1. Biochemistry and Chemical Biology
  2. Structural Biology and Molecular Biophysics
Download icon

The enterococcal cytolysin synthetase has an unanticipated lipid kinase fold

  1. Shi-Hui Dong
  2. Weixin Tang
  3. Tiit Lukk
  4. Yi Yu
  5. Satish K Nair  Is a corresponding author
  6. Wilfred A van der Donk  Is a corresponding author
  1. University of Illinois at Urbana-Champaign, United States
  2. Howard Hughes Medical Institute, University of Illinois at Urbana-Champaign, United States
  3. Cornell High Energy Synchrotron Source, United States
Research Article
Cite this article as: eLife 2015;4:e07607 doi: 10.7554/eLife.07607
6 figures and 2 tables

Figures

Figure 1 with 2 supplements
Biosynthesis of the enterococcal cytolysin.

(A) Biosynthetic route to cytolysin S (small subunit of cytolysin) and the structure of cytolysin L (large subunit of cytolysin). CylM dehydrates three Thr and one Ser in the precursor peptide CylLS to generate three Dhb residues and one Dha. The enzyme also catalyzes the conjugate addition of the thiols of Cys5 to Dhb1 and Cys21 to Dha17. The proteases CylB and CylA then remove the leader peptide in a step-wise manner to provide cytolysin S. In similar fashion, CylM catalyzes seven dehydrations of Ser and Thr residues and three cyclization reactions during the biosynthesis of the large subunit of cytolysin. Abu-S-Ala = methyllanthionine (MeLan); Ala-S-Ala = lanthionine (Lan); Dha = dehydroalanine; Dhb = dehydrobutyrine. (B) Post-translational modifications carried out by CylM during cytolysin biosynthesis. Xn = peptide linker.

https://doi.org/10.7554/eLife.07607.003
Figure 1—figure supplement 1
MALDI/TOF mass spectra for CylLL (A) and CylLS (B) peptides incubated with (magenta traces) or without (blue traces) CylM.

Linear CylLL, calculated M: 7,082, average mass; observed M + H+: 7084, average mass. CylM modified CylLL, calculated M—7 H2O: 6956, average mass; observed M—7 H2O + H+: 6958, average mass. CylLS, calculated M: 7132, average mass; observed M + H+: 7134, average mass. CylM modified CylLS, calculated M—4 H2O: 7060, average mass; observed M—4 H2O + H+: 7062, average mass. The observed masses are consistent with the expected post-translational modifications shown in Figure 1.

https://doi.org/10.7554/eLife.07607.004
Figure 1—figure supplement 2
ESI MS/MS analysis of CylLL (A) and CylLS (B) core peptides modified by CylM in vitro and treated with the protease CylA that removes the leader peptide.

The fragmentation pattern verifies the expected ring topology. The parent ions provided masses consistent with the expected structure and the MS/MS data corroborate the ring topology. CylM-modified CylLL core peptide, calculated (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass; observed (M—7 H2O + 3 H)3+: 1146.2, monoisotopic mass. CylM-modified CylLS core peptide, calculated (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass; observed (M—4 H2O + 2 H)2+: 1016.5, monoisotopic mass.

https://doi.org/10.7554/eLife.07607.005
Figure 2 with 3 supplements
(A) Overall structure of CylM.

(B) Structure of the class I lanthipeptide cyclase NisC illustrating the structural homology with the C-terminus of CylM. (C) Comparison of the putative peptide-binding β-strands of CylM with the peptide binding regions of other RiPP biosynthetic enzymes including NisB (involved in nisin biosynthesis, PDB 4WD9) and LynD (involved in cyanobactin biosynthesis; PDB 4V1T). (D) Structure of the lipid kinase PI3K that shares homology with the dehydration domain of CylM. (E) Domain organization of LanMs in comparison with that of lipid kinases. RBD, Ras-binding domain.

https://doi.org/10.7554/eLife.07607.006
Figure 2—figure supplement 1
MALDI-TOF mass spectrum for CylLS modified by the CylM dehydratase domain in Escherichia coli.

Calculated M—4 H2O: 8330, average mass; observed M—4 H2O + H+: 8334, average mass. Partial gluconoylation at the N-terminus of dehydrated CylLS occurred when expressing the peptide in E. coli BL21(DE3), resulting in a +178 Da peak in addition to the desired peptide mass (Aon et al., 2008).

https://doi.org/10.7554/eLife.07607.007
Figure 2—figure supplement 2
Topology diagrams for (A) CylM and (B) PI3 kinase P110γ.
https://doi.org/10.7554/eLife.07607.008
Figure 2—figure supplement 3
Structure based alignment of biochemically characterized LanM enzymes.

Secondary structural elements are colored as in Figures 2A, 3A.

https://doi.org/10.7554/eLife.07607.009
Figure 3 with 3 supplements
(AC) Comparison of the kinase domains of (A) CylM, with those of (B) mammalian target of rapamycin (mTOR) and (C) DNA-PKc (a PI3 kinase).

Secondary structural elements are colored as in Figure 2A and structurally unique insertions are designated. (D) Close up of the CylM dehydratase active site showing the bound nucleotide, and the proximity of residues important for phosphorylation and phosphate elimination. A simulated annealing difference Fourier map (calculated without the nucleotide) is superimposed in blue mesh. (E) Solvent occluded surface showing the two possible peptide-binding grooves that flank the peptide β-strand element (red). A loop = activation loop.

https://doi.org/10.7554/eLife.07607.010
Figure 3—figure supplement 1
Two views, rotated by 180o, of the superposition of the kinase active site of CylM (in purple) with the kinase domain of PI3 kinase (in cyan).

Relevant structural and functional elements are noted.

https://doi.org/10.7554/eLife.07607.011
Figure 3—figure supplement 2
Superposition of the active sites of CylM (pink) with the co-crystal structures of transition state mimics bound to mTOR (cyan) and cyclin-dependent protein kinase CDK2 (green).

Conserved active site residues implicated in the catalytic mechanism are labeled using the same color-coding as for the polypeptides.

https://doi.org/10.7554/eLife.07607.012
Figure 3—figure supplement 3
Superposition of the active sites of CylM (pink) with cyclin-dependent protein kinase CDK2 bound to a peptide substrate (green).

The insertions in the kinase domain of CylM preclude binding of the CylA peptide substrate in a similar pose.

https://doi.org/10.7554/eLife.07607.013
Dependence of the rate of ADP production by CylM (1 μM) on ATP concentration in the presence of 100 μM CylLS.
https://doi.org/10.7554/eLife.07607.014
Figure 5 with 2 supplements
MALDI-TOF mass spectra of CylLS peptides co-expressed with CylM and CylM mutants in E. coli. M = unmodified CylLs; P = phosphorylation.

Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 1.

https://doi.org/10.7554/eLife.07607.015
Figure 5—source data 1

Calculated and observed masses of CylLS peptides modified by CylM and CylM mutants in E. coli.

All calculated masses are [M + H]. -: not observed.

https://doi.org/10.7554/eLife.07607.016
Figure 5—source data 2

Calculated and observed masses of CylLS peptides incubated with CylM and CylM mutants in vitro for 30 min.

All calculated masses are [M + H]. -: not observed.

https://doi.org/10.7554/eLife.07607.017
Figure 5—source data 3

Calculated and observed masses of CylLS peptides incubated with CylM and CylM mutants in vitro for 10 hr.

All calculated masses are [M + H]. -: not observed.

https://doi.org/10.7554/eLife.07607.018
Figure 5—figure supplement 1
MALDI-TOF mass spectra of CylLS peptides incubated with CylM and CylM phosphorylation-deficient mutants in vitro for 30 min (left) and 10 hr (right).

M = unmodified CylLs; P = phosphorylation. Peaks between the masses of the highlighted multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 2.

https://doi.org/10.7554/eLife.07607.019
Figure 5—figure supplement 2
MALDI-TOF mass spectra of CylLS peptides incubated with CylM elimination-deficient mutants in vitro for 30 min (left) and 10 hr (right).

M = unmodified CylLs; P = phosphorylation. Peaks between the highlighted masses of multiply phosphorylated CylLS correspond to intermediates resulting from both phosphorylation and partial dehydration. A table showing the calculated and observed masses of each intermediate is provided in Figure 5—source data 3.

https://doi.org/10.7554/eLife.07607.020
Figure 6 with 2 supplements
MALDI-TOF mass spectra of phosphorylated CylLS intermediates incubated with CylM in the absence of nucleotides (black trace), and in the presence of AMP (adenosine 5′-monophosphate disodium salt) (blue trace), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) (magenta trace), or non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate) (red trace).

M = unmodified CylLs; P = phosphorylation. The data are shown for non-hydrolyzable analogs of ADP and ATP to distinguish whether the observed activity is due to the presence of these nucleotides, or to the activated phosphor-anhydride groups of ADP/ATP (see ‘Materials and methods’ for more information). See also Figure 6—figure supplement 1.

https://doi.org/10.7554/eLife.07607.021
Figure 6—figure supplement 1
MALDI-TOF mass spectra of CylLS peptides incubated with CylM in the absence of nucleotides (black trace), and in the presence of AMP (adenosine 5′-monophosphate disodium salt) (blue trace), non-hydrolyzable ADP (adenosine 5′-(β-thio)diphosphate trilithium salt) (magenta trace), or non-hydrolyzable ATP (adenosine 5′-(β,γ-imido)triphosphate lithium salt hydrate) (red trace).

M = unmodified CylLs; P = phosphorylation.

https://doi.org/10.7554/eLife.07607.022
Figure 6—figure supplement 2
MALDI-TOF mass spectra of phosphorylated CylLS intermediates incubated with CylM in the absence (black trace) or presence of ADP (magenta trace).

M = unmodified CylLs; P = phosphorylation. Not only are the phosphates eliminated from pSer/pThr, ADP also is used to dehydrate non-phosphorylated Ser/Thr to afford fully, fourfold dehydrated peptide. See ‘Materials and methods’ for further discussion.

https://doi.org/10.7554/eLife.07607.023

Tables

Table 1

Primer sequences used for cloning of cylM and its mutants

https://doi.org/10.7554/eLife.07607.024
Primer namePrimer sequence (5′-3′)
CylM_EcoRI_Duet_FPAAAAA GAATTCG GAAGATA ATCTGATTAA T
CylM_NotI_Duet_RPAAAAA GCGGCCGC TTACAGT TCAAACAGCA G
CylM_D252A_QC_FPAGGGT GCA AGCCAT AGCCGTGGTAAAACCGTT AGC
CylM_D252A_QC_RPATGGCT TGC ACCCT GGC TTTCGCTAAT GCTATTCAGT
CylM_H254A_QC_FPGATAGC GCT AGCCGT GGT AAAACCGTT AGCACCCTG
CylM_H254A_QC_RPACGGCT AGC GCTA TC ACCCTGGC TTTCGCTAAT G
CylM_D347A_QC_FPGTTACC GCT CTGCAT TATGAAAACATCATTGCCCATGGC
CylM_D347A_QC_RPAT GCAG AGC GGT AAC ATTAAAC AGAAAGGCAA TGCCAATCAG
CylM_H349A_QC_FPCCGATCTG GCT TATGAAAA CATCATTGCCCATGGCGAATA
CylM_H349A_QC_RPTTTTCATA AGC CAGATCGG T AACATTAAAC AGAAAGGCAA TGCCAAT
CylM_N352A_QC_FPCATTATGAA GCC ATCATTGC CCATGGCGAATATCCG GTGATT
CylM_N352A_QC_RPGCAATGAT GGC TTCATAATG CAGATCGGT AACATTAAAC AGAAAGGC
CylM_D364A_QC_FPGTGATTATT GCT AATGAAACC TTTTTTCAGCAGAATATTCCGATTGAATTT
CylM_D364A_QC_RPGGTTTC ATT AGC AATA ATCAC CGGAT ATTCGCCATG GGC
CylM_R506A_QC_FPTGATTGTG GCC AATGTTAT TCGTCCGACCCAGCGTTA
CylM_R506A_QC_RPA TAACATT GGC CACAATCA GA TTCTGCAGAT TATTATTAAT ATAGGCCAGA
CylM_T512A_QC_FPGTCCG GCC CAG C GTTATGCAGATATGCTGGAA TTTAGC
CylM_T512A_QC_RPCTG GGCCGGAC GAA TAACATTGCG CACAATCAGA
CylM_NdeI_FPAAAAA CATATG GAAGATA ATCTGATTAA T
CylM625_KpnI_RPAAAAA GGTACC TTA GTACGGGTTA TAAATATTCA G
Table 2

Data collection, phasing, and refinement statistics

https://doi.org/10.7554/eLife.07607.025
NativeSeMet
Data collection
 Space groupP212121P212121
 Unit cell: a, b, c (Å)51.2, 90.7, 246.451.2, 90.9, 246.2
 Resolution (Å)*50.00–2.2 (2.24–2.2)50.00–2.8 (2.85– 2.8)
 Total reflections359,303169,660
 Unique reflections58,18025,354
 Rsym (%)6.3 (67.0)6.1 (53.8)
 I/σ(I)19.1 (1.7)16.7 (2.1)
 Completeness (%)97.9 (87.6)96.0 (88.4)
 Redundancy6.2 (5.1)6.0 (5.9)
Refinement
 Resolution (Å)25.0–2.2
 No. reflections used51,874
 Rwork/Rfree23.7/26.8
Number of atoms
 Protein7251
 Solvent160
 Metal/Nucleotide1/23
B-factors
 Protein52.9
 Solvent32.4
 Metal/Nucleotide54.1/62.3
R.m.s deviations
 Bond lengths (Å)0.011
 Bond angles (°)1.54
  1. *

    Highest resolution shell is shown in parenthesis.

  2. R-factor = Σ(|Fobs| − k|Fcalc|)/Σ |Fobs|and R-free is the R value for a test set of reflections consisting of a random 5% of the diffraction data not used in refinement.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)