hair cells or supporting cells. Two proteins called FGF9 and FGF20 are involved in the formation of the cochlea. FGF20 promotes the formation of the hair cells and supporting cells, but the precise roles of both proteins are not clear.
Here, Huh et al. studied FGF9 and FGF20 in the inner ear of mice at an early stage of development. The experiments show that these proteins work together to control the number of progenitor cells and the length of the cochlea. FGF20 is produced by the same tissue structure (called an ‘epithelium’) that gives rise to the hair cells and supporting cells. In contrast, FGF9 is produced in another epithelium tissue that produces the cells that line the fluid-filled tubes of the inner ear.
The experiments also show that both FGF9 and FGF20 act as signals to cells in an adjacent tissue called the mesenchyme, where they activate other proteins known as FGF receptors. These receptors, in turn, regulate an unknown molecule in the mesenchyme that influences the growth of progenitor cells and the length of the cochlea.
Sensory hair cells can be injured or lost by excessive sound exposure, some medications and as part of normal aging. These cells are not replaced, and so their loss is a major cause of permanent hearing loss. Understanding the signals that produce the progenitor cells will take us one step closer to being able to grow these cells in the laboratory for use in therapies to replace or repair damaged sensory hair cells.
https://doi.org/10.7554/eLife.05921.002Introduction
The Organ of Corti contains mechanosensory hair cells (HC) and specialized supporting cells (SC) that are required for the transduction of sound (Wu and Kelley, 2012). The frequency spectrum of sound stimuli is tonotopically represented along the length of the mammalian cochlea (Fay and Popper, 2000). In mouse, the cochlea begins to grow from the ventral otic vesicle at embryonic day 11.5 (E11.5) and continues to grow and coil, forming approximately one and a half turns by birth. During its development, the length of the cochlea is limited by the number of progenitors that give rise to sensory HCs and SCs, and is further regulated through a process of convergent extension (Chen and Segil, 1999; Montcouquiol et al., 2003; Wang et al., 2005; Wu and Kelley, 2012). In mouse, sensory progenitors exit the cell cycle by E14.5 and begin to differentiate into HCs and SCs. Thus, the size of the progenitor population at this stage of development is the ultimate determinant of the size of the adult cochlea. Progenitor number is determined by proliferation, the timing of differentiation, and in some cases by aberrant cell death. Previous studies indicate that sensory progenitor growth requires mesenchymal signals (Phippard et al., 1999; Montcouquiol and Kelley, 2003; Braunstein et al., 2008, 2009), however, the identity and source of the factors that control this activity are not known.
Fibroblast Growth Factors (FGFs) have several stage-specific functions during inner ear development. FGF3 and FGF10 signal from hindbrain and head mesenchyme, respectively, to the overlying ectoderm to induce formation of the otic placode and vesicle (Urness et al., 2010). Later in development, FGF20 regulates differentiation of outer hair cells (OHC) and SCs, termed the lateral compartment of the cochlea (Huh et al., 2012). Phenotypic similarities with mice lacking Fgfr1 in the entire otic epithelium suggest that FGF20 signals directly to FGFR1, serving as a permissive factor for differentiation (Pirvola et al., 2002; Hayashi et al., 2008; Huh et al., 2012). FGF9 signaling regulates structural components of the vestibular system, but alone has no effect on cochlear development (Pirvola et al., 2004). During postmitotic stages, FGF8 signaling from the inner hair cell (IHC) to FGFR3 in SCs regulates pillar cell differentiation (Colvin et al., 1996; Mueller et al., 2002; Jacques et al., 2007).
Here, we identify another critical stage in inner ear development that requires FGF signaling. We show that Fgf9, expressed in the non-sensory epithelium, and Fgf20, expressed in the sensory epithelium, regulate the number of cochlear progenitors and the ultimate length of the cochlea through signaling to mesenchymal FGFRs. We find that in vivo FGF9/20 signaling to mesenchymal FGFR1 and FGFR2 is required for sensory progenitor proliferation and that mesenchymal FGFR signaling is sufficient to promote sensory progenitor proliferation and extend the length of the cochlear duct. In addition, we show that prosensory epithelial FGFR1 and FGF20 independently is required for differentiation of outer HCs and SCs.
Results
Fgf9 and Fgf20 are expressed in the developing cochlea
In a prior study, we showed that Fgf20 is required between E13.5–14.5 for differentiation of cochlear OHCs and SCs in the organ of Corti (Huh et al., 2012). However, Fgf20 is expressed in a portion of the otic vesicle sensory epithelium much earlier in development, beginning at E10.5 (Huh et al., 2012), but analysis of mice lacking Fgf20 did not reveal any function for Fgf20 at this stage of development. Since there are many examples of FGFs functioning redundantly during development, we hypothesized that redundancy could account for the lack of a phenotype in Fgf20 null inner ears between E10.5 and 12.5. Fgf9 is closely related to Fgf20 (Zhang et al., 2006; Itoh and Ornitz, 2008), and is also expressed in the otic epithelium at E10.5–12.5 (Pirvola et al., 2004); however, Fgf9−/− mice have normal cochlear development and normal patterning of the organ of Corti (Pirvola et al., 2004).
We first examined the expression domain of Fgf9 relative to Sox2-expressing sensory progenitors (and Fgf20) using a new Fgf9-βGal reporter allele (Fgf9lacZ) in which a splice acceptor-lacZ gene was inserted into the first intron of Fgf9 (Skarnes et al., 2011). At E10.5, βGal activity was detected in the otic vesicle epithelium (Figure 1A). Co-staining of βGal and Sox2 at E11.5 showed no overlap, indicating that Fgf9 is expressed in the non-sensory epithelium of the otic vesicle (Figure 1B). Taken together with previous Fgf20 expression analysis at this stage (Huh et al., 2012, Figure 1C), Fgf9 and Fgf20 are both expressed in the otic vesicle, but in non-overlapping domains in the otic epithelium (Figure 1D).

Fgf9 and Fgf20 are expressed in distinct regions of the otic vesicle.
(A) βGal activity in an Fgf9lacZ/+ embryo at E10.5 visualized with xGal staining. (B, C) βGal (red) and Sox2 (green) co-immunostaining showing that Fgf9 (B) is expressed in Sox2- non-sensory epithelium and Fgf20 (C) is expressed in Sox2+ sensory epithelium at E11.5. (D) Schematic diagram of FGF9, FGF20, and Sox2 immunostaining showing that FGF9 and FGF20 are expressed in distinct domains in the otic vesicle. ov, otic vesicle, scale bars, 100 μm.
Fgf9 and Fgf20 regulate cochlear length and Fgf20, not Fgf9, is required for lateral compartment differentiation and patterning
To determine whether Fgf9 and Fgf20 could have a redundant role in cochlear development, Fgf9;Fgf20 double knockout cochleae were analyzed at E18.5 by staining with phalloidin and with an antibody to p75 to identify sensory HCs and pillar cells, respectively (Figure 2A–C). Control embryos (Fgf9−/+;Fgf20lacZ/+) showed a normal pattern of three rows of OHCs and one row of IHCs throughout the cochlear duct (Figure 2A–C). Fgf9−/− and Fgf9−/−;Fgf20lacZ/+ cochleae showed the same wild type HC pattern as the double heterozygous controls (Figure 2A–C). Fgf20lacZ/lacZ and Fgf9−/+;Fgf20lacZ/lacZ cochleae showed patches of sensory HCs and gaps (Figure 2A–C) (Huh et al., 2012). Fgf9−/−;Fgf20lacZ/lacZ cochleae also showed a similar patterning phenotype to Fgf20lacZ/lacZ mice (Figure 2A–D). The density (number of cells per 100 μm) of OHCs in Fgf9−/− and Fgf9−/−;Fgf20lacZ/+ cochleae was similar to double heterozygous controls (Figure 2E). However, the densities of OHCs in Fgf20lacZ/lacZ, Fgf9−/+;Fgf20lacZ/lacZ and Fgf9−/−;Fgf20lacZ/lacZ cochleae were similar to each other (ANOVA, p > 0.1), and significantly (ANOVA, p < 0.0001) decreased compared to double heterozygous controls (Figure 2E). Densities of IHCs were comparable in all genotypes (Figure 2E). To analyze SCs, cochleae were immunostained for Prox1 and Sox2 (Figure 2D). In double heterozygous control cochleae, 5 rows of Prox1+ SCs overlapped with Sox2 staining (Figure 2D). Fgf9−/− and Fgf9−/−;Fgf20lacZ/+ cochleae showed a similar pattern (Figure 2D). In contrast, Fgf20lacZ/lacZ, Fgf9−/+;Fgf20lacZ/lacZ and Fgf9−/−;Fgf20lacZ/lacZ cochleae showed patches of SCs separated by gaps of Sox2+, Prox1− cells (Figure 2D). The density of SCs in Fgf9−/− and Fgf9−/−;Fgf20lacZ/+ was comparable (ANOVA, p > 0.5) to double heterozygous control (Figure 2F). The density of SCs in Fgf20lacZ/lacZ, Fgf9−/+;Fgf20lacZ/lacZ and Fgf9−/−;Fgf20lacZ/lacZ were similar to each other (ANOVA, p > 0.3) and significantly (ANOVA, p < 0.0001) decreased compared to double heterozygous controls (Figure 2F).

Fgf9 and Fgf20 regulate cochlear length.
(A, B) Phalloidin (A) and p75 immunostaining (B) of E18.5 whole cochlea showing hair cells (HCs) (phalloidin) and pillar cells (p75) in the cochlear duct of Fgf9−/+;Fgf20lacZ/+, Fgf9−/−, Fgf20lacZ/lacZ, Fgf9−/−;Fgf20lacZ/+, Fgf9−/+;Fgf20lacZ/lacZ and, Fgf9−/−;Fgf20lacZ/lacZ embryos. (C) Phalloidin (green) and p75 immunostaining (red) showing the orientation of HCs, pillar cells, and gaps in the sensory epithelium. (D) Prox1 (green) and Sox2 (red) co-immunostaining showing supporting cells (SCs) (yellow, Prox1 and Sox2) and undifferentiated sensory progenitors (red, Sox2). (E–G) Measurement of HC number (E), SC number (F), and length of cochleae (G) of E18.5 embryos. Scale bars, A, 500 μm; C, 100 μm. For statistical analysis, all samples were compared with Fgf9−/+;Fgf20lacZ/+ double heterozygous controls. *p < 0.001. Sample numbers (n) are indicated in data bars.
One of the striking differences among Fgf9;Fgf20 compound mutants was cochlear length. The length of Fgf9−/− and Fgf9−/−;Fgf20lacZ/+ cochleae was comparable (ANOVA, p > 0.1) to that of double heterozygous controls (Figure 2G), whereas the length of Fgf20lacZ/lacZ and Fgf9−/+;Fgf20lacZ/lacZ cochleae was 16% and 18% shorter than double heterozygous controls (p < 0.05 and p < 0.001), respectively, and the length of Fgf9−/−;Fgf20lacZ/lacZ cochleae was reduced by 58% compared to controls (p < 0.001) (Figure 2G). In addition, Fgf9−/−;Fgf20lacZ/lacZ double knockout cochleae were 49% and 51% of the length of Fgf20lacZ/lacZ and Fgf9−/+;Fgf20lacZ/lacZ cochleae (p < 0.001), respectively (Figure 2G). These data identify a redundant role for Fgf9 and Fgf20 to attain the proper cochlear length, while Fgf20, alone, primarily regulates cochlear patterning and differentiation.
Fgf9 and Fgf20 regulate sensory progenitor cells proliferation
We hypothesized that the overall length of the cochlear duct would correlate with the size of the postmitotic prosensory domain. In mouse, cochlear sensory progenitors exit the cell cycle beginning at E12.5 in the apex and progressing towards the base by E14.5 (Lee et al., 2006). E14.5 cochleae were dissected and immunostained for Sox2 (Figure 3A), which marks the lineage of cells that will become HCs and SCs (Kiernan et al., 2005). The Sox2+ prosensory domain of double heterozygous control and Fgf9−/+;Fgf20lacZ/lacZ inner ears were similar (Figure 3A). However, the Sox2+ prosensory domain of Fgf9−/−;Fgf20lacZ/lacZ inner ears were clearly smaller than that of double heterozygous control or Fgf9−/+;Fgf20lacZ/lacZ cochleae (Figure 3A). Immunostaining of histological sections of E14.5 inner ears showed that the Sox2+ prosensory domain was less compact in Fgf9−/−;Fgf20lacZ/lacZ inner ears compared to double heterozygous control and inner ears with one wild type allele of Fgf9 (Figure 3B). Immunostaining for p27kip1 (Cdkn1b) showed a very similar pattern to that of Sox2, with more diffuse cells in the prosensory domain of E14.5 inner ears of Fgf9−/−;Fgf20lacZ/lacZ mice (Figure 3C). Jag1, which marks the medial prosensory cells that will give rise to IHCs, inner SCs, and Kölliker's organ (Ohyama et al., 2010; Basch et al., 2011), showed a similar expression pattern across all three genotypes, indicating that the medial compartment of the cochlea was correctly specified (Figure 3D).

Fgf9 and Fgf20 are required for sensory progenitor proliferation.
(A) Sox2 immunostaining of whole E14.5 cochlea to identify the progenitor domain (arrows). (B–D) Sox2 (B), p27 (C), and Jag1 (D) immunostaining of E14.5 Fgf9−/+;Fgf20lacZ/+, Fgf9−/+;Fgf20lacZ/lacZ, and Fgf9−/−;Fgf20lacZ/lacZ embryo sections. Boxed regions of the cochlear duct are magnified below each image and were chosen in regions where the sections perpendicularly transect the cochlear duct. (E, F) Sox2 and phospho-Histone H3 (pHH3) co-immunostaining of E11.5 (E) and E12.5 (F) Fgf9−/+;Fgf20lacZ/+, Fgf9−/+;Fgf20lacZ/lacZ and, Fgf9−/−;Fgf20lacZ/lacZ embryo sections. (G, H) Measurement of Sox2+ sensory progenitor proliferation at E11.5 (G) and E12.5 (H). All samples were compared with Fgf9−/+;Fgf20lacZ/+ double heterozygous controls. *p < 0.01, **p < 0.001. Sample numbers (n) are indicated in data bars. See also Figure 3—figure supplements 1, 2.
To determine whether the decreased size of the Fgf9−/−;Fgf20lacZ/lacZ prosensory domain resulted from changes in cell proliferation and/or cell death, histological sections of E11.5 and E12.5 otic vesicles were immunostained for Sox2 and phospho-Histone H3 (pHH3) (Figure 3E,F), or activated Caspase-3 (aCasp3) (data not shown). Quantification of the number of pHH3+, Sox2+ sensory progenitors showed similar numbers (p > 0.09 at E11.5 and p > 0.2 at E12.5) in double heterozygous control and Fgf9−/+;Fgf20lacZ/lacZ cochleae (Figure 3G,H). However, proliferation of Fgf9−/−;Fgf20lacZ/lacZ cochlear epithelial cells was significantly decreased at E11.5 (p < 0.001) and E12.5 (p < 0.01) compared to double heterozygous controls (Figure 3G,H). In addition quantitation of cell proliferation using EdU labeling of E11.5 embryos showed similar results (Figure 3—figure supplement 1). No cell death (aCasp3+) was detected in any of the genotypes at E11.5 and E12.5 (data not shown).
Decreased sensory progenitor number could also result from premature cell cycle exit. p27kip1 is one of the cell cycle inhibitors that is expressed in sensory progenitors as they become postmitotic. Expression of p27kip1 begins at E12.5 in the apex of the cochlea and progresses towards the base (Lee et al., 2006). By E14.5, the entire cochlear progenitor domain becomes p27kip1 positive. Expression of p27kip1 at E12.5 in the proximal cochlear duct was not detected in either control or Fgf9−/−;Fgf20lacZ/lacZ embryos suggesting that there is no premature cell cycle exit in mice lacking Fgf9 and Fgf20 (Figure 3—figure supplement 2).
Epithelial Fgfr1 but not Fgfr2 is required for lateral compartment differentiation
Next, we questioned which cell types are required for sensory progenitor proliferation and/or lateral compartment differentiation. Expression of both Fgfr1 and Fgfr2 have been reported in the otic epithelium and periotic mesenchyme between E10.5 and E12.5 (Pirvola et al., 2000, 2002, 2004; Ono et al., 2014). Epithelial Fgfr1 has been conditionally inactivated in otic epithelium using Foxg1Cre, Six1enh21Cre, and Emx2Cre (Pirvola et al., 2002; Ono et al., 2014). This results in a cochlear epithelium with reduced numbers of HCs, with OHC numbers being more severely affected than IHC numbers. In addition to the loss of differentiated HCs, a 40–50% decrease in cochlear length was reported when Fgfr1 was inactivated with Six1enh21Cre, or Emx2Cre (Ono et al., 2014).
To directly compare cochlear phenotypes resulting from inactivation of Fgfr1 in otic epithelium with embryos lacking Fgf9 and Fgf20, we re-created and re-evaluated Fgfr1−/f::Foxg1Cre/+ mutant mice maintained on a 129X1/SvJ;C57BL/6J mixed genetic background. Quantification of the density of OHCs in Fgfr1−/f::Foxg1Cre/+ embryos demonstrated a significant (p < 0.0001) decrease compared to controls (Fgfr1+/f::Foxg1Cre/+) (Figure 4—figure supplement 1A,B,E), while the density of IHCs was not changed (p > 0.09). Furthermore, the length of Fgfr1−/f::Foxg1Cre/+ cochleae was only 9% shorter than control (Figure 4—figure supplement 1A,B,F), similar to what was observed in Fgf20lacZ/lacZ embryos (Figures 1B, 2G and ref. Huh et al., 2012). Whole mount Sox2 staining of E14.5 Fgfr1−/f::Foxg1Cre/+ cochleae was also comparable to control, indicating that the number of Sox2+ progenitors was not changed (Figure 4—figure supplement 1C). In addition, proliferation of the Fgfr1−/f::Foxg1Cre/+ prosensory epithelium was comparable (p > 0.6) to that of controls at E12.5 (Figure 4—figure supplement 1D,G).
Because Fgfr2 often exhibits redundancy with Fgfr1, it is important to consider potential Fgfr2 function in the inner ear prosensory epithelium. However, Fgfr2 is required for formation of the otic vesicle and Foxg1Cre, which is active before and during the otic vesicle stage (Hébert and McConnell, 2000), could not be used to investigate the role of Fgfr2 at later stages of otic vesicle development. In addition, due to overall activity of Foxg1Cre in the otic vesicle, cell type specificity of Fgfr1 was still unknown. To study whether Fgfr1 and/or Fgfr2 function cell autonomously or non-cell autonomously in the Fgf20+ domain of the prosensory epithelium, we generated an Fgf20Cre allele (Figure 4—figure supplement 2A) to allow conditional gene targeting of the Fgf20 lineage. To assess Cre activity, Fgf20Cre/+;ROSAmTmG/+ mice were generated. Cre activity was detected at E10.5 in a subset of the Sox2+ prosensory domain, in a pattern identical to that of Fgf20lacZ embryos (Figure 4—figure supplement 2B). At P0, all of the components of the organ of Corti were positive for the Fgf20Cre/+;ROSAmTmG/+ lineage tracer, indicating that Fgf20Cre is active in prosensory progenitors or their lineage (Figure 4—figure supplement 2B).
To identify potential roles for Fgfr1 and Fgfr2 in the prosensory epithelial lineage, we generated Fgfr1 and Fgfr2 single and double conditional mutant mice using the Fgf20Cre allele. E18.5 embryos were harvested and stained with phalloidin and p75, to visualize cochlear morphology. The phenotype of Fgfr1−/f::Fgf20Cre/+(Fgfr1−/f;Fgfr2+/f::Fgf20Cre/+) cochleae was similar to that of Fgf20lacZ/lacZ, Fgf9−/−;Fgf20lacZ/lacZ, and Fgfr1−/f::Foxg1Cre/+ cochleae (Figures 2A–C, 4A–C, Figure 4—figure supplement 1A,B). In contrast, the pattern and morphology of Fgfr2−/f::Fgf20Cre/+(Fgfr1+/f;Fgfr2−/f::Fgf20Cre/+) cochleae was similar to control (Figure 4A–C) and Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ cochleae was comparable to Fgfr1−/f::Fgf20Cre/+ (Figure 4A–C). The density of OHCs in Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ was comparable to Fgfr1−/f::Fgf20Cre/+ (p > 0.94) and significantly (p < 0.001) decreased compared to control (Figure 4F). The density of OHCs of Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ embryos was comparable to control (p > 0.6) (Figure 4F) and the density of IHCs in Fgfr1−/f::Fgf20Cre/+, Fgfr2−/f::Fgf20Cre/+, and Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ cochleae were indistinguishable (ANOVA, p > 0.8) from that of controls (Figure 4F).

Cell-autonomous regulation of sensory progenitor differentiation requires epithelial Fgfr1 but not Fgfr2.
(A, B) Phalloidin (A) and p75 immunostaining (B) of E18.5 whole cochlea showing HCs (phalloidin) and pillar cells (p75) in the cochlear duct of control, Fgfr1−/f::Fgf20Cre/+ (Fgfr1−/f;Fgfr2+/f::Fgf20Cre/+), Fgfr2−/f::Fgf20Cre/+ (Fgfr1+/f;Fgfr2−/f::Fgf20Cre/+) and, Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ embryos. (C) Phalloidin (green) and p75 immunostaining (red) showing the patterning of HCs and pillar cells in the cochlear duct. (D) Sox2 immunostaining of E14.5 whole cochlea to identify progenitor domains (arrows). (E) Sox2 and pHH3 co-immunostaining of E12.5 embryo sections. (F, G) Measurement of HC number (F) and length of cochleae (G) of E18.5 control embryos. (H) Measurement of Sox2+ sensory progenitor proliferation in E12.5 embryos. All samples were compared with controls. *p < 0.001; ns, not significant. Sample numbers (n) are indicated in data bars. See also Figure 4—figure supplements 1, 2.
The length of the cochleae from E18.5 Fgfr1−/f::Fgf20Cre/+ and Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ embryos was decreased by 19% and 25%, respectively, compared to controls (p < 0.0001, Figure 4G). However, the length of the cochleae from Fgfr2−/f::Fgf20Cre/+ was comparable (p > 0.5) to controls. Together, these data, and those presented above, showed that epithelial Fgfr1, but not Fgfr2, is required for lateral compartment differentiation, and has a modest effect on cochlear duct length of a similar magnitude to the 10% reduction in cochlear length seen in Fgf20lacZ/lacZ mice (Huh et al., 2012). This reduction in cochlear length could be due to reduced numbers of progenitors or to other effects of FGFR1 signaling on cochlear duct elongation at later stages of development. Whole mount Sox2 staining at E14.5 of Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ cochleae showed a similarly sized sensory progenitor domain as compared to controls indicating that the Sox2+ progenitor population was not affected by inactivation of epithelial Fgfr1 and Fgfr2 (Figure 4D). In addition, proliferation of Fgfr1−/f;Fgfr2−/f::Fgf20Cre/+ cochleae was comparable (p > 0.5) to controls at E12.5 (Figure 4E,H).
Mesenchymal Fgfr1 and Fgfr2 regulate cochlear length but not lateral compartment differentiation
We next asked whether mesenchymal FGFRs regulate cochlear length. Twist2(Dermo1)Cre is widely expressed in mesenchymal cells (Li et al., 1995; Šošić et al., 2003). To determine whether Twist2Cre is active in periotic mesenchyme during otic vesicle development, Twist2Cre/+;ROSA26lacZ/+ embryos were stained for lacZ activity at E9.5 and E10.5. lacZ activity was observed in all of the mesenchyme surrounding the unstained otic epithelium at both developmental time points (Figure 5—figure supplement 1). Twist2Cre was then used to inactivate Fgfr1 and Fgfr2 from mesenchymal cells. Cochleae were dissected from E18.5 embryos and stained with phalloidin and p75. All genotypes showed normal sensory HC and SC patterning, with one row of IHCs and three rows of OHCs (Figure 5A–C). The linear density of IHCs and OHCs was comparable (ANOVA, p > 0.2, p > 0.8, respectively) among all genotypes (Figure 5F). However, the length of the cochleae of Fgfr1−/f::Twist2Cre/+ (Fgfr1−/f;Fgfr2+/f::Twist2Cre/+), Fgfr2−/f::Twist2Cre/+ (Fgfr1+/f;Fgfr2−/f::Twist2Cre/+), and Fgfr1−/f;Fgfr2−/f::Twist2Cre/+ embryos were decreased by 7%, 20%, and 55%, respectively, compared to control (Figure 5A,B,G). Thus, the total number of HCs is decreased in proportion to the decreased length of the cochlea.

Mesenchymal Fgfr1 and Fgfr2 regulate the length of the cochlear duct and sensory progenitor proliferation.
(A, B) Phalloidin (A) and p75 immunostaining (B) of E18.5 whole cochlea showing HCs (phalloidin) and pillar cells (p75) in the cochlear duct of control, Fgfr1−/f::Twist2Cre/+ (Fgfr1−/f;Fgfr2+/f::Twist2Cre/+), Fgfr2−/f::Twist2Cre/+ (Fgfr1+/f;Fgfr2−/f::Twist2Cre/+), and Fgfr1−/f;Fgfr2−/f::Twist2Cre/+ embryos. (C) Phalloidin (green) staining showing normal HC patterning in the cochlear sensory epithelium. (D) Sox2 immunostaining of E14.5 whole cochlea to identify progenitor domains (arrows). (E) Sox2 and pHH3 co-immunostaining of E12.5 cochlea sections. (F, G) Measurement of HC number (F) and length of cochleae (G) of E18.5 control, Fgfr1−/f::Twist2Cre/+ (Fgfr1−/f;Fgfr2+/f::Twist2Cre/+), Fgfr2−/f::Twist2Cre/+ (Fgfr1+/f;Fgfr2−/f::Twist2Cre/+), and Fgfr1−/f;Fgfr2−/f::Twist2Cre/+ embryos. (H) Measurement of Sox2+ sensory progenitor (green) proliferation (red, pHH3) in E12.5 embryo sections. All samples were compared with controls. *p < 0.001. Sample numbers (n) are indicated in data bars. See also Figure 5—figure supplement 1.
To determine whether the effect of loss of mesenchymal FGFRs on cochlear length originates early in development, we examined the size of the Sox2+ progenitor domain at the time that HCs commit to differentiate, and cell proliferation within the Sox2+ domain before the onset of differentiation. The size of the Sox2+ progenitor domain, visualized by whole mount Sox2 staining of E14.5 cochleae was decreased in Fgfr1−/f;Fgfr2−/f::Twist2Cre/+ embryos compared to control embryos (Figure 5D). In addition, proliferation of Sox2+ progenitors from Fgfr1−/f;Fgfr2−/f::Twist2Cre/+ cochleae was significantly (p < 0.01) decreased compared to control cochleae at E12.5 (Figure 5E,H). Together, these data show that mesenchymal FGFR signaling is a necessary determinant of cochlear length and sensory progenitor proliferation, but not for cochlear pattern formation or differentiation.
To determine whether the FGF signaling pathway is affected in periotic mesenchyme, whole mount RNA in situ hybridization was used to localize expression of Etv4 and Etv5, two transcription factors that are commonly regulated by FGF signaling (Raible and Brand, 2001; Firnberg and Neubüser, 2002; Brent and Tabin, 2004; Mao et al., 2009; Zhang et al., 2009). Compared to double heterozygous control and Fgf9−/+;Fgf20lacZ/lacZ inner ears, Fgf9−/−;Fgf20lacZ/lacZ inner ears showed decreased expression of Etv4 and Etv5 in mesenchyme surrounding the cochlear duct (Figure 6—figure supplement 1A,B). The only known mesenchymal signaling pathway to regulate sensory progenitor proliferation is a Tbx1/Pou3f4 dependent retinoic acid (RA) signaling cascade (Braunstein et al., 2008, 2009). However, Tbx1 and Pou3f4 expression, using RNA in situ hybridization in the embryos lacking Fgf9 and Fgf20 (Fgf9−/−;Fgf20lacZ/lacZ), did not reveal a change in expression of these transcription factors compared to doble heterozygous control and Fgf9−/+;Fgf20lacZ/lacZ embryos (Figure 6—figure supplement 1C,D), suggesting that FGF signaling may function independent of RA signaling.
Mesenchymal FGF signal is sufficient to activate sensory progenitor cells proliferation
Next we asked whether increased mesenchymal FGFR signaling is sufficient to activate sensory progenitor proliferation. We ectopically expressed a constitutive FGFR1 tyrosine kinase domain in mesenchymal cells by combining the Twist2Cre, ROSArtTA, and the doxycycline-responsive TRE-caFgfr1-myc alleles (TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+) (Cilvik et al., 2013). Doxycycline was fed to pregnant female mice beginning at E10.5. Embryos were analyzed at E12.5 for prosensory progenitor proliferation using pHH3 and Sox2 co-immunostaining (Figure 6A). The proliferation index in control prosensory cells was 2.4 ± 0.5/10,000 μm2 (Figure 6B). However, embryos in which the caFgfr1-myc allele was induced in mesenchyme showed a significantly increased (4.1 ± 0.6/10,000 μm2, p < 0.02) proliferation index (Figure 6B). To test the hypothesis that increased proliferation in sensory progenitors could lead to an increase in cochlear length, TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+ embryos were induced from E10.5 to E14.5 and cochleae were analyzed at E18.5 (Figure 6C). Linear densities of IHCs, OHCs, and SCs in TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+ embryos were comparable (p > 0.4) to control (Figure 6E,F). However, the cochlear length in TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+ embryos was significantly (p < 0.001) increased by 14% compared to control (Figure 6D).

Ectopic activation of FGFR signaling in mesenchyme increases sensory progenitor proliferation and cochlear length.
(A) Sox2 (green) and pHH3 (red) co-immunostaining of E12.5 control and TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+ embryo sections. (B) Measurement of Sox2+ sensory progenitor proliferation at E12.5. (C) Phalloidin (green) and p75 immunostaining (red) showing the patterning of HCs and pillar cells in the cochlear duct of control and TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+ embryos. Measurement of the length of the cochleae (D), HC number (E), and SC number (F) of E18.5 control and TRE-caFgfr1;ROSArtTA/+::Twist2Cre/+ embryos. (G) Schematic diagram indicating the requirement for epithelial FGF9/20 signaling to mesenchymal FGFR1/2 to induce sensory progenitor proliferation. *p < 0.01 in B and *p < 0.001 in D. Sample numbers (n) are indicated in data bars. See also Figure 6—figure supplement 1.
Discussion
Sensory progenitor proliferation and differentiation are temporally distinct events in cochlear development. In mice, sensory progenitors exit from the cell cycle beginning at the apical end of the cochlea at ∼E12.5 and ending at the base at ∼E14.5. In contrast, differentiation begins in the mid-base at ∼E14.5 and then extends to the base and apex (Wu and Kelley, 2012). Under physiological conditions, once progenitors exit the cell cycle, they do not reenter the cell cycle throughout the life of the organism. Previous studies suggested that during development both epithelial and mesenchymal signals are required to regulate cochlear progenitor proliferation and differentiation (Montcouquiol and Kelley, 2003; Doetzlhofer et al., 2004). However, the mechanisms that control cochlear sensory progenitor proliferation are not known. In this study, we found that epithelial FGF9 and FGF20 signaling to mesenchymal FGFR1 and FGFR2 is required for normal levels of cochlear sensory progenitor proliferation and that inactivation of either the ligands or the mesenchymal receptors results in a shortened cochlea. We also demonstrated that activation of mesenchymal FGFR signaling is sufficient to increase sensory progenitor proliferation and extend cochlear length.
Fgf9 is expressed in non-sensory epithelia of the cochlea and loss of Fgf9 results in defects in periotic mesenchymal cell proliferation, causing a hypoplastic otic capsule (Pirvola et al., 2004). Based on known expression patterns in mesenchyme, Fgfr1 and Fgfr2 were considered the most likely targets of FGF9 signaling (Pirvola et al., 2004). The critical time window for FGF9 signaling was determined to occur before E14.5. By contrast, Fgf20 is expressed in the sensory epithelium and loss of Fgf20 results in failure of the lateral compartment of the organ of Corti to fully differentiate (Huh et al., 2012). Based on expression patterns and phenotypic similarities with epithelial Fgfr1 conditional gene inactivation, FGFR1 was identified as the epithelial target receptor (Pirvola et al., 2002; Huh et al., 2012).
The effects of epithelial FGFR1 signaling on the length of the cochlear duct exhibit variability among studies. Ono et al. (2014) report a 40–50% decrease in cochlear length in Fgfr1f/f::Six1enh21Cre, and Fgfr1f/f::Emx2Cre conditional knockout mice, by contrast, Fgf20lacZ/lacZ, Fgf9−/+;Fgf20lacZ/lacZ, and Fgfr1−/f::Foxg1Cre/+ mice that we studied (Huh et al., 2012, and this study) showed only a 10–25% decrease in cochlear length. It is clear that in both studies defects in epithelial differentiation is likely to result in some decrease in cochlear length. It is also possible that differences in genetic background could contribute to differences in these two studies.
FGF9 and FGF20 are members of the same FGF subfamily and share similar biochemical properties (Zhang et al., 2006; Ornitz and Itoh, 2015). Redundancy between these FGFs has also been demonstrated in kidney development, where both ligands are required for nephron progenitor maintenance (Barak et al., 2012). Interestingly, in both cases, the expression patterns of these two FGFs do not overlap, but nevertheless they appear to signal to a common target tissue, periotic mesenchyme in the developing inner ear and CAP mesenchyme in the developing kidney. For the evolution of the kidney and inner ear, it is possible that additive expression of these FGFs from distinct sources was required to take advantage of their unique receptor specificities or unique interactions with the extracellular matrix.
Tbx1 is a transcription factor that is expressed in both sensory epithelium and mesenchyme (Vitelli et al., 2003; Raft et al., 2004). Deletion of Tbx1 in mesenchymal cells resulted in defects in cochlear epithelial proliferation indicating a non-cell autonomous requirement for Tbx1 for cochlear epithelial development (Xu et al., 2007). In addition, the Pou domain containing transcription factor, Pou3f4, also known as Brn4, is expressed in mesenchymal cells in the developing inner ear (Phippard et al., 1999). Deletion of Pou3f4 resulted in reduction of cochlear length and defects in derivatives of the otic mesenchyme including the spiral limbus, scala tympani, and strial fibrocytes (Phippard et al., 1999). Furthermore, decreasing gene dosages of Tbx1 and Pou3f4 resulted in a significant decrease in sensory epithelial proliferation and cochlear length indicating that Tbx1 and Pou3f4 genetically interact. The RA catabolizing genes Cyp26a1 and Cyp26c1, both targets of Tbx1 and Pou3f4, were decreased in these mice, suggesting that increased RA signaling could directly or indirectly suppress sensory progenitor proliferation (Braunstein et al., 2008, 2009). Analysis of Fgf9 and Fgf20 double mutant mice showed no change in the expression of Tbx1 and Pou3f4 in mesenchyme surrounding the otic vesicle, suggesting that mesenchymal FGF signaling does not directly affect transcription factors that regulate RA signaling (Figure 6—figure supplement 1C,D). On the other hand, Etv4 and Etv5 function as downstream targets of FGF signaling in other systems including the limb (Mao et al., 2009; Zhang et al., 2009), and Etv4 and Etv5 expression were decreased in Fgf9/Fgf20 mutant ears. Future studies will be needed to determine whether FGF signaling including ETV4 and ETV5 regulates RA signaling downstream of Tbx1/Pou3f4 or act in parallel to the Tbx1/Pou3f4/RA signaling pathway to regulate sensory progenitor proliferation. Whether the cellular target of RA signaling is in the periotic mesenchyme or the sensory progenitor epithelium also remains to be determined. It is also possible that the number of nearby mesenchymal cells may influence sensory progenitor proliferation. However, considering that loss of Fgf9 resulted in decreased mesenchymal cell proliferation (Pirvola et al., 2004) but did not affect HC formation or cochlear length (Figure 2), alternative mechanisms may need to be considered.
The reactivation of developmental signaling pathways may be important for regeneration. Recent publications showed that inhibition of Notch signaling could induce transdifferentiation of SCs to HCs in a damaged cochlea (Korrapati et al., 2013; Mizutari et al., 2013). In addition, Wnt/β-catenin signaling can induce SC proliferation in neonatal mice (Chai et al., 2012; Shi et al., 2012). One intermediate goal of regenerative biology for the inner ear would be to generate large numbers of sensory progenitor cells that could be differentiated into functional HCs and SCs and then be reintroduced into the damaged inner ear. The studies presented here suggest that in efforts to grow inner ear sensory progenitor cells in vitro, that FGF-induced mesenchyme may be necessary. The identification of mesenchymal factors that are regulated by FGF or RA could also be used to support the growth of sensory progenitor cells.
Materials and methods
Generation of Fgf20Cre mutant mice
Request a detailed protocolThis study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Washington University Division of Comparative Medicine Animal Studies Committee (Protocol Number 20130201). All efforts were made to minimize animal suffering.
Fgf20Cre knock-in mice were generated using a similar method to that reported previously (Huh et al., 2012). Briefly, exon1 of Fgf20 was replaced with a Cre-EGFP–FRT-neomycin-FRT cassette to generate Fgf20Cre(neo)/+ mice. The neomycin gene was eliminated by mating with CAG-FLPe (Kanki et al., 2006) mice to generate Fgf20Cre/+ mice. Genotyping was performed using PCR1: CTGCATTC GCCTCGCCACCCTTGCTACACT; PCR2: GGATCTGCAGGTGGAAGCCGGTGCGGCAGT; PCR3: TTCAGGGTCAGCTTGCCGTAGGTGGCATCG primers, which amplify wild type (335 bp) and mutant (241 bp) PCR fragments. Mice were maintained on a 129X1/SvJ;C57BL/6J mixed background.
Generation of Fgf9lacZ mutant mice
Request a detailed protocolFgf9lacZ mice were derived from International Knockout Mouse Consortium targeted ES cells (project number 24486) (Skarnes et al., 2011). Chimeric mice derived from injected blastocysts were bred to Sox2Cre mice (Hayashi et al., 2003) to remove the nbactP-neo selection cassette and the second exon of the Fgf9 gene. Genotyping was performed using Wt1: GAAGTCGTGCGTGAGGTGCTCCAGGTCGG; Wt2: CCGCGAATGCTGACCAGGCCCACTGCTAT primers for wild type (172 bp) and mut1: GTT GCA GTGCACGGCAGATACACTTGCTGA; mut2: GCCACTGGTGTGGGCCATAATTCAATTCGC primers for mutant (389 bp) PCR fragments. Mice were maintained on a 129X1/SvJ;C57BL/6J mixed background.
Other mouse lines
Request a detailed protocolFgfr1f/f, Fgfr2f/f, Twist2(Dermo1)Cre/+, Foxg1Cre/+, R26R, ROSAmTmG/+, TRE-caFgfr1-myc, ROSArtTA/+, Fgf20lacZ/+, and Fgf9−/+ mice lines were reported previously (Soriano, 1999; Hébert and McConnell, 2000; Colvin et al., 2001; Pirvola et al., 2002; Šošić et al., 2003; Yu et al., 2003; Belteki et al., 2005; Muzumdar et al., 2007; Huh et al., 2012; Cilvik et al., 2013). Fgfr1−/+ and Fgfr2−/+ mice were generated by crossing Fgfr1f/f and Fgfr2f/f to Sox2Cre/+ mice, respectively.
βGal staining
Request a detailed protocolEmbryos were fixed overnight in Mirsky's Fixative (National Diagnostics, Atlanta, GA), washed three times in PBT (PBS, 0.1% Tween-20) and incubated in βGal staining solution (2 mM MgCl2, 35 mM potassium ferrocyanide, 35 mM potassium ferricyanide, 1 mg/mg X-Gal in PBT) at 37°C until color reaction was apparent. Samples were washed in PBS, fixed in 10% formalin and imaged under a dissecting microscope.
Histology
Request a detailed protocolFor frozen sections, embryos were fixed with 4% paraformaldehyde overnight and washed with PBS. Samples were soaked in 30% sucrose and embedded in OCT compound (Tissue-Tek, Torrance, CA). Samples were sectioned (12 µm) and stored at −80°C for immunohistochemistry.
Quantification of HC and SC numbers
Request a detailed protocolEither phalloidin or Prox1 immunostaining were used to identify HCs and SCs, respectively. To measure the density of HCs and SCs, at least 300 µm regions of the base (10%), middle (40%), and apex (70%) of the cochleae were counted and normalized to 100 µm along the length of the cochlear duct. Inner and OHCs were identified by location and morphology of phalloidin staining. Cell counting was performed using Image J software.
Proliferation and cell death analyses
Request a detailed protocolTo analyze progenitor proliferation and cell death, frozen sections were prepared from the entire ventral inner ear of E11.5 or E12.5 embryos. Alternate sections were subjected to staining for pHH3 and Sox2 (for proliferation) or activated-Caspase 3 and Sox2 (for cell death, data not shown). For EdU labeling, pregnant females were injected with 50 µg/g (body weight) of EdU according to the manufacture's recommendation. Embryos were collected 2 hr after EdU injection. EdU was detected with the Click-iT EdU Alexa Fluor 488 Imaging Kit (Invitrogen, Carlsbad, CA) according to manufacture's instructions. The total area of Sox+ cells was measured using Image J software and pHH3+ or activated-Caspase 3+ cells within the Sox2+ domain were counted. Counting was normalized to 10,000 μm2 of Sox2+ prosensory epithelium.
Immunohistochemistry
Request a detailed protocolFor whole mount immunofluorescence, cochleae were isolated and fixed in 4% PFA overnight at 4°C. Samples were washed with PBS and blocked with PBS containing 0.1% triton X-100 and 0.5% donkey serum. Primary antibody was incubated overnight at 4°C. Samples were washed with PBS and incubated with a secondary antibody for 1 hr at room temperature. Samples were washed, placed on a glass microscope slide, coverslipped, and photographed using a Zeiss LSM 700 confocal microscope. For immunofluorescence on histological sections, frozen sections (12 µm) were washed with PBS, blocked with 0.1% triton X-100 and 0.5% donkey serum, and incubated with primary antibodies in a humidified chamber overnight at 4°C. Sections were then washed and incubated with secondary antibody for 1 hr at room temperature. Samples were washed, coverslipped with Vectashield Mounting Media (Vector Labs, Burlingame, CA), and photographed using a Zeiss LSM 700 confocal microscope. Primary antibodies used: Phallodin (R&D Systems, Minneapolis, MN, 1:40), Prox1 (Covance, Princeton, NJ, 1:250), p27 (Neomarkers, Fremont, CA, 1:100), p75 (Chemicon, Billerica, MA, 1:500), β-galactosidase (Abcam, United Kingdom, 1:500), Sox2 (Millipore, Billerica, MA, 1:250, Santa Cruz, Dallas, TX, 1:250), Jag1 (Santa Cruz, Dallas, TX, 1:200), phospho-histone 3 (Sigma–Aldrich, St. Louis, MO, 1:500), and activated Caspase 3 (BD Sciences, San Jose, CA, 1:200).
Statistics
Numbers of samples are indicated for each experiment. All data are presented as mean ± standard deviation (sd). The p value for difference between two samples was calculated using a two-tailed Student's t-test or one-way ANOVA where appropriate. p < 0.05 was considered as significant.
References
-
FGF9 and FGF20 maintain the stemness of nephron progenitors in mice and manDevelopmental Cell 22:1191–1207.https://doi.org/10.1016/j.devcel.2012.04.018
-
Cooperative function of Tbx1 and Brn4 in the periotic mesenchyme is necessary for cochlea formationJournal of the Association for Research in Otolaryngology 9:33–43.https://doi.org/10.1007/s10162-008-0110-6
-
Tbx1 and Brn4 regulate retinoic acid metabolic genes during cochlear morphogenesisBMC Developmental Biology 9:31.https://doi.org/10.1186/1471-213X-9-31
-
Wnt signaling induces proliferation of sensory precursors in the postnatal mouse cochleaProceedings of the National Academy of Sciences of USA 109:8167–8172.https://doi.org/10.1073/pnas.1202774109
-
p27(Kip1) links cell proliferation to morphogenesis in the developing organ of CortiDevelopment 126:1581–1590.
-
Lung hypoplasia and neonatal death in Fgf9-null mice identify this gene as an essential regulator of lung mesenchymeDevelopment 128:2095–2106.
-
FGF signaling regulates expression of Tbx2, Erm, Pea3, and Pax3 in the early nasal regionDevelopmental Biology 247:237–250.https://doi.org/10.1006/dbio.2002.0696
-
Fgf20 is required for sensory epithelial specification in the developing cochleaThe Journal of Neuroscience 28:5991–5999.https://doi.org/10.1523/JNEUROSCI.1690-08.2008
-
Functional evolutionary history of the mouse Fgf gene familyDevelopmental Dynamics 237:18–27.https://doi.org/10.1002/dvdy.21388
-
High-efficiency CAG-FLPe deleter mice in C57BL/6J backgroundExperimental Animals 55:137–141.https://doi.org/10.1538/expanim.55.137
-
Dermo-1: a novel twist-related bHLH protein expressed in the developing dermisDevelopmental Biology 172:280–292.https://doi.org/10.1006/dbio.1995.0023
-
Planar and vertical signals control cellular differentiation and patterning in the mammalian cochleaThe Journal of Neuroscience 23:9469–9478.
-
Fibroblast growth factor signaling regulates pillar cell development in the organ of cortiThe Journal of Neuroscience 22:9368–9377.
-
BMP signaling is necessary for patterning the sensory and nonsensory regions of the developing mammalian cochleaThe Journal of Neuroscience 30:15044–15051.https://doi.org/10.1523/JNEUROSCI.3547-10.2010
-
The fibroblast growth factor signaling pathwayWiley Interdisciplinary Reviews Developmental Biology 4:215–266.https://doi.org/10.1002/wdev.176
-
Targeted mutagenesis of the POU-domain gene Brn4/Pou3f4 causes developmental defects in the inner earThe Journal of Neuroscience 19:5980–5989.
-
FGF/FGFR-2(IIIb) signaling is essential for inner ear morphogenesisThe Journal of Neuroscience 20:6125–6134.
-
Wnt-responsive lgr5-expressing stem cells are hair cell progenitors in the cochleaThe Journal of Neuroscience 32:9639–9648.https://doi.org/10.1523/JNEUROSCI.1064-12.2012
-
Generalized lacZ expression with the ROSA26 Cre reporter strainNature Genetics 21:70–71.https://doi.org/10.1038/5007
-
TBX1 is required for inner ear morphogenesisHuman Molecular Genetics 12:2041–2048.https://doi.org/10.1093/hmg/ddg216
-
Molecular mechanisms of inner ear developmentCold Spring Harbor Perspectives in Biology 4:a008409.https://doi.org/10.1101/cshperspect.a008409
-
Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF familyThe Journal of Biological Chemistry 281:15694–15700.https://doi.org/10.1074/jbc.M601252200
Decision letter
-
Tanya T WhitfieldReviewing Editor; University of Sheffield, United Kingdom
eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.
Thank you for sending your work entitled “Cochlear progenitor number is controlled through mesenchymal FGF receptor signaling” for consideration at eLife. Your article has been evaluated by Janet Rossant (Senior editor) and three reviewers, one of whom is a member of our Board of Reviewing Editors.
The following individuals responsible for the peer review of your submission have agreed to reveal their identity: Tanya Whitfield (Reviewing editor); Raj Ladher (peer reviewer). A further reviewer remains anonymous.
The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.
As you will see, all three reviewers found the work interesting and potentially important. However, they felt that the data, as they stand, do not provide full support for the proposed model, and that further work and clarification is required. As a minimum, this should include a full characterisation of the mesenchymal phenotype in each of the mutants, including the Fgf9 and Fgf20 single mutants for comparison. Improved quantitation of the sensory cell phenotype and levels of proliferation in epithelium and mesenchyme, ideally including a marker other than PHH3, will be important. Alternative interpretations of the mesenchymal phenotype should be considered and discussed. A fuller discussion of the phenotype caused by Fgfr1 KO in the epithelium is also required, since this also affects cochlear length. The revised version must include citation, acknowledgement and discussion of previously published work that impacts on the current study. In particular, it will be worth examining the IHC phenotype carefully here.
The full reviews are appended below.
Reviewer #1:
This is an interesting paper that builds on a previous study (Huh et al., 2012) demonstrating a role for Fgf20 in differentiation of the lateral compartment of the cochlea. The new information here is that FGF signalling from epithelium to mesenchyme is both required and sufficient for sensory progenitor proliferation and extension of the cochlear duct. The data are clear and support the conclusions well. However, there is no identification of a potential mechanism for the mesenchymal signal back to the cochlear duct that regulates its growth. As a result, the advance that the study makes over previous work appears to be somewhat incremental.
A few details of the manuscript could be clarified:
The normal expression patterns of Fgfr1 and Fgfr2 in the otic epithelium and periotic mesenchyme at the relevant stages should be presented or referred to early on in the manuscript.
Introduction: ‘…and that mesenchymal FGF signaling is sufficient to promote…’. This is ambiguous. Is this the same signalling from epithelium to mesenchyme as referred to in the previous sentence, or new signalling from mesenchyme to epithelium, also mediated by FGF?
Figure 1 and Results: Make sure the text follows the order of the panels in the figure and vice versa—i.e. show Fgf20 first in the figure.
Figure 1D: The sketch here does not appear to represent the expression patterns shown very well. The two FGF domains appear to abut each other directly, with a very sharp boundary at the junction between non-sensory (thinner) and sensory (thicker) epithelium. This is not shown in the sketch, which does not depict the full extent of the Fgf20 domain and shows a substantial gap between the two domains.
Figure 2: It would be helpful to show the Fgf20-/-; Fgf9+/+ phenotype here, to illustrate the effects of the loss of Fgf20 alone, even though previously published.
In the subsection headed “Fgf9 and Fgf20 regulate cochlear length and Fgf20, not Fgf9, is required for lateral compartment differentiation and patterning”, when you state “…the normal pattern of three rows of OHCs… (Figure 2A, B)”, there should be a reference to the later panels (C, D) here as well.
Figure 2C: Please mark on the positions of IHC and OHC on these panels. It looks to me as if there are two rows of IHC in the Fgf20βGal/βGal, especially in the right hand panel. Please comment.
The density of each HC type is measured for several different genotypes. It should be clarified somewhere that where patterning of the organ of Corti is affected, the whole organ is fragmented and that cell measurements are (presumably) taken over patches where the sensory cells are still present. If density was measured along the whole length of the cochlea, presumably IHC density would also be affected.
Figure 3D: Other areas marked by Jag1, but not highlighted, appear to show significant differences from controls, e.g. in the top left hand corner of the panel, the domain appears to be twice as big as in controls, whereas the stained area towards the bottom of the panel appears much reduced. Please comment.
The Discussion is rather brief, and does not really exploit the detail provided in the Results. In particular, the Discussion does not cover the potential differences in roles between Fgf9 and Fgf20, and Fgfr1 and Fgfr2. My interpretation of the Results was that Fgf20 primarily signals through Fgfr1 in the cochlear epithelium to regulate patterning of lateral compartment of the organ of Corti, while Fgf9 primarily signals through Fgfr2 in the mesenchyme to regulate cochlear length, with some cross-activity and redundancy between the two FGF pathways. However, the Discussion merely focusses on the redundancy rather than any differences between the two. It would be interesting to relate any differences to the clear differences between the non-overlapping expression domains of each FGF in the developing cochlear duct, and to the expression domains of the FGFRs, which are not shown (see comment above).
In addition, there is no mention of how the mesenchyme may signal back to the epithelium to regulate cochlear growth. It is not made clear in the paragraph about RA signalling whether this is being proposed as the mechanism of mesenchymal to epithelial signalling, but the last sentence of the manuscript appears to indicate that this may be a second signalling pathway that is regulating mesenchymal cell behaviour. Do the authors have any speculation on how the mesenchyme may regulate cochlear duct growth? Are there any candidate factors?
Reviewer #2:
Fgfr1 signalling has been implicated in the regulation of the pool of sensory progenitors that give rise to the hair cells and support cells of the mammalian cochlea and in the specification of outer hair cells during later organ of Corti patterning. In previous studies, Huh and colleagues described the role of Fgf20 in the mediating the latter function. In the current study the authors analyse the role of Fgf9 and Fgf20 in the control of the sensory progenitor pool. Using Cre-drivers they suggest that the ligands signal via the mesenchyme and back on to the otic epitehlia.
One of my major criticisms of this paper is the failure to reconcile their data with data that is already published. A recent study of the Fgfr1 phenotype (Ono et al., 2014) has not been considered and needs to be evaluated in the context of the authors work. For example, in the subsection “Epithelial Fgfr1 but not Fgfr2 is required for lateral compartment differentiation”, the sentence “however, no quantitative data regarding affected cell types or cochlear length was reported” (in Foxg1Cre Fgfr1 mutants) is untrue—the data is presented in Ono et al. Similarly, a paper showing the role of Fgf20 in the maintenance of Sox2+ progenitors (Munnamalai et al., 2012) has not been cited or considered.
With this in mind, it is probably worth highlighting the points that are inconsistent:
a) In Fgf9/20 knockouts, Fgf20Cre;Fgfr1/2 and Dermo1Cre;Fgfr1/2 mutants the inner hair cells are unaffected. In Ono et al., early deletion (using Six1-Cre and Foxg1Cre) of Fgfr1 affects IHC; Cochlear length is affected, quite significantly, in the early, epithelial deletions of Fgfr1 presented by Ono et al. Huh, Warchol and Ornitz do not find any reduction in epithelial size; Proliferation of Sox2+ progenitors was unaffected in Ono's early deletions of Fgfr1.
Alternative interpretations of the mesenchymal requirement of FGFR signalling in the regulation of cochlear length need to be considered. One possibility is that the effect on cochlear length is secondary, not because of a direct action of Fgf9/20 on Fgfr1 and 2 in the mesenchyme, but because there is simply less mesenchyme. I think that it is quite likely that a reduction of Fgfr1 and 2 in the peri-otic mesenchyme at such early stages leads to a reduction in the amount of mesenchyme. As Doetzlhofer et al., had shown, the mesenchyme is important for outgrowth. The authors need to analyse the periotic mesenchyme in these mutants.
The correlation of sensory progenitors with cochlea length is quite a laboured point. It is clear that even in the absence of Sox2+ progenitors (see Kiernan et al., 2005), the cochlea still extends. It is likely that progenitor proliferation plays at best a contributory role.
The cochlear of Fgf9 nulls, as well as the Fgf20 nulls and Fgf9/20 double nulls should also be analysed. Are these the same as wild-types or is the Fgf9 and Fgf20 phenotype additive?
Reviewer #3:
This is an interesting study that attempts to show the relative importance of Fgf9 and Fgf20 on the development of the prosensory domain of the mouse cochlea. The control of cell number in the prosensory domain of the cochlea is an important and unresolved issue in the field, as there is no apparent cell death, and so the number of progenitors generated directly affects the size of the organ of Corti.
In the first part of the paper, the authors show a role for Fgf9 on cochlear length; while Fgf20 seems to be affecting the number of prosensory progenitors that are being generated, or the way they are being patterned. This role for Fgf20 has been previously described by this group, and here they extend that work to show that Fgf9 does not play a role in this aspect. In Figure 2, the paper suffers from not showing data from Fgf20-/- mice alone (presumably because this is contained in their earlier publication). I think evidence from this mouse should be included here as part of the current analysis, so that direct comparison is possible; also, its absence makes the description of the various phenotypes rather confusing, and the authors might want to spend some time thinking of a way to describe this part more clearly. In the end of this first section, the authors claim that there are synergistic effects between the two genes; but I am unclear about why they are making this interpretation, since the lack of any patterning defects in Fgf9-/-, seems to suggest that this FGF acts outside the prosensory domain to affect the length of the cochlear duct (Figure 2).
The main point of the second section (Figure 3), is that Fgf9 plays a synergistic role with Fgf20 in the proliferation of the cells of the prosensory domain that will make up the organ of Corti. This is an interesting observation, but seems to contradict the separate roles that the two genes play as described in Figure 2, namely prosensory (Fgf20) and non-prosensory (Fgf9). The data here are also a little difficult. In Figure 3G and H, they are counting cells in histological sections rather than whole mounts? But it is difficult to know how much of the prosensory domain they actually measure, and did they count in exactly the same basal-apical position? This may have been difficult to do, since the (Fgf20-/-::Fgf9-/+) does show a change in patterning (“less compact”). Thus, the modest counting difference that they observe in Figure 3G and H could be due to differences in cell distribution within the duct? Indeed, from this figure there does seem to be a trend in their data showing that Fgf20 has an effect on its own, without Fgf9, even if their statistical test does not show a significant difference; and so Fgf9 could be skewing the data by changing the shape of the duct? This leads me to be skeptical of their interpretation that the genes are acting together, instead of independently on two different elements of the observed phenotype.
Figure 5: I don't think the conclusion that “together, these data show that FGFR1/2, expressed in mesenchymal cells, are required for proper cochlear length formation and for sensory progenitor proliferation, but not for cochlear pattern formation or differentiation” is completely supported in the case of proliferation, since they fail to isolate the two genes for the proliferation part of the study (Figure 5H), and only look at the double KO. How do we know that FGFR1 is not responsible, on its own, for the proliferation defect, an observation that would be consistent with the previous Pirvola study, I think?
Figure 6: In which they show that activation of FGFR signalling is sufficient to affect prosensory proliferation, is very interesting, and complements the KO data.
Discussion:
The authors state that their evidence shows that “in this study, we found that epithelial FGF9 and FGF20 signaling to mesenchymal FGFR1 and FGFR2 is required for normal levels of cochlear sensory progenitor proliferation and that inactivation of either the ligands or the mesenchymal receptors results in a shortened cochlea.”
Also, that “…the expression patterns of these two FGFs do not overlap, but nevertheless they appear to signal to a common target tissue, periotic mesenchyme in the developing inner ear…”
But how do we know that pro-sensory-derived FGF9 and FGF20 are signaling through mesenchymal FGFR1/2? Why couldn't they also be signaling through epithelial FGFRs? The fact that overstimulation of FGFR1/2 in mesenchyme changes the epithelial proliferation may suggest this is one route, but does not prove this, I don't think.
[Editors' note: further revisions were requested prior to acceptance, as described below.]
Thank you for resubmitting your work entitled “Cochlear progenitor number is controlled through mesenchymal FGF receptor signaling” for further consideration at eLife. Your revised article has been favorably evaluated by Janet Rossant (Senior editor) and Tanya Whitfield (Reviewing editor). The manuscript is much improved and most of the comments have been addressed. There are some discrepancies with previously published work, but these have now been acknowledged and discussed.
A few remaining issues still need to be addressed before acceptance, as outlined below:
1) As requested, morphological data for the single mutants have been added for comparison in Figure 2, but no additional Fgf9-/- single mutant analysis has been added to Figure 3 to show proliferation data for this genotype. Reference is also made to Pirvola et al., 2004, where the authors state that the cochlear duct is of normal length and architecture in Fgf9-/- mice. However, that paper has no quantitative data concerning proliferation either, and cochlear patterning is not analyzed in detail. If quantitative proliferation data on the single Fgf9 KO to compare to the double KO are available, they should be included. If they are not available, the claim that the epithelial proliferation phenotype in the double mutant reflects a synergy between the two Fgfs should perhaps be toned down.
2) None of the data shown appear to use simple pairwise comparisons. Each graph usually shows one (or more) control situation and several experimental situations (e.g. Figure 3H: one control and two experiments to which a statistical test is applied). If each experiment is compared with the same control, this is not a pairwise comparison, and ANOVA with multiple sample correction should be used. In any case, when an asterisk is used on the bar graphs, it should be clarified what is being compared with what, either with a description in the legend or by using a horizontal bar between the relevant control and the experimental case (e.g. Figure 2: are all samples being compared with the left hand (white) double heterozygote control?).
https://doi.org/10.7554/eLife.05921.015Author response
As you will see, all three reviewers found the work interesting and potentially important. However, they felt that the data, as they stand, do not provide full support for the proposed model, and that further work and clarification is required. As a minimum, this should include a full characterisation of the mesenchymal phenotype in each of the mutants, including the Fgf9 and Fgf20 single mutants for comparison.
We have added Fgf9 and Fgf20 single mutant data to Figure 2. The new data include representative images and quantitation of HC and SC numbers and cochlear length at E18.5.
Improved quantitation of the sensory cell phenotype and levels of proliferation in epithelium and mesenchyme, ideally including a marker other than PHH3, will be important.
We have labeled embryos with EdU at E11.5 and quantified cell proliferation in the Sox2+ domain. The genotypes analyzed include: Fgf9-/+;Fgf20βGal/+; Fgf9-/+;Fgf20βGal/βGal; Fgf9-/-;Fgf20βGal/βGal. These data are consistent with our previous data in Figure 3E showing reduced epithelial proliferation in the double mutant mouse embryo cochlear duct. The data is shown in Figure 3–figure supplement 1.
Alternative interpretations of the mesenchymal phenotype should be considered and discussed.
We have added to the Discussion additional interpretations of the mesenchymal phenotype.
A fuller discussion of the phenotype caused by Fgfr1 KO in the epithelium is also required, since this also affects cochlear length.
We have added to the Discussion additional comparisons of the epithelial phenotype to the phenotype seen in mice conditionally lacking FGFR1, published by the Ono et al.
The revised version must include citation, acknowledgement and discussion of previously published work that impacts on the current study. In particular, it will be worth examining the IHC phenotype carefully here.
We have added additional citations and acknowledgements as requested. In the genetic background used in our experiments we do not see any effects on IHC differentiation. The total number of IHCs is decreased in the Fgf9/20 double knockout embryos and in the mesenchymal FGFR conditional knockouts in which the length of the cochlea is dramatically shortened. These points are now discussed in the revised manuscript.
The full reviews are appended below.
Reviewer #1:
This is an interesting paper that builds on a previous study (Huh et al., 2012) demonstrating a role for Fgf20 in differentiation of the lateral compartment of the cochlea. The new information here is that FGF signalling from epithelium to mesenchyme is both required and sufficient for sensory progenitor proliferation and extension of the cochlear duct. The data are clear and support the conclusions well. However, there is no identification of a potential mechanism for the mesenchymal signal back to the cochlear duct that regulates its growth. As a result, the advance that the study makes over previous work appears to be somewhat incremental.
We agree with the reviewers that we have not identified the mesenchymal signal back to the cochlear duct that regulates its growth. However, we have ruled out several candidate pathways. What we have done is identify that mesenchymal FGFR signaling, possibly through activation of Etv4/5, is a critical pathway that will regulate the putative mesenchymal signal back to the cochlear duct. This is an important key step in understanding the ultimate, and currently elusive, molecular mechanism that regulates cochlear progenitor cell growth.
A few details of the manuscript could be clarified:
The normal expression patterns of Fgfr1 and Fgfr2 in the otic epithelium and periotic mesenchyme at the relevant stages should be presented or referred to early on in the manuscript.
We have cited two references, for the Fgfr1 and Fgfr2 expression patterns in the otic epithelium and periotic mesenchyme at early, E10-12, stages of development. (Pirvola et al. J. Neuroscience 2000 and Neuron 2002).
Introduction: ‘…and that mesenchymal FGF signaling is sufficient to promote…’. This is ambiguous. Is this the same signalling from epithelium to mesenchyme as referred to in the previous sentence, or new signalling from mesenchyme to epithelium, also mediated by FGF?
We have clarified this stated conclusion by indicating that Fgf9 and FGF20 signal to mesenchymal FGFRs and that mesenchymal FGFR signaling is necessary and sufficient to regulate cochlear progenitor cell number.
Figure 1 and Results: Make sure the text follows the order of the panels in the figure and vice versa—i.e. show Fgf20 first in the figure.
We have modified the text to follow the order of the figure.
Figure 1D: The sketch here does not appear to represent the expression patterns shown very well. The two FGF domains appear to abut each other directly, with a very sharp boundary at the junction between non-sensory (thinner) and sensory (thicker) epithelium. This is not shown in the sketch, which does not depict the full extent of the Fgf20 domain and shows a substantial gap between the two domains.
We have redrawn the sketch to better reflect the expression patterns shown in the immunostained sections.
Figure 2: It would be helpful to show the Fgf20-/-; Fgf9+/+ phenotype here, to illustrate the effects of the loss of Fgf20 alone, even though previously published.
We have added the Fgf9-/-;Fgf20+/+ and Fgf9+/+;Fgf20-/- genotypes in Figure 2 as requested. The Fgf9-/-;Fgf20+/+ genotype is comparable to the double heterozygous control and Fgf9-/-;Fgf20-/+ genotypes. The Fgf9+/+;Fgf20-/- genotype is comparable to Fgf9-/+;Fgf20-/- genotype. These data indicate that there is no cochlear patterning phenotype resulting from loss of Fgf9 as long as one wild type allele of Fgf20 is present. Furthermore, loss of one copy of Fgf9 does not contribute to either outer hair cell loss or cochlear length shortening.
In the subsection headed “Fgf9 and Fgf20 regulate cochlear length and Fgf20, not Fgf9, is required for lateral compartment differentiation and patterning”, when you state “…the normal pattern of three rows of OHCs… (Figure 2A, B)”, there should be a reference to the later panels (C, D) here as well.
We added reference to panels C and D as suggested.
Figure 2C: Please mark on the positions of IHC and OHC on these panels. It looks to me as if there are two rows of IHC in the Fgf20βGal/βGal, especially in the right hand panel. Please comment.
We have marked IHC and OHC as suggested. Yes, there are two rows of IHC in the sensory epithelial clumps. This was previously reported by us.
The density of each HC type is measured for several different genotypes. It should be clarified somewhere that where patterning of the organ of Corti is affected, the whole organ is fragmented and that cell measurements are (presumably) taken over patches where the sensory cells are still present. If density was measured along the whole length of the cochlea, presumably IHC density would also be affected.
We counted three regions of each cochlea (at 10%, 40%, and 70% along the length). In total, more than 900µm of each cochlea was counted. Due to delayed hair cell differentiation in Fgf20-/- compound mutants, we counted only the regions that contained differentiated sensory cells. Two rows of IHC are present in patch regions and no IHCs were detected in the region between the sensory patches. Therefore, IHC density was not changed throughout the cochlea. We explained this in the Methods section.
Figure 3D: Other areas marked by Jag1, but not highlighted, appear to show significant differences from controls, e.g. in the top left hand corner of the panel, the domain appears to be twice as big as in controls, whereas the stained area towards the bottom of the panel appears much reduced. Please comment.
At E14.5, Fgf9-/-;Fgf20-/- embryos had very shortened cochlear length compared to other genotypes. Therefore the angle of the cochlear turns in these embryos do not match that of other genotypes. The regions of Jag1 staining that are not boxed are sectioned at an oblique angle and thus cannot be compared. The boxed regions are examples of sections that perpendicularly transect the cochlear duct and thus can be compared across genotypes. This has been clarified in the figure legend.
The Discussion is rather brief, and does not really exploit the detail provided in the Results. In particular, the Discussion does not cover the potential differences in roles between Fgf9 and Fgf20, and Fgfr1 and Fgfr2. My interpretation of the Results was that Fgf20 primarily signals through Fgfr1 in the cochlear epithelium to regulate patterning of lateral compartment of the organ of Corti, while Fgf9 primarily signals through Fgfr2 in the mesenchyme to regulate cochlear length, with some cross-activity and redundancy between the two FGF pathways. However, the Discussion merely focusses on the redundancy rather than any differences between the two. It would be interesting to relate any differences to the clear differences between the non-overlapping expression domains of each FGG in the developing cochlear duct, and to the expression domains of the FGFRs, which are not shown (see comment above).
We have included discussion regarding specific roles of Fgf9 and Fgf20 and their receptors as shown below (extracted from the Discussion section):
“Fgf9 is expressed in non-sensory epithelia of the cochlea and loss of Fgf9 results in defects in periotic mesenchymal cell proliferation […] FGFR1 was identified as the epithelial target receptor (Huh et al., 2012; Pirvola et al., 2002).”
In addition, there is no mention of how the mesenchyme may signal back to the epithelium to regulate cochlear growth. It is not made clear in the paragraph about RA signalling whether this is being proposed as the mechanism of mesenchymal to epithelial signalling, but the last sentence of the manuscript appears to indicate that this may be a second signalling pathway that is regulating mesenchymal cell behaviour. Do the authors have any speculation on how the mesenchyme may regulate cochlear duct growth? Are there any candidate factors?
At present Tbx1/Pou3f4 induction of RA signaling is the only known mesenchymal factor to induce sensory progenitor proliferation. We showed that Tbx1 and Pou3f4 were not changed in Fgf9/Fgf20 mutant inner ear. However, we found that Etv4 and Etv5 were decreased in Fgf9/Fgf20 mutant inner ear. We speculate that downstream targets of Etv4 and Etv5 might induce sensory epithelial proliferation. We described these possibilities in the Discussion.
Reviewer #2:
One of my major criticisms of this paper is the failure to reconcile their data with data that is already published. A recent study of the Fgfr1 phenotype (Ono et al., 2014) has not been considered and needs to be evaluated in the context of the authors work. For example, in the subsection “Epithelial Fgfr1 but not Fgfr2 is required for lateral compartment differentiation”, the sentence “however, no quantitative data regarding affected cell types or cochlear length was reported” (in Foxg1Cre Fgfr1 mutants) is untrue—the data is presented in Ono et al. Similarly, a paper showing the role of Fgf20 in the maintenance of Sox2+ progenitors (Munnamalai et al., 2012) has not been cited or considered.
With this in mind, it is probably worth highlighting the points that are inconsistent:
In Fgf9/20 knockouts, Fgf20Cre;Fgfr1/2 and Dermo1Cre;Fgfr1/2 mutants the inner hair cells are unaffected. In Ono et al., early deletion (using Six1-Cre and Foxg1Cre) of Fgfr1 affects IHC;
We agree with the reviewer in that there are differences in the observed phenotypes between data shown here and that shown by Ono et al. 2014. We have modified the Results section to include the Ono et al. observations. In the Discussion, we attempt to reconcile these differences in phenotype. We think that the differences are most likely attributed to differences in genetic background, although the genetic background of the Ono et al. mice were not reported.
Cochlear length is affected, quite significantly, in the early, epithelial deletions of Fgfr1 presented by Ono et al. Huh, Warchol and Ornitz do not find any reduction in epithelial size;
We observed a 10-25% decrease of cochlear length in Foxg1Cre, Fgfr1-/f mutants, which is comparable with what we observed in Fgf20-/- mutants. We maintain our mouse lines on a 129X1/SvJ;C57BL/6J mixed background. We observed a shorter cochlear length in Fgf20 mutant when on a pure C57BL/6J genetic background (not shown). We speculate that the difference between what we observed and Ono et al. may due to different genetic backgrounds.
Proliferation of Sox2+ progenitors was unaffected in Ono's early deletions of Fgfr1.
We observed that progenitor proliferation was decreased only with mesenchymal FGFR deletion (with Dermo1Cre) but not with epithelial FGFR deletion (with foxg1Cre or Fgf20Cre). This result is consistent with the observations of Ono et al.
Alternative interpretations of the mesenchymal requirement of FGFR signalling in the regulation of cochlear length need to be considered. One possibility is that the effect on cochlear length is secondary, not because of a direct action of Fgf9/20 on Fgfr1 and 2 in the mesenchyme, but because there is simply less mesenchyme. I think that it is quite likely that a reduction of Fgfr1 and 2 in the peri-otic mesenchyme at such early stages leads to a reduction in the amount of mesenchyme. As Doetzlhofer et al., had shown, the mesenchyme is important for outgrowth. The authors need to analyse the periotic mesenchyme in these mutants.
Out data is consistent with the observations of Montcouquiol 2003 and Doetzlhofer 2004 showing that mesenchyme is important for epithelial progenitor growth, presumably through production of some trophic factor. Pirvola, 2004 showed that periotic mesenchyme proliferation was decreased in Fgf9 mutant, resulting in a hypoplastic otic capsule. But this did not affect either cochlear length or progenitor proliferation (Pirvola et al. 2004). Therefore, decreased mesenchymal cell number is unlikely to be the direct cause of the epithelial phenotype. Rather, we propose that FGF signaling within mesenchyme affects some factor that signals reciprocally to epithelial progenitors. We have analyzed periotic mesenchyme for candidate signaling molecules and targets of FGFR signaling. We have shown that Etv4 is decreased, but we have not yet found a mesenchymal-derived signaling molecule that could regulate epithelial proliferation.
The correlation of sensory progenitors with cochlea length is quite a laboured point. It is clear that even in the absence of Sox2+ progenitors (see Kiernan et al., 2005), the cochlea still extends. It is likely that progenitor proliferation plays at best a contributory role.
We agree with the reviewer. For cochlea to elongate, at least two mechanisms are required, 1) Cochlear length should depend on the total number of available differentiated hair cells (which depend on total numbers of progenitor cells); 2) Cochlear length should depend on the proper organization of sensory cells into one row of IHC and 3 rows of OHCs, governed by convergent extension. Many PCP mutants that have disrupted convergent extension show decreased cochlear length. We posit that Fgf9/20 signaling to mesenchyme is required for progenitor proliferation, thus affecting cochlear length. In addition, FGF20 signaling to epithelial FGFR1 regulates sensory cell differentiation and this also affects cochlear length, but, in our mouse genetic background, this is a relatively small effect (10-25%).
The cochlear of Fgf9 nulls, as well as the Fgf20 nulls and Fgf9/20 double nulls should also be analysed. Are these the same as wild-types or is the Fgf9 and Fgf20 phenotype additive?
We have added these data to Figure 2. Fgf9-/- or Fgf9-/-;Fgf20-/+ does not affect cochlear length and HC/SC number. In addition, Fgf20-/- and Fgf9-/+;Fgf20-/- showed a similar phenotype.
Reviewer #3:
In the first part of the paper, the authors show a role for Fgf9 on cochlear length; while Fgf20 seems to be affecting the number of prosensory progenitors that are being generated, or the way they are being patterned. This role for Fgf20 has been previously described by this group, and here they extend that work to show that Fgf9 does not play a role in this aspect. In Figure 2, the paper suffers from not showing data from Fgf20-/- mice alone (presumably because this is contained in their earlier publication). I think evidence from this mouse should be included here as part of the current analysis, so that direct comparison is possible; also, its absence makes the description of the various phenotypes rather confusing, and the authors might want to spend some time thinking of a way to describe this part more clearly.
We have added the Fgf9-/- and Fgf20-/- data to Figure 2. See response to reviewer 2 above.
In the end of this first section, the authors claim that there are synergistic effects between the two genes; but I am unclear about why they are making this interpretation, since the lack of any patterning defects in Fgf9-/-, seems to suggest that this FGF acts outside the prosensory domain to affect the length of the cochlear duct (Figure 2).
We agree with the reviewer that FGF9 acts outside of the prosensory domain to affect the length of cochlear duct. Our data shows that FGF20 also acts outside of the prosensory domain to affect the length of cochlear duct and functions together with FGF9. Receptor inactivation in mesenchyme strongly suggests that the target of FGF9 and FGF20 is periotic mesenchyme. Our conclusion is that there is synergism in signaling to mesenchyme, but no synergism in signaling to epithelium.
The main point of the second section (Figure 3), is that Fgf9 plays a synergistic role with Fgf20 in the proliferation of the cells of the prosensory domain that will make up the organ of Corti. This is an interesting observation, but seems to contradict the separate roles that the two genes play as described in Figure 2, namely prosensory (Fgf20) and non-prosensory (Fgf9).
The reviewer has astutely identified the key observation of this work. In Figure 2 the phenotype is observed at E18.5. We are hypothesizing, based on the data shown, that the FGF9/20 double knockout encompasses two phenotypes that are developmentally distinct and separable. 1) A patterning phenotype that is due to FGF20 signaling to epithelial FGFR1 as was described in our previous publication (Huh, 2012). This patterning phenotype is independent of FGF9. 2) A cochlear length phenotype that demonstrates synergism between FGF9 and FGF20. Figure 3 begins to define how these two phenotypes differ. The key data is in Figure 3A. This shows that Control or FGF20 knockout cochlea have normal numbers of sensory progenitor cells. In contrast the Fgf9/20 double knockout has significantly reduced numbers of progenitor cells. From these data we conclude that FGF20 alone does not affect progenitor cell number, but rather functions later in development to regulate epithelial patterning (differentiation). In contrast FGF9/20 together regulate progenitor cell number. Therefore, these are really not contradictory results and actually define two distinct developmental processes.
The data here are also a little difficult. In Figure 3G and H, they are counting cells in histological sections rather than whole mounts? But it is difficult to know how much of the prosensory domain they actually measure, and did they count in exactly the same basal-apical position? This may have been difficult to do, since the (Fgf20-/-::Fgf9-/+) does show a change in patterning (“less compact”). Thus, the modest counting difference that they observe in Figure 3G and H could be due to differences in cell distribution within the duct? Indeed, from this figure there does seem to be a trend in their data showing that Fgf20 has an effect on its own, without Fgf9, even if their statistical test does not show a significant difference; and so Fgf9 could be skewing the data by changing the shape of the duct? This leads me to be skeptical of their interpretation that the genes are acting together, instead of independently on two different elements of the observed phenotype.
We counted pHH3+ cells within the Sox2+ sensory progenitor domain throughout the entire cochlear duct, counting every second section from base to apex. In the revised manuscript, we have repeated this analysis for the E11.5 time point using EdU labeling. The result was consistent with the data in Figure 3G and H and is shown in Figure 3–figure supplement 1.
Figure 5: I don't think the conclusion that “together, these data show that FGFR1/2, expressed in mesenchymal cells, are required for proper cochlear length formation and for sensory progenitor proliferation, but not for cochlear pattern formation or differentiation” is completely supported in the case of proliferation, since they fail to isolate the two genes for the proliferation part of the study (Figure 5H), and only look at the double KO. How do we know that FGFR1 is not responsible, on its own, for the proliferation defect, an observation that would be consistent with the previous Pirvola study, I think?
The reviewer is correct. We have reworded the paragraph to state that mesenchymal FGFR signaling is a necessary determinant of cochlear length and sensory progenitor proliferation, but not for cochlear pattern formation or differentiation.
The Pirvola study inactivated epithelial Fgfr1 but did not measure proliferation or effects on cochlear length. We repeated this experiment and showed that there is no effect on sensory progenitor proliferation (Figure 4–figure supplement 1) and a very small effect on cochlear length (9%).
Figure 6: In which they show that activation of FGFR signalling is sufficient to affect prosensory proliferation, is very interesting, and complements the KO data.
Discussion:
The authors state that their evidence shows that “in this study, we found that epithelial FGF9 and FGF20 signaling to mesenchymal FGFR1 and FGFR2 is required for normal levels of cochlear sensory progenitor proliferation and that inactivation of either the ligands or the mesenchymal receptors results in a shortened cochlea.”
Also, that “…the expression patterns of these two FGFs do not overlap, but nevertheless they appear to signal to a common target tissue, periotic mesenchyme in the developing inner ear…”
But how do we know that pro-sensory-derived FGF9 and FGF20 are signaling through mesenchymal FGFR1/2? Why couldn't they also be signaling through epithelial FGFRs? The fact that overstimulation of FGFR1/2 in mesenchyme changes the epithelial proliferation may suggest this is one route, but does not prove this, I don't think.
We posit that FGF9/20 are unlikely to signal to epithelial FGFRs to regulate progenitor cell proliferation based on phenotypic comparisons of the different tissue-specific receptor knockouts. Epithelial deletion of Fgfr1/2 did not show a dramatic decrease in cochlear length or progenitor proliferation compared to Fgf9/20 deletion. On the other hand, mesenchymal deletion of Fgfr1/2 showed a severe decrease of cochlear length and progenitor proliferation, which was comparable to the Fgf9/20 mutant, but no patterning phenotype. We believe that these data demonstrate that mesenchymal Fgfr1/2 are required for proper cochlear length formation and that this phenotype likely results from reduced progenitor proliferation and fewer progenitor cells. We have elaborated on this in the Discussion.
[Editors' note: further revisions were requested prior to acceptance, as described below.]
1) As requested, morphological data for the single mutants have been added for comparison in Figure 2, but no additional Fgf9-/- single mutant analysis has been added to Figure 3 to show proliferation data for this genotype. Reference is also made to Pirvola et al., 2004, where the authors state that the cochlear duct is of normal length and architecture in Fgf9-/- mice. However, that paper has no quantitative data concerning proliferation either, and cochlear patterning is not analyzed in detail. If quantitative proliferation data on the single Fgf9 KO to compare to the double KO are available, they should be included. If they are not available, the claim that the epithelial proliferation phenotype in the double mutant reflects a synergy between the two Fgfs should perhaps be toned down.
We have not measured proliferation in Fgf9-/- embryos because we have not observed any phenotype that affects hair or supporting cell number or overall length of the cochlear duct in these mice. If the editors or reviewers require these data we can add it, but this will require 3-4 weeks to time mate and analyze the appropriate mice.
We have modified the text to say that comparison of cochlear epithelial cell proliferation was compared to double heterozygous controls.
We do not use the word synergy, but we do state that FGF9 and FGF20 have redundant function. This is based on the lack of a cochlear phenotype in Fgf9-/- embryos and the appearance of a sensory epithelial proliferation phenotype in the Fgf9/20 double mutant that is not observed in Fgf20-/- cochleae.
2) None of the data shown appear to use simple pairwise comparisons. Each graph usually shows one (or more) control situation and several experimental situations (e.g. Figure 3H: one control and two experiments to which a statistical test is applied). If each experiment is compared with the same control, this is not a pairwise comparison, and ANOVA with multiple sample correction should be used. In any case, when an asterisk is used on the bar graphs, it should be clarified what is being compared with what, either with a description in the legend or by using a horizontal bar between the relevant control and the experimental case (e.g. Figure 2: are all samples being compared with the left hand (white) double heterozygote control?).
We have clarified the statistical comparisons to state that two-way comparisons used Student’s t test and we used one-way ANOVA for comparison of more than three samples.
https://doi.org/10.7554/eLife.05921.016Article and author information
Author details
Funding
Action on Hearing Loss
- David M Ornitz
March of Dimes Foundation (March of Dimes Births Defect Foundation)
- David M Ornitz
National Institutes of Health (NIH) (K99 DC012825)
- Sung-Ho Huh
Hearing Health Foundation (HHF)
- Sung-Ho Huh
Office of Naval Research (ONR) (N000141211025)
- Mark E Warchol
National Institutes of Health (NIH) (Microscopy & Digital Imaging Core P30 DC004665)
- Mark E Warchol
National Institutes of Health (NIH) (DDRCC Murine Models Core Grant P30 DK052574)
- David M Ornitz
National Institutes of Health (NIH) (Washington University Musculoskeletal Research Center P30 AR057235)
- David M Ornitz
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank Craig Smith for technical help. This work was funded with a grant from the Action on Hearing Loss Foundation (DMO), the Office of Naval Research N000141211025 (MEW), the March of Dimes Foundation (DMO), the Hearing Health Foundation (SHH), NIH K99 DC012825 (SHH). Confocal microscopy was supported by the Microscopy & Didigal Imaging Core (NIH P30 DC004665). Mouse lines were generated with assistance from the Mouse Genetics Core, the DDRCC Murine Models Core Grant (NIH P30 DK052574), and the Washington University Musculoskeletal Research Center (NIH P30 AR057235).
Ethics
Animal experimentation: This study was carried out in strict accordance with the recommendations in the Guide for the Careand Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Washington University Division of Comparative Medicine Animal Studies Committee (Protocol Number20130201). All efforts were made to minimize animal suffering.
Reviewing Editor
- Tanya T Whitfield, University of Sheffield, United Kingdom
Version history
- Received: December 5, 2014
- Accepted: April 25, 2015
- Accepted Manuscript published: April 27, 2015 (version 1)
- Version of Record published: May 18, 2015 (version 2)
Copyright
© 2015, Huh et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 2,185
- Page views
-
- 418
- Downloads
-
- 53
- Citations
Article citation count generated by polling the highest count across the following sources: Scopus, Crossref, PubMed Central.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Chromosomes and Gene Expression
- Developmental Biology
Imaging experiments reveal the complex and dynamic nature of the transcriptional hubs associated with Notch signaling.
-
- Cell Biology
- Developmental Biology
Cylicins are testis-specific proteins, which are exclusively expressed during spermiogenesis. In mice and humans, two Cylicins, the gonosomal X-linked Cylicin 1 (Cylc1/CYLC1) and the autosomal Cylicin 2 (Cylc2/CYLC2) genes, have been identified. Cylicins are cytoskeletal proteins with an overall positive charge due to lysine-rich repeats. While Cylicins have been localized in the acrosomal region of round spermatids, they resemble a major component of the calyx within the perinuclear theca at the posterior part of mature sperm nuclei. However, the role of Cylicins during spermiogenesis has not yet been investigated. Here, we applied CRISPR/Cas9-mediated gene editing in zygotes to establish Cylc1- and Cylc2-deficient mouse lines as a model to study the function of these proteins. Cylc1 deficiency resulted in male subfertility, whereas Cylc2-/-, Cylc1-/yCylc2+/-, and Cylc1-/yCylc2-/- males were infertile. Phenotypical characterization revealed that loss of Cylicins prevents proper calyx assembly during spermiogenesis. This results in decreased epididymal sperm counts, impaired shedding of excess cytoplasm, and severe structural malformations, ultimately resulting in impaired sperm motility. Furthermore, exome sequencing identified an infertile man with a hemizygous variant in CYLC1 and a heterozygous variant in CYLC2, displaying morphological abnormalities of the sperm including the absence of the acrosome. Thus, our study highlights the relevance and importance of Cylicins for spermiogenic remodeling and male fertility in human and mouse, and provides the basis for further studies on unraveling the complex molecular interactions between perinuclear theca proteins required during spermiogenesis.