NR2F2 is required in the embryonic testis for fetal Leydig cell development

eLife Assessment

This important study, which has been improved further upon revision, reveals a critical role of the transcription factor NR2F2 in mouse fetal Leydig cell (FLC) differentiation. With elegantly carried out experiments, the authors provide compelling evidence that NR2F2 helps to initiate the differentiation of certain interstitial cells into FLC until these cells mature into functional secretory cells that produce androgen and insulin-like peptide 3 (INSL3). The particular importance of the work comes from the fact that NR2F2 affects FLCs without altering paracrine signals known to be involved in FLC differentiation. The work will be of interest to colleagues studying reproductive development in mammals including humans or the biological functions of the nuclear receptor family.

https://doi.org/10.7554/eLife.103783.3.sa0

Significance of the findings:

Important: Findings that have theoretical or practical implications beyond a single subfield

Landmark
Fundamental
Important
Valuable
Useful

Strength of evidence:

Compelling: Evidence that features methods, data and analyses more rigorous than the current state-of-the-art

Exceptional
Compelling
Convincing
Solid
Incomplete
Inadequate

During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments

Abstract
Introduction
Results
Discussion
Materials and methods
Appendix 1
Data availability
References
Article and author information
Metrics

Abstract

Male genital development in XY mammalian fetuses is triggered by the action of hormones, including testosterone, secreted by the developing testes. Defects in this process are a cause for differences in sex development (DSD), one of the most common congenital abnormalities in humans. Fetal Leydig cells (FLCs) play a central role in the synthesis of masculinizing hormones in the developing testes. Yet, the genetic cascade controlling their differentiation is poorly understood. Here, we investigate the role of the orphan nuclear receptor NR2F2 (COUP-TFII) in FLC development. We report that NR2F2 is expressed in interstitial progenitor cells of the mouse embryonic testes and is downregulated upon their differentiation into FLC. By using two mouse models for conditional mutation of Nr2f2 in the developing testes, we demonstrate that NR2F2 is required for testis morphogenesis and FLC development. NR2F2 acts in interstitial progenitors to regulate the initiation and progression of FLC differentiation. These results establish NR2F2 as an essential regulator of FLC development and steroid hormone synthesis in the mouse fetal testis and provide an entry point in understanding the etiology of 46,XY DSD associated with pathogenic NR2F2 variants.

Introduction

Sexual development in mammals is conditioned by the gonadal sex established during fetal life. In XY embryos, the initially undifferentiated gonads develop into testes that can produce testosterone which stimulates the differentiation of male internal and external genitalia (including epididymis, vas deferens, seminal vesicles, scrotum, and penis) leading to the masculinization of the fetus. In contrast, fetal ovaries do not produce testosterone, and female internal and external genitalia (oviducts, uterus, vagina, and vulva) develop in XX individuals. Abnormalities in the masculinization process are mainly associated with defects in androgen synthesis or signaling (Reyes et al., 2023). Although this molecular cascade is well defined, the differentiation of androgen-producing cells in the embryo is only partially understood.

Androgen production in the developing testis relies mainly on fetal Leydig cells (FLCs), which express all enzymes required for the biosynthesis of androstenedione from cholesterol (Miyabayashi et al., 2017; Inoue et al., 2016; Shima et al., 2013; Ademi et al., 2022). The final step of conversion of androstenedione into testosterone, catalyzed by HSD17B3, takes place in a different cell type, the fetal Sertoli cells (Shima et al., 2013; O’Shaughnessy et al., 2000). In addition to their role in androgen synthesis, FLCs also produce INSL3, a hormone required for testis descent (Nef and Parada, 1999; Zimmermann et al., 1999). Defects in testis descent, regulated also by androgens, result in cryptorchidism, a condition which impacts fertility and constitutes a risk factor for testicular cancer (Hutson et al., 2015). While a fraction of FLCs persist after birth, others de-differentiate or involute, and adult testosterone production is ensured by a distinct population of steroidogenic cells, the adult Leydig cells (ALCs), which differentiate at puberty (Shima and Morohashi, 2017; Shima, 2019).

FLCs differentiate from embryonic day 12.5 (E12.5) in mice and increase in number during fetal life through the recruitment and differentiation of Wnt5a positive proliferative progenitors located in the interstitial space of the testes (Ademi et al., 2022; Shima and Morohashi, 2017; Shima, 2019; Rotgers et al., 2018). Interstitial progenitors also give rise to the contractile peritubular myoid cells (PTM) that will surround the future seminiferous tubules (Ademi et al., 2022). Despite being the most abundant cell population in the fetal testis (Ademi et al., 2022; Mayère et al., 2022), little is known about the genetic control of the proliferation, specification, and differentiation of the interstitial steroidogenic progenitor cells.

Lineage tracing and single-cell transcriptomic analyses have revealed that interstitial progenitors have a dual origin. The majority are derived from the coelomic epithelium of the undifferentiated gonad, which harbors early bipotential progenitors able to differentiate along the supporting (the future Sertoli cells) or the steroidogenic lineage (Ademi et al., 2022; Karl and Capel, 1998; Stévant et al., 2018; Stévant et al., 2019). In addition, Nestin positive cells migrate from the adjacent mesonephros into the gonad and differentiate along the steroidogenic lineage from E13.5 to give rise to up to a third of the FLC population by the end of gestation (Ademi et al., 2022; DeFalco et al., 2011; Kumar and DeFalco, 2018).

Positive and negative paracrine signals drive FLC differentiation by upregulating the transcription factors NR5A1, GATA4, and GATA6, which in turn regulate the expression of genes related to cholesterol metabolism and steroidogenesis (Rotgers et al., 2018; Wen et al., 2016; Morohashi et al., 2020; Baba et al., 2018; Baba et al., 2014; Shima et al., 2018; Padua et al., 2015; Bielinska et al., 2007; Viger et al., 2022). Desert Hedgehog (DHH) is secreted by Sertoli cells and acts on the interstitial progenitors expressing the Hedgehog receptor Patched1 (PTCH1) and the Hedgehog effectors GLI1, -2, and -3 to trigger FLC and PTM differentiation (Yao et al., 2002; Barsoum and Yao, 2011; Barsoum et al., 2009; Park et al., 2000; Kothandapani et al., 2020; Pierucci-Alves et al., 2001; Clark et al., 2000). In addition, FLC development requires the activation of signaling pathways downstream of PDGFRA in the steroidogenic progenitors (Brennan et al., 2003; Inoue et al., 2022; Schmahl et al., 2008). On the other hand, ligands present in vascular and perivascular cells activate the NOTCH2 receptor and the expression of the effectors HES1 and HEYL in interstitial progenitors to maintain their undifferentiated state and inhibit FLC differentiation (Kumar and DeFalco, 2018; Tang et al., 2008; Liu et al., 2016; Defalco et al., 2013). In addition to the paracrine signals from adjacent cell populations, FLC differentiation is also regulated by the cell-autonomous action of the transcription factors ARX, TCF21, PBX1, MAF, and MAFB expressed in the interstitial steroidogenic progenitors, although their precise roles remain elusive (Ademi et al., 2022; Miyabayashi et al., 2013; Li et al., 2021; Cui et al., 2004; Schnabel et al., 2003).

Nuclear receptor subfamily 2 group F member 2 (NR2F2, also known as COUP-TFII) is abundantly expressed in interstitial progenitors of the fetal and adult testis in rodents and humans (Inoue et al., 2016; Ademi et al., 2022; Mendoza-Villarroel et al., 2014b; Kilcoyne et al., 2014; van den Driesche et al., 2012; Lottrup et al., 2014; Qin et al., 2008; Taelman et al., 2024). NR2F2 activates or represses transcription depending on the cellular context by directly binding to DNA responsive elements or by interacting with other transcription factors. NR2F2 regulates cell differentiation during organogenesis, adult tissue homeostasis, and tumorigenesis (Polvani et al., 2019). NR2F2 function is essential for cardiac and vascular development so that Nr2f2 mutation in mouse leads to embryonic lethality at mid-gestation (Pereira et al., 1999). The study of mouse conditional mutants has shown that NR2F2 is essential for ALC differentiation in the postnatal testis before puberty (Qin et al., 2008). However, the function of NR2F2 in the developing testis during fetal life has not been addressed, and its role in the interstitial progenitors that give rise to the FLC lineage remains unknown. It was initially proposed that NR2F2 could act as a negative regulator of steroidogenesis at fetal stages based on the inverse correlation between NR2F2 expression and steroidogenesis genes and testosterone levels in mouse and rat fetal testes treated with endocrine disruptors (van den Driesche et al., 2012). More recently, rare variants in NR2F2 have been associated with cryptorchidism, hypospadias, and defective penile growth in human patients (Zidoune et al., 2022; Ganapathi et al., 2023; Wankanit et al., 2024). These phenotypes can be attributed to defective testosterone and INSL3 production during gestation (Hutson et al., 2015; Amato et al., 2022), suggesting a positive role for NR2F2 in promoting FLC differentiation and/or function in the fetal testis.

In this study, we show that NR2F2 is expressed in interstitial progenitors of coelomic and mesonephric origin of the mouse fetal testes and is downregulated upon FLC differentiation. By using two Cre lines that drive Nr2f2 deletion in mouse embryonic gonads, we show that NR2F2 is required for fetal mouse testis morphogenesis and for FLC differentiation. Absence of Nr2f2 does not impair paracrine signals known to regulate FLC differentiation nor the proliferation or survival of the steroidogenic progenitor population. Our findings reveal that NR2F2 promotes the initiation of FLC differentiation as well as FLC maturation. Taken together, these results establish NR2F2 as an essential factor that positively regulates the development of steroidogenic cells in the mouse fetal testis.

Results

NR2F2 is expressed in steroidogenic progenitors of the developing testis

We analyzed the spatiotemporal distribution of NR2F2 in the developing testis by immunofluorescence. At E11.5 (18–21 tail somites [ts]), NR2F2 was detected in both the coelomic epithelium and the mesonephric mesenchyme adjacent to the gonads, two tissues that contribute to the population of interstitial steroidogenic progenitors (Ademi et al., 2022; Karl and Capel, 1998; Kumar and DeFalco, 2018; Figure 1A and C). The majority of mesenchymal cells in the gonad expressed the transcription factor RUNX1 (RUNX1+) (Nicol et al., 2019), indicating that most of the gonadal somatic cells at this stage belong to the supporting lineage (Figure 1A and D). Nevertheless, NR2F2+ RUNX1- cells were observed, revealing that interstitial progenitors were already present at this stage (Figure 1A). NR2F2+ cells were either GATA4+ or GATA4-, suggesting that interstitial progenitors of coelomic and mesonephric origins, respectively, were both present (Figure 1A–C).

Figure 1 with 1 supplement see all

Download asset Open asset

NR2F2 is expressed in steroidogenic progenitors of the fetal testis.

(**A–D**) Immunodetection of NR2F2, RUNX1, and GATA4 on embryonic day 11.5 (E11.5) (18 tail somites) XY gonad. NR2F2 is detected in coelomic epithelium (ce), mesonephros (me), and RUNX1 negative cells that are either GATA4 positive (arrows in A–C) or GATA4 negative (arrowheads in A–C). (**E–H**) Immunodetection of NR2F2 and ARX on E12.5 XY gonad. NR2F2 is co-expressed with ARX in the coelomic epithelium (ce, dotted lines in F–H) and in interstitial cells between the testis cords (arrows in F–H). (**I,J**) Immunodetection of NR2F2 and PDGFRA on E14.5 XY gonad. NR2F2 is detected in PDGFRA positive cells, including interstitial progenitors (arrowheads in J), peritubular myoid cell surrounding testis cords (arrows in J), and cells of the future tunica albuginea (yellow arrow in J). (**K,L**) Immunodetection of NR2F2, NESTIN, and PECAM-1 on E14.5 XY gonad. NR2F2 is detected in NESTIN positive interstitial progenitors, including perivascular cells (arrowheads in L) and peritubular myoid cells (arrow in L). (**M–P**) Immunodetection of NR2F2 and HSD3B on E14.5 XY gonad. NR2F2 is absent from the majority of HSD3B positive fetal Leydig cells (arrowheads in N–P) and is only detected at low levels in a few HSD3B positive elongated cells (arrows in N–P). Data are representative of triplicate biological replicates. Scale bar = 50 µm in A–D, F–H, J, L, and N–P. Scale bar = 100 µm in E, I, K, M.

In E12.5 testes, NR2F2+ cells were detected in the coelomic epithelium and in the interstitial space outside the developing testis cords (Figure 1E–H, Figure 1—figure supplement 1A–D). NR2F2+ cells co-expressed the steroidogenic progenitor marker ARX (Ademi et al., 2022; Miyabayashi et al., 2013) and were actively proliferating (Figure 1E–H, Figure 1—figure supplement 1E–H). At E14.5, NR2F2 expression was maintained in interstitial cells co-expressing PDGFRA (Brennan et al., 2003), as well as in the PTM lining the testis cords and in the cells beneath the surface of the testis that will contribute to the future tunica albuginea (Figure 1I and J, Figure 1—figure supplement 1M–P). NR2F2 expression was also found in NESTIN-expressing perivascular cells that correspond to the mesonephros-derived steroidogenic progenitors (Kumar and DeFalco, 2018; Figure 1K and L). In contrast, NR2F2 protein was either absent or detected at very low levels in FLC marked by the expression of the steroidogenic enzyme HSD3B (Figure 1M–P, Figure 1—figure supplement 1I–L).

Together, our results show that NR2F2 is expressed in the coelomic epithelium and the mesonephros, as well as in the interstitial progenitors derived from both sources, and is downregulated upon FLC differentiation in the developing testis.

NR2F2 is required for fetal testicular morphogenesis and FLC development

In order to investigate the function of NR2F2 in the developing mouse testis, we used an Nr2f2^flox conditional allele (Hutson et al., 2015), and a knock-in Wt1^CreERT2 line, in which tamoxifen-inducible CreERT2 is produced by Wt1-expressing cells (Shima and Morohashi, 2017; Figure 2A). Wt1 is expressed from E9.5 in the coelomic epithelium of the gonadal ridge and in the adjacent mesonephros (Armstrong et al., 1993), and Wt1^CreERT2-mediated recombination can be induced in all somatic gonadal cells upon tamoxifen administration at E9.5 and E10.5 (Manuylov et al., 2008; Figure 2—figure supplement 1A).

Figure 2 with 1 supplement see all

Download asset Open asset

NR2F2 deletion by *Wt1^CreERT2* impairs Sertoli cell differentiation and fetal Leydig cell (FLC) development.

(A) Generation of *Wt1^CreERT2; Nr2f2^flox/flox* mutants. Tamoxifen was administered at embryonic day 9.5 (E9.5) and E10.5, and embryos were recovered at E12.5, E14.5, and E16.5. (**B,C**) Immunodetection of NR2F2 and SOX9 on E12.5 *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes (outlined by dotted lines) after tamoxifen treatment at E9.5 and E10.5. NR2F2 is efficiently deleted in the gonad and mesonephros. (**D,E**) Immunodetection of NR2F2 and NESTIN on E14.5 *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes. NR2F2 is efficiently deleted in NESTIN1 positive cells. (**F,G**) Immunodetection of ARX on E12.5 *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes (outlined by dotted lines). Interstitial cells are generated in *Wt1^CreERT2; Nr2f2^flox/flox* mutants. (**H,I**) Macroscopic view of the urogenital tract of XY E16.5 *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes dissected after tamoxifen treatment at E9.5 and E10.5. Testes (t) and kidneys (k) are hypoplastic in *Wt1^CreERT2; Nr2f2^flox/flox* mutants. bl: bladder. vd: vas deferens. (**J,K**) Immunodetection of HSD3B on E12.5 *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes (outlined by dotted lines). ad: adrenal. (**L,M**) Immunodetection of HSD3B on E14.5 *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes. ad: adrenal. (N) Quantification of the number of HSD3B positive cells per surface unit and of the number of SOX9 positive cells per surface unit in control (wild-type or *Nr2f2^flox/+*) and *Wt1^CreERT2; Nr2f2^flox/flox* testes. Each triangle represents the mean number of HSD3B or SOX9 positive cells per surface unit of one individual measured on at least two sections per gonad. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (O) Quantification of *Cyp11a1*, *Cyp17a1, Insl3,* and *Sox9* transcripts in *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes treated with tamoxifen at E9.5 and E10.5 and dissected at E14.5 after normalization to *Sdha* and *Tbp* by RT-qPCR. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. Immunodetection data are representative of triplicate biological replicates. Scale bar = 100 µm in B–G, J–M. Scale bar = 500 µm in H, I.

Figure 2—source data 1 Source data for cell counts and RT-qPCR data in Figure 2.: https://cdn.elifesciences.org/articles/103783/elife-103783-fig2-data1-v1.xlsx
Download elife-103783-fig2-data1-v1.xlsx

NR2F2 is co-expressed with WT1 in the gonadal coelomic epithelium, in the mesonephros, and in interstitial cells (Yu et al., 2012; Figure 2—figure supplement 1C–F). Tamoxifen treatment at E9.5 and E10.5 triggered an efficient NR2F2 deletion in gonadal and mesonephric tissues of Wt1^CreERT2; Nr2f2^flox/flox embryos analyzed at E12.5 and E14.5 (Figure 2A–E, Figure 2—figure supplement 1B). NR2F2 expression was completely absent in gonadal interstitial cells, including NESTIN+ cells, demonstrating that all interstitial steroidogenic progenitors were targeted in Wt1^CreERT2; Nr2f2^flox/flox embryos (Figure 2D and E). Morphological examination of the urogenital system of E16.5 Wt1^CreERT2; Nr2f2^flox/flox embryos revealed hypoplastic undescended testes, as well as hypoplastic kidneys (Figure 2H and I), indicating that NR2F2 function is required for testicular and kidney development.

Sertoli cells expressing SOX9 (Figure 2B and C) and interstitial progenitors marked by ARX (Figure 2F and G) were present in Wt1^CreERT2; Nr2f2^flox/flox embryos at E12.5. However, differentiated steroidogenic FLC (marked by HSD3B expression) were almost completely absent in the mutant gonads (Figure 2J, K, and N). This phenotype was not due to a delay in the initiation of FLC differentiation, as the number of HSD3B positive cells remained strongly reduced in Wt1^CreERT2; Nr2f2^flox/flox mutant gonads at E14.5 (60% reduction, Figure 2L–N). In addition, the transcripts of Cyp11a1 and Cyp17a1, two genes encoding steroidogenic enzymes expressed in FLC, and of Insl3 were strongly reduced (Figure 2O), providing a possible explanation for the observed undescended testes phenotype (Figure 2—figure supplement 1G and H). The mutant gonads showed fewer testis cords that were enlarged and exhibited irregular shapes at E14.5 (Figure 2E, Figure 2—figure supplement 1J and M). Moreover, the expression of ACTA2 was strongly reduced both in the periphery of the gonad and in cells lining the testis cords, indicating that tunica cell and PTM development were impaired in Wt1^CreERT2; Nr2f2^flox/flox mutants (Figure 2—figure supplement 1G and H). Together, these results demonstrate that NR2F2 function is not essential for the initial specification of the interstitial and supporting cells of the testis but is required for testicular morphogenesis and for FLC development.

Sertoli cell development is impaired in Wt1^CreERT2; Nr2f2^flox/flox testes

FLC differentiation relies on signals produced by Sertoli cells such as DHH and PDGFA acting on interstitial cells (Rotgers et al., 2018; Wen et al., 2016). The number of Sertoli cells expressing SOX9 and the levels of Sox9 transcripts were not altered in Wt1^CreERT2; Nr2f2^flox/flox mutants at E14.5 (Figure 2N and O). However, the expression of Dhh, Pdgfa, and Amh, another marker of differentiated Sertoli cells, was reduced in Wt1^CreERT2; Nr2f2^flox/flox mutants compared to Nr2f2^flox/+ control gonads (Figure 2—figure supplement 1K), indicating that Sertoli cell differentiation is abnormal in Wt1^CreERT2; Nr2f2^flox/flox gonads. WT1 is required for Sertoli cell development (Gao et al., 2006), and previous work suggested that Wt1 heterozygosity in Wt1^CreERT2^/+ gonads results in delayed testicular development (Carré et al., 2018). To discriminate between the effects of Nr2f2 loss of function and Wt1 heterozygosity in the phenotype of Wt1^CreERT2; Nr2f2^flox/flox mutants, we analyzed gene expression in Wt1^CreERT2/+ testes compared to wild-type littermates. We found that the expression of the FLC markers Cyp11a1 and Cyp17a1 was not significantly different in Wt1^CreERT2/+ testes compared to wild-type littermates (Figure 2—figure supplement 1L). In contrast, transcript levels of Dhh, Pdgfa, and Amh were significantly reduced (Figure 2—figure supplement 1L). While these results indicate that impaired FLC development in Wt1^CreERT2; Nr2f2^flox/flox mutants is associated with the loss of Nr2f2 function, the potential contribution of Sertoli cell defects caused by Wt1 heterozygosity to the FLC phenotype cannot be ruled out in this model.

NR2F2 is required in the steroidogenic lineage for FLC development

In order to elucidate the specific function of NR2F2 in the steroidogenic lineage for FLC development, we used the transgenic Nr5a1-Cre line which drives robust recombination in somatic gonadal cells from E11.5, after the supporting and steroidogenic lineages have been specified (Figure 3A, Figure 3—figure supplement 1A and B; Bingham et al., 2006; Manuylov et al., 2011).

Figure 3 with 1 supplement see all

Download asset Open asset

NR2F2 deletion by Nr5a1-Cre impairs fetal Leydig cell (FLC) development.

(A) Generation of *Nr5a1-Cre; Nr2f2^flox/flox* mutants. (**B,C**) Immunodetection of NR2F2 and SOX9 on embryonic day 12.5 (E12.5) *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes (outlined by dotted lines). NR2F2 is deleted in interstitial cells but is still present in the outermost layer of the testis. (**D,E**) Immunodetection of NR2F2 and NESTIN on E14.5 *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. NR2F2 is still detected in NESTIN1 positive cells. (**F,G**) Immunodetection of ARX on E12.5 *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes (outlined by dotted lines). Interstitial cells are generated in *Nr5a1-Cre; Nr2f2^flox/flox* mutants. (H) Quantification of *Sox9, Dhh, Pdgfa,* and *Amh* transcripts after normalization to *Sdha* and *Tbp* in control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* by RT-qPCR at E14.5. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (**I,J**) Immunodetection of HSD3B on E12.5 *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes (outlined by dotted lines). ad: adrenal. (**K,L**) Immunodetection of HSD3B on E14.5 *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. (M) Quantification of the number of HSD3B positive cells per surface unit in control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* testes at E12.5 and E14.5. Each circle represents the mean number of HSD3B positive cells per surface unit of one individual measured on at least two sections per gonad. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (N) Quantification of *Cyp11a1*, *Cyp17a1,* and *Insl3* after normalization to *Sdha* and *Tbp* in control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* by RT-qPCR at E14.5. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (**O,P**) Macroscopic view of the urogenital tract of XY P3 *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* mutants. The testes are in abdominal position in *Nr5a1-Cre; Nr2f2^flox/flox* mutants. k: kidney, t: testis, bl: bladder. vd: vas deferens. Immunodetection data are representative of triplicate biological replicates. Scale bar = 100 µm in B–G, I–L. Scale bar = 500 µm in O, P.

Figure 3—source data 1 Source data for cell counts and RT-qPCR data in Figure 3.: https://cdn.elifesciences.org/articles/103783/elife-103783-fig3-data1-v1.xlsx
Download elife-103783-fig3-data1-v1.xlsx

At E11.5, NR5A1 is co-expressed with NR2F2 in the gonadal coelomic epithelium and in interstitial cells, but is absent from the mesonephros and mesonephros-derived cells (Stévant et al., 2018; Kumar and DeFalco, 2018; Figure 3—figure supplement 1D–G). Nr5a1-Cre; Nr2f2^flox/flox mutants show efficient Nr2f2 deletion in gonadal interstitial cells at E12.5 and E14.5 (Figure 3B–E, Figure 3—figure supplement 1C). Consistent with previous reports on the activity of Nr5a1-Cre (Manuylov et al., 2011), NR2F2 was still detected in the coelomic epithelium layer and in interstitial cells just beneath it, particularly in the anterior part of the gonad of Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 3B–E). NESTIN+ NR2F2+ cells were still present, confirming that steroidogenic progenitors of mesonephric origin were not targeted by Nr5a1-Cre (Figure 3D and E, Figure 3—figure supplement 1H and I; Kumar and DeFalco, 2018). Together, these results demonstrate that in Nr5a1-Cre; Nr2f2^flox/flox mutants, NR2F2 is deleted after E11.5 in interstitial cells derived from the coelomic epithelium, except in the outermost layer of the testis.

Nr2f2 deletion by Nr5a1-Cre did not affect the initial formation of the supporting and steroidogenic lineages as evidenced by SOX9 (Figure 3B, C, and H, Figure 3—figure supplement 1N and O) and ARX expression (Figure 3F and G), nor the differentiation of Sertoli cells as shown by normal expression levels of Dhh, Pdgfa, and Amh (Figure 3H, Figure 3—figure supplement 1N). In addition, ACTA2 was detected in PTM and was only slightly reduced in the tunica albuginea of the posterior region in the mutant testes (Figure 3—figure supplement 1J and K). In contrast, the FLC population marked by HSD3B or CYP11A1 was decreased (40% reduction, Figure 3I–M, Figure 3—figure supplement 1L and M), and the expression of the FLC markers Cyp11a1, Cyp17a1, and Insl3 was strongly downregulated in Nr5a1-Cre; Nr2f2^flox/flox mutant testes (Figure 3N). We conclude that Nr2f2 deletion after E11.5 by Nr5a1-Cre leads to FLC reduction without Sertoli cell defects, suggesting that NR2F2 is required cell-autonomously in the interstitial cells for FLC development.

In agreement with reduced Insl3 expression, the testes of Nr5a1-Cre; Nr2f2^flox/flox embryos were undescended and exhibited an abnormal abdominal position at postnatal day (P) 3 (Figure 3O and P). In addition, the anogenital distance, a readout for androgen levels (Schwartz et al., 2019), was reduced in P0 and P1 Nr5a1-Cre; Nr2f2^flox/flox males when compared to male controls (Figure 3—figure supplement 1P), consistent with the reduced expression of steroidogenic enzymes in the mutant testes. We conclude that defective FLC development in Nr2f2 mutants results in cryptorchidism and impaired masculinization of the external genitalia.

NR2F2 is required for the initiation of FLC differentiation

FLCs differentiate from proliferating interstitial progenitors that progressively lose their mitotic ability, downregulate the transcription factors ARX and NR2F2, upregulate the master regulator of steroidogenesis NR5A1, and activate the expression of steroidogenesis-related genes (Inoue et al., 2016; Ademi et al., 2022; Miyabayashi et al., 2013). We wanted to determine which of these steps of FLC differentiation are NR2F2 dependent.

The transcription factor ARX is required in the pool of proliferating interstitial progenitors for FLC development (Miyabayashi et al., 2013). We first examined whether NR2F2 regulates the survival, proliferation, or identity of the ARX+ cell population. We found that the expression of Arx mRNA was not modified in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4—figure supplement 1A). The total number of gonadal cells, the percentage of ARX+ cells among the total number of gonadal cells, and the fraction of proliferating cells among the ARX+ population were similar to controls at E12.5 and E14.5 (Figure 4A, B, and E, Figure 4—figure supplement 1B–E). In addition, we did not find evidence of increased cell death in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4—figure supplement 1F–H). Together, these results indicate that ARX+ steroidogenic progenitor cells are present and proliferate at normal rates in Nr5a1-Cre; Nr2f2^flox/flox mutants.

Figure 4 with 1 supplement see all

Download asset Open asset

NR2F2 function is required for the initiation of fetal Leydig cell (FLC) differentiation.

(**A,B**) Immunodetection of ARX and BrdU (arrows) on embryonic day 14.5 (E14.5) XY *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. (**C,D**) Immunodetection of NR5A1 on E14.5 XY *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. Arrows indicate strong expression of NR5A1 positive FLC. (E) Quantification of the percentage of ARX positive cells (number of ARX positive nuclei relative to the total number of nuclei labeled by DAPI), of the percentage of ARX positive cells labeled by BrdU (number of nuclei positive for ARX and BrdU relative to the number of ARX positive nuclei) and of the number of NR5A1 positive cells per surface unit in E14.5 XY control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* testes. Each circle represents the mean percentage of ARX+ or ARX+/BrdU+ or NR5A1+ cells per surface unit of one individual measured on at least two sections per gonad. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (F) Quantification of *Gli1*, *Pdgfra*, *Pdgfb,* and *Sgpl1* transcripts after normalization to *Sdha* and *Tbp* in control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* by RT-qPCR at E14.5. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (**G,H**) In situ hybridization detection of *Gli1* transcripts and immunodetection of HSD3B protein on E14.5 XY *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. (**I,J**) Immunodetection of PDGFRA on E14.5 XY *Nr2f2^flox/flox* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. (**K,L**) Immunodetection of PECAM-1 and NR2F2 on E12.5 XY *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. PECAM-1 is expressed in germ cells and in endothelial cells (white arrows). (M) Quantification of Cdh5, *Notch2, Heyl, and Hes1* transcripts after normalization to *Sdha* and *Tbp* in control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* by RT-qPCR at E14.5. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. Immunodetection data are representative of triplicate biological replicates. Scale bar = 100 µm.

Figure 4—source data 1 Source data for cell counts and RT-qPCR data in Figure 4.: https://cdn.elifesciences.org/articles/103783/elife-103783-fig4-data1-v1.xlsx
Download elife-103783-fig4-data1-v1.xlsx

As the ARX+ steroidogenic progenitors adopt an FLC identity, NR2F2 is progressively lost, and the nuclear receptor NR5A1 is strongly upregulated (Inoue et al., 2016; Ademi et al., 2022; van den Driesche et al., 2012). NR5A1 directs FLC differentiation by regulating the expression of genes associated with cholesterol metabolism and steroidogenesis (Morohashi et al., 2020; Shima et al., 2018; Jeyasuria et al., 2004; Buaas et al., 2012). In Nr5a1-Cre; Nr2f2^flox/flox mutants, the cells expressing high levels of NR5A1+ in the interstitial compartment were reduced compared to controls (Figure 4C–E, Figure 4—figure supplement 1I and J). This observation indicates that NR2F2 function is required for NR5A1 upregulation at the initial step of steroidogenic cell differentiation.

DHH, PDGFRA, and NOTCH pathways are not impaired in Nr5a1-Cre; Nr2f2^flox/flox mutants

We next investigated the impact of Nr5a1-Cre; Nr2f2 ^flox/flox mutation on the activation of the signaling pathways involved in FLC differentiation. DHH secreted by Sertoli cells binds to its receptor PTCH1 expressed in interstitial progenitors and activates its target genes, including Gli1, to promote FLC differentiation (Yao et al., 2002; Barsoum and Yao, 2011). The expression levels of Dhh and of its target Gli1, a readout of Hedgehog pathway activation, were not modified in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 3H, Figure 4F, Figure 3—figure supplement 1N). Gli1 transcripts exhibited a similar distribution in interstitial cells of control and Nr5a1-Cre; Nr2f2^flox/flox mutants at E14.5 (Figure 4G and H). PDGFA produced by Sertoli cells binds to the PDGFRA receptor expressed in interstitial progenitors to activate downstream signaling required for FLC development (Brennan et al., 2003; Schmahl et al., 2008). The expression levels of Pdgfa and Pdgfb, coding for two PDGFRA ligands expressed in developing testes (Brennan et al., 2003), were not altered in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figures 3H and 4F). Transcript levels of Pdgfra were unchanged in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4F), and PDGFRA protein was detected at the plasma membrane of interstitial cells in both control and Nr5a1-Cre; Nr2f2^flox/flox mutant testes at E14.5 (Figure 4I and J). In addition, the expression of Sgpl1, a PDGFRA signaling target involved in steroidogenic differentiation (Schmahl et al., 2008), was not reduced in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4F). These observations indicate that the activities of Hedgehog and PDGFRA signaling, two pathways that positively regulate FLC differentiation, are not impaired in Nr5a1-Cre; Nr2f2^flox/flox mutants.

In addition to the positive signals, FLC differentiation is also negatively modulated by NOTCH signaling triggered by ligands expressed in vascular and perivascular cells. An increase in testicular endothelial cells results in a reduction in FLC numbers (Kumar and DeFalco, 2018; Tang et al., 2008; Liu et al., 2016; Defalco et al., 2013). The distribution and abundance of endothelial cells marked by PECAM-1 was not altered in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4K and L). In addition, Cdh5 transcript levels (a readout of the abundance of endothelial cells) were similar in controls and Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4M). These observations indicate that the reduction in FLCs in Nr5a1-Cre; Nr2f2^flox/flox mutants was not associated with an increased population of endothelial cells. The receptor NOTCH2 expressed in interstitial cells is involved in restricting FLC differentiation (Kumar and DeFalco, 2018; Tang et al., 2008; Liu et al., 2016; Defalco et al., 2013). Notch2 mRNA levels were not altered in Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4M). NOTCH signaling activates the expression of its target genes (that also act as effectors of the pathway), including Heyl, specifically expressed in interstitial cells and strongly upregulated upon vascular depletion (Kumar and DeFalco, 2018) and Hes1, expressed in interstitial cells and involved in restricting FLC differentiation (Tang et al., 2008; Liu et al., 2016). Transcripts of the NOTCH pathway targets Hes1 and Heyl were detected at similar levels in controls and Nr5a1-Cre; Nr2f2^flox/flox mutants (Figure 4M), indicating that the observed decrease in FLC numbers cannot be attributed to an increase in NOTCH signaling.

Together, these results indicate that NR2F2 deficiency does not impact the activity of the signaling pathways known to induce or repress FLC formation, suggesting that NR2F2 acts downstream or in parallel to these pathways to regulate FLC differentiation from interstitial progenitors.

NR2F2 is required for FLC maturation

A small fraction of HSD3B positive cells formed in the absence of NR2F2 function, even in the case of Wt1^CreERT2; Nr2f2^flox/flox mutant gonads that exhibit widespread NR2F2 deletion in steroidogenic progenitors of coelomic and mesonephric origin. One possibility is that these cells are ALCs that have prematurely differentiated in Nr2f2 mutant fetal testes. Bhmt (Betaine-homocysteine methyltransferase) is specifically expressed in ALC and absent in FLC (Sararols et al., 2021). Bhmt transcripts were not detected in control or Nr2f2 mutant testes by RT-qPCR at E14.5, while they were present in adult testes (Figure 5—figure supplement 1A), indicating that the steroidogenic cells of the mutants do not have adult characteristics.

To evaluate the steroidogenic capacities of the remaining FLC in Nr2f2 mutant gonads, we analyzed the transcript levels of Cyp11a1 and Cyp17a1 normalized to the FLC number as quantified by HSD3B immunofluorescence (Figure 2N, Figure 3M; Kothandapani et al., 2020). Normalized data showed reduced steroidogenic gene expression in Nr5a1-Cre; Nr2f2^flox/flox and in Wt1^CreERT2; Nr2f2^flox/flox mutant testes (Figure 5A and B), in agreement with the reduced HSD3B expression levels detected by immunofluorescence in Nr2f2 mutant testes (Figures 2J–M–3I–L). These observations suggest that FLC formed in the mutant testes have reduced steroidogenic function.

Figure 5 with 1 supplement see all

Download asset Open asset

NR2F2 function is required for fetal Leydig cell (FLC) maturation.

(A) RT-qPCR quantification of *Cyp11a1* and *Cyp17a1* transcripts in control (wild-type or *Nr2f2^flox/+*) and *Nr5a1-Cre; Nr2f2^flox/flox* testes after normalization to *Sdha* and *Tbp* and to the number of FLC as quantified by HSD3B immunofluorescence at embryonic day 14.5 (E14.5). Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (B) RT-qPCR quantification of *Cyp11a1* and *Cyp17a1* transcripts in *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* gonads after normalization to *Sdha* and *Tbp* and to the number of FLC as quantified by HSD3B immunofluorescence at E14.5. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (**C,D**) Immunodetection of HSD3B on E14.5 XY *Nr2f2^flox/+* and *Nr5a1-Cre; Nr2f2^flox/flox* testes. (**E,F**) Immunodetection of HSD3B on E14.5 XY *Nr2f2^flox/+* and *Wt1^CreERT2; Nr2f2^flox/flox* testes after tamoxifen was administered at E9.5 and E10.5. (G) Quantification of the area and circularity of HSD3B positive cells in two E14.5 control (wild-type or *Nr2f2^flox/+,* 737 cells, gray violin plot) and three *Nr5a1-Cre; Nr2f2^flox/flox* (486 cells, red violin plot) testes. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (H) Quantification of the area and circularity of HSD3B positive cells in three E14.5 control (wild-type or *Nr2f2^flox/+,* 1485 cells, gray violin plot) and three *Wt1^CreERT2; Nr2f2^flox/flox* (474 cells, blue violin plot) testes. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05. (I) Summary figure: NR2F2 is expressed in spindle-shaped interstitial steroidogenic progenitors together with ARX and is progressively downregulated upon FLC differentiation. NR2F2 is required for the initiation of FLC differentiation (marked by the upregulation of NR5A1) and for FLC maturation (characterized by the increase in cytoplasmic volume and the high expression of steroidogenic enzymes and *Insl3*). Immunodetection data are representative of triplicate biological replicates. Scale bar = 10 µm.

Figure 5—source data 1 Source data for cell measurements and RT-qPCR data in Figure 5.: https://cdn.elifesciences.org/articles/103783/elife-103783-fig5-data1-v1.xlsx
Download elife-103783-fig5-data1-v1.xlsx

FLC differentiation is accompanied by a change in cell shape from spindle-shaped progenitors to round-shaped FLC and an increase in cytoplasmic volume (van den Driesche et al., 2012; Haider, 2004). HSD3B positive FLC present in Nr5a1-Cre; Nr2f2^flox/flox and in Wt1^CreERT2; Nr2f2^flox/flox mutants were smaller and more elongated than those in control littermates (Figure 5C–H, Figure 5—figure supplement 1). These cellular characteristics have been associated with immature FLC at the initial stages of FLC differentiation before the formation of large and round testosterone-producing FLC (van den Driesche et al., 2012; Haider, 2004).

Taken together, our results show that NR2F2 is required in interstitial steroidogenic progenitor cells for initiation of FLC differentiation but also for the subsequent step of FLC maturation leading to robust steroid production (Figure 5I).

Discussion

NR2F2 protein is expressed in interstitial cells of coelomic epithelium and mesonephric origin and is absent or detected at very low levels in FLC as soon as they are formed at E12.5. Our observations are consistent with NR2F2 positive cells being progenitors for FLC (Inoue et al., 2016; Ademi et al., 2022; Estermann et al., 2025) and indicate that NR2F2 is quickly downregulated upon differentiation of the fetal steroidogenic lineage, when the cells begin to synthesize steroid hormones.

We used two Cre lines to address the role of NR2F2 in the mouse fetal testis. Nr2f2 mutants exhibit reduced FLC numbers together with a strong reduction in Insl3 and steroidogenic gene expression, resulting in cryptorchidism and reduced anogenital distance. Importantly, the reduction of Insl3 expression is sufficient to impair testis descent even when a fraction of FLC is still present. Our findings identify NR2F2 as an essential regulator of FLC and male reproductive system development in the mouse. This conclusion is confirmed by an independent Nr2f2 conditional mutation resulting in a similar phenotype of FLC hypoplasia, cryptorchidism, and hypospadias (Estermann et al., 2025).

Nr2f2 deletion using Nr5a1-Cre does not impair the survival or proliferation of the interstitial steroidogenic progenitor population, yet the FLC population is reduced in Nr5a1-Cre; Nr2f2^flox/flox mutant testes. We found that the expression of the master regulator of steroidogenic differentiation of NR5A1 is not upregulated in Nr2f2 mutants, which is sufficient to account for the decrease in FLC numbers (Morohashi et al., 2020; Baba et al., 2018; Baba et al., 2014; Shima et al., 2018). ChIP-seq analysis of whole E14.5 testes has identified NR2F2 binding peaks in the regulatory region of Nr5a1 (Estermann et al., 2025). In addition, NR2F2 regulates gene expression by directly interacting with NR5A1 in MA-10 cells, an in vitro model for immature ALCs (Mendoza-Villarroel et al., 2014b; Mendoza-Villarroel et al., 2014a; Di-Luoffo et al., 2022). It would be interesting to explore whether an interaction between NR2F2 and NR5A1 contributes to the strong upregulation of Nr5a1 itself in differentiating FLCs and/or whether NR2F2 cooperates with other factors for the regulation of Nr5a1.

The activity of the main paracrine pathways regulating FLC differentiation was not significantly altered in Nr5a1-Cre; Nr2f2^flox/flox mutant testes, as shown by the expression of target genes of the DHH, PDGFRA, and NOTCH signaling. These observations indicate that NR2F2 is a permissive factor in steroidogenic progenitors acting downstream or in cooperation with the signaling pathways regulating FLC differentiation. NR2F2 expression has been found to be modulated by Hedgehog and/or NOTCH signaling in other cell types, and whether a similar regulation of Nr2f2 expression by DHH and NOTCH signaling occurs in the steroidogenic progenitors remains unknown (Lee et al., 2006; Swift et al., 2014).

A fraction of FLC differentiates in Nr2f2 mutants, including when progenitors of both coelomic epithelium and mesonephric origins are targeted. This observation indicates that additional factors cooperate with NR2F2 to regulate the transition from the steroidogenic progenitor state to the differentiating FLC. The homeodomain protein ARX is expressed in Nr2f2 mutant steroidogenic progenitors and is a good candidate to be such a factor. Arx mutants exhibit decreased FLC numbers without defects in paracrine signals driving their differentiation, similar to Nr2f2 mutants (Miyabayashi et al., 2013).

FLC and ALC are morphologically, transcriptionally, and functionally distinct (Shima, 2019; Sararols et al., 2021), yet NR2F2 function is required for the differentiation of both lineages. In contrast to the situation in the fetal testis, NR2F2 is maintained in cells that have started to express steroidogenesis genes in the postnatal testis (Inoue et al., 2016; Ademi et al., 2022; Mendoza-Villarroel et al., 2014b). NR2F2 regulates the transition from the adult progenitor Leydig cell (characterized by their elongated shape, their ability to proliferate, and a low level of testosterone synthesis) to the immature ALC (characterized by their round shape, low mitotic activity, and increased testosterone production) (Qin et al., 2008; Haider, 2004). In agreement with its in vivo role promoting maturation along the ALC lineage, NR2F2 cooperates with NR5A1 and GATA4 to activate the transcription of Insl3, Star (encoding the cholesterol transporter), and Amhr2 (Mendoza-Villarroel et al., 2014b; Mendoza-Villarroel et al., 2014a; Di-Luoffo et al., 2022; Mehanovic et al., 2021; Mehanovic et al., 2022) in MA-10 cells.

Here, we found that the steroidogenic cells that differentiate in Nr2f2 mutant fetal testes exhibit a small size, an elongated shape, and reduced steroidogenic gene expression, features of the earliest stages of FLC differentiation (Wen et al., 2016; van den Driesche et al., 2012; Haider, 2004). A similar phenotype is obtained when Nr5a1 is deleted after the onset of FLC differentiation (Buaas et al., 2012). This suggests that in addition to controlling the initial engagement of steroidogenic progenitors into the FLC lineage and similar to the situation in the postnatal testis, NR2F2 promotes FLC maturation possibly by directly regulating the initial expression of genes involved in steroidogenesis. In agreement with this hypothesis, NR2F2 binding peaks are found in the regulatory regions of genes involved in lipid metabolism and cholesterol biosynthesis in ChIP-seq analysis of whole E14.5 testes (Estermann et al., 2025).

NR2F2 is required for additional aspects of fetal testis morphogenesis and differentiation. Testis cords are enlarged and abnormally shaped in Nr2f2 mutants. Testis cord development involves the formation of Sertoli-germ cell masses after E11.5 and their subsequent partition by growing wedges of interstitial cells and associated vascular branches at E12.5 (Cool et al., 2012). How NR2F2-dependent regulation of interstitial cell adhesion or migration contributes to this process will be the aim of future research.

Pathogenic variants in NR2F2 have been associated with congenital malformations, including congenital heart disease, congenital diaphragmatic hernia, and syndromic 46,XX testicular or ovo-testicular difference/disorder in sex development (DSD) (Polvani et al., 2019; Bashamboo et al., 2018). More recently, defects in the external genitalia (micropenis, hypospadias) and cryptorchidism have been associated with rare heterozygous variants in NR2F2 in 46,XY patients (Zidoune et al., 2022; Ganapathi et al., 2023; Wankanit et al., 2024). These phenotypes can be attributed to defects in testosterone-dependent masculinization and INSL3-dependent testis descent during gestation and could be explained by a failure of FLC differentiation in the fetal testis. NR2F2 is abundantly expressed in interstitial cells of fetal human testes, a population that likely contains the progenitors for FLC (Kilcoyne et al., 2014; van den Driesche et al., 2012; Lottrup et al., 2014; Taelman et al., 2024). The present work demonstrating that NR2F2 is required in the steroidogenic progenitors of the murine fetal testis for the initiation and progression of FLC differentiation provides an entry point in understanding the etiology of 46,XY DSD associated with pathogenic NR2F2 variants.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Mus musculus)	Nr2f2	MGI	MGI:1352452
Genetic reagent (Mus musculus)	Nr2f2^tm1Vc	Dr. M. Vasseur-Cognet	MGI:3578106
Genetic reagent (Mus musculus)	Wt1^{tm2(cre/ERT2)Wtp}	Dr. William T Pu	MGI:7528785
Genetic reagent (Mus musculus)	Tg(Nr5a1-cre)2Klp	Dr. Keith L Parker	MGI:5493455
Chemical compound	Tamoxifen	Sigma-Aldrich	T5648	200 mg/kg body weight
Chemical compound	5-Bromo-2'-deoxy-uridine	Sigma-Aldrich	B5002	50 mg/kg body weight
Chemical compound	Paraformaldehyde	EMS	15710-S	4% in PBS
Antibody	Anti-ACTA2 (Mouse monoclonal)	Gift from Dr. Chaponnier		IF (1:500)
Antibody	Anti- Activated Caspase 3 (Rabbit polyclonal)	R&D Systems	AF835 (RRID:AB_2243952)	IF (1:200)
Antibody	Anti- AMH (Mouse monoclonal)	Bio-Rad	MCA2246 (RRID:AB_2226471)	IF (1:50)
Antibody	Anti- ARX (Rabbit polyclonal)	Gift from Pr. Morohashi and Dr. Inoue		IF (1:200)
Antibody	Anti-COL4A1 (Rabbit polyclonal)	Abcam	ab19808 (RRID:AB_445160)	IF (1:400)
Antibody	Anti-CYP11A1 (Rabbit polyclonal)	Gift from Dr. Wilhelm		IF (1:200)
Antibody	Anti-GATA4 (Goat polyclonal)	Santa Cruz Biotechnology	Sc-1237 (RRID:AB_2108747)	IF (1:200)
Antibody	Anti-GFP (Chicken polyclonal)	Abcam	Ab13970 (RRID:AB_300798)	IF (1:200)
Antibody	Anti-HSD3B (Goat polyclonal)	Santa Cruz Biotechnology	Sc-30820 (RRID:AB_2279878)	IF (1:200)
Antibody	Anti-HSD3B (Rabbit polyclonal)	Invitrogen	PA5-76669 (RRID:AB_2720396)	IF (1:500)
Antibody	Anti-Ki67 (Rabbit monoclonal)	Spring Bioscience	M3062 (RRID:AB_11219741)	IF (1:200)
Antibody	Anti-LAMA1 (Rabbit polyclonal)	Sigma-Aldrich	L9393 (RRID:AB_477163)	IF (1:200)
Antibody	Anti-NESTIN (Rabbit)	BioLegend	839801 (RRID:AB_2565443)	IF (1:1000)
Antibody	Anti-NR2F2 (Mouse monoclonal)	R&D Systems	PP-H7147-00 (RRID:AB_2155627)	IF (1:200)
Antibody	Anti-NR5A1 (Rabbit polyclonal)	Cosmo Bio	KO611(RRID:AB_2861370)	IF (1:200)
Antibody	Anti-PDGFRA (Rabbit polyclonal)	Santa Cruz Biotechnology	SC-338 (RRID:AB_631064)	IF (1:200)
Antibody	Anti-PECAM-1 (Goat polyclonal)	Santa Cruz Biotechnology	Sc-1506 (RRID:AB_2161037)	IF (1:200)
Antibody	Anti-RUNX1 (Rabbit monoclonal)	Abcam	ab92336 (RRID:AB_2049267)	IF (1:500)
Antibody	Anti-SOX9 (Rabbit polyclonal)	Sigma-Aldrich	HPA001758 (RRID:AB_1080067)	IF (1:250)
Antibody	Anti-WT1 (Goat polyclonal)	R&D Systems	AF5729 (RRID:AB_2216239)	IF (1:200)
Commercial assay or kit	BrdU detection kit	Roche	11 296 736 001
Commercial assay or kit	RNAscope Multiplex Fluorescent Reagent Kit v2	Bio-Techne	323110
Sequence-based reagent	Gli1 probe	Bio-Techne	311001
Commercial assay or kit	RNeasy Micro Kit	QIAGEN	74004
Commercial assay or kit	SYBR Green I Master	Roche	04887352001
Software, algorithm	RefFinder	https://www.ciidirsinaloa.com.mx/RefFinder-master/?type=reference
Software, algorithm	OMERO	https://www.openmicroscopy.org/omero/
Software, algorithm	GraphPad Prism	Graphpad Software, Inc, La Jolla, CA, USA	GraphPad Prism 10.2.1

Mouse strains and genotyping

Request a detailed protocol

The experiments described herein were carried out in compliance with the guidelines of the French Regulations for Animal Care and with the approval of the local Ethical Committee (APAFIS APAFIS#12789-2017121515109323 v1 and APAFIS#44072-2023061915491990 v5). Mouse lines were kept on a mixed background B6CBAF1/JRj. The Nr2f2^tm1Vc line where Nr2f2 exon 1 sequences (encoding the DNA binding domain) are deleted upon CRE-mediated recombination (referred to as Nr2f2^flox), the knock-in Wt1^{tm2(cre/ERT2)Wtp} line where tamoxifen-inducible Cre^ERT2 is produced by WT1 expressing cells (referred to as Wt1^CreERT2), and the transgenic Tg(Nr5a1-cre)2Klp line where Cre expression is driven by Nr5a1 regulatory sequences (referred to as Nr5a1-Cre) were genotyped as previously described (Bardoux et al., 2005; Zhou et al., 2008; Bingham et al., 2006). Wt1^CreERT2; Nr2f2^flox/+ or Nr5a1-Cre^tg/0; Nr2f2^flox/+ males were crossed with Nr2f2^flox/+ females to obtain mutant embryos at different stages. Embryos were named controls (Nr2f2^+/+ or Nr2f2^flox/+) or mutants (Wt1^CreERT2; Nr2f2^flox/flox or Nr5a1-Cre^tg/0; Nr2f2^flox/flox). Genotypes of mice and embryos were determined using PCR assays on lysates from ear biopsies or tail tips. Genotyping primers are listed in Appendix 1. To activate the Cre^ERT2 recombinase in embryos, tamoxifen (TAM, T5648, Sigma-Aldrich) was directly diluted in corn oil to a concentration of 40 mg/mL, and two TAM treatments (200 mg/kg body weight) were administered to pregnant females by oral gavage at E9.5 and E10.5. For proliferation assays, 5-bromo-2'-deoxy-uridine (BrdU) (B5002, Sigma-Aldrich) diluted to a concentration of 10 mg/mL in sterile H₂O was administered to the pregnant females (50 mg/kg body weight) by intraperitoneal injection, and pregnant females and their embryos were humanely killed after 3 hr and 30 min. The day when a vaginal plug was found was designated as E0.5. E11.5–E12.5 embryos were staged by counting the number of ts with 18 ts corresponding to E11.5.

Immunofluorescence staining and in situ hybridization

Request a detailed protocol

Embryos were fixed in 4% (wt/vol) paraformaldehyde (PFA, 15,710-S, EMS) overnight, processed for paraffin embedding, and sectioned into 5-µm-thick sections. Immunofluorescence and DAPI staining were performed as described in Tang et al., 2020. Proliferation analysis was performed by using a BrdU detection kit (11 296 736 001, Roche). Gli1 mRNA was detected with the RNAscope technology (probe 311001) according to Advanced Cell’s instructions using the RNAscope Multiplex Fluorescent Reagent Kit v2 Assay. Images were obtained on a motorized Axio Imager Z1 microscope (Zeiss) coupled with an AxioCam MRm camera (Zeiss) and processed with Fiji (Bethesda, MD, USA). The DAPI staining marking the nuclei was adjusted to visualize the tissues and may vary between samples. However, for the immunofluorescence analysis, the exposure time of the acquisition of the fluorescent signal was identical in the same experiment to allow comparison between controls and mutants. Images were assembled using the open-source software platform OMERO (https://www.openmicroscopy.org/omero/). Antibodies are listed in the Key resources table. At least three embryos of each genotype were analyzed for each marker.

Cell quantifications

Request a detailed protocol

The gonadal area for each section was measured by creating a gonadal region of interest (ROI) drawn manually in Fiji. The number of HSD3B positive cells (2–493 cells per section depending on the stages and genotypes), SOX9 positive cells (231–882 cells per section depending on the stages and genotypes), NR5A1 positive cells (3–256 cells per section depending on the stages and genotypes), ARX positive cells (666–2487 cells per section depending on the stages and genotypes), ARX positive cells that had incorporated BrdU (232–656 cells per section depending on the stages and genotypes), activated caspase 3 positive cells (0–6 cells per section depending on the stages and genotypes), or the number of nuclei labeled by DAPI (1582–4279 cells per section depending on the stages and genotypes) were counted manually in the entire gonadal section using the Cell Counter Plugin from Fiji. For each genotype, gonads of three or four biological replicates were analyzed. Two to three coronal sections spaced by at least 30 µm in the medial regions of the gonads were analyzed for each individual. Statistical significance was assessed by Mann-Whitney U two-tailed test. * indicates p-value≤0.05; ns indicates p-value>0.05.

Quantification of area and circularity of HSD3B positive cells

Request a detailed protocol

Gonadal (ROI) was drawn manually, and HSD3B positive cells were segmented using the Stardist Deep Learning plugin of Fiji with a minimum area of 20 µm² to remove small particles. The area and circularity of each segmented cell were measured with Fiji. Circularity = 4π*area/perimeter^2. A value of 1.0 indicates a perfect circle. As the value approaches 0.0, it indicates an increasingly elongated shape. For each genotype, two to three biological replicates were analyzed. The data are shown as violin plots (with median and quartiles) for control and mutant samples.

RNA extraction and quantitative PCR analysis

Request a detailed protocol

Individual gonads were dissected from the mesonephros in PBS, snap-frozen in liquid nitrogen, and kept at −80°C. RNA was extracted by RNeasy Micro Kit (74004, QIAGEN) and reverse-transcribed by M-MLV reverse transcriptase (M170A, Promega). The cDNA was used as a template for quantitative PCR analysis using the SYBR Green I Master (04887352001, Roche) and a LightCycler 480 System (Roche). Primer sequences are listed in Appendix 1.

All biological replicates of different genotypes (N=3–9) were run in the same plate and run as duplicate technical replicates. Relative gene expression of each gonad was normalized to the expression of the housekeeping genes Shda and Tbp (Yokoyama et al., 2018) by the 2-ΔΔCt calculation method. GeNorm, BestKeeper algorithms, and the comparative delta-Ct method provided through the online tool RefFinder (https://www.ciidirsinaloa.com.mx/RefFinder-master/?type=reference#) were used to confirm reference gene stability in the experimental datasets. Fold change in gene expression was obtained by dividing the normalized gene expression in gonads of a given genotype by the mean of the normalized gene expression in control gonads. Data are shown as means ± SEM. Statistical significance was assessed by Mann-Whitney U two-tailed test (GraphPad Prism 10.2.1). * indicates p-value≤0.05; ns indicates p-value>0.05.

Appendix 1

Primers

Primer name	Application	Sequence (5’-3’)
CRE 1	Genotyping Cre	CAGGATATACGTAATCTGGC
CRE 4	Genotyping Cre	CACGGGCACTGTGTCCAGACCAG
CCR5mR	Genotyping internal control	ATGTGGATGGAGAGGAGTCG
CCR5mL	Genotyping internal control	CAACCGAGACCTTCCTGTTC
TF2.1	Genotyping Nr2f2	TGCCCACACTTTCCTACTCC
TF2.5	Genotyping Nr2f2	TTTCTGCAAGGAATGGGTTG
Amh-Fwd	RT-qPCR primers	GGGGAGACTGGAGAACAGC
Amh-Rev	RT-qPCR primers	AGAGCTCGGGCTCCCATA
Arx-Fwd	RT-qPCR primers	GCACCACGTTCACCAGTTAC
Arx-Rev	RT-qPCR primers	GCACCACGTTCACCAGTTAC
Bhmt-Fwd	RT-qPCR primers	CGTCAGCTTCATCGGGAGTT
Bhmt-Rev	RT-qPCR primers	CTTGCCGTGCAATGTCACAA
Cdh5-Fwd	RT-qPCR primers	TCCTCTGCATCCTCACCATCACA
Cdh5-Rev	RT-qPCR primers	GTAAGTGACCAACTGCTCGTGAAT
Cyp11a1-Fwd	RT-qPCR primers	TGGCCCCATTTACAGGGAGAA
Cyp11a1-Rev	RT-qPCR primers	GGCATCTGAACTCTTAAACAGGA
Cyp17a1-Rev	RT-qPCR primers	CAGAGAAGTGCTCGTGAAGAAG
Cyp17a1Fwd	RT-qPCR primers	CAGAGAAGTGCTCGTGAAGAAG
Dhh-Fwd	RT-qPCR primers	GGACCTCGTACCCAACTACAA
Dhh-Rev	RT-qPCR primers	CGATGGCTAGAGCGTTCACC
Gli1-Fwd	RT-qPCR primers	TGGTACCATGAGCCCTTCTT
Gli1-Rev	RT-qPCR primers	GTGGTACACAGGGCTGGACT
Hes1-Fwd	RT-qPCR primers	ATAGCTCCCGGCATTCCAAG
Hes1-Rev	RT-qPCR primers	ATAGCTCCCGGCATTCCAAG
HeyL-Fwd	RT-qPCR primers	CAGCCCTTCGCAGATGCAA
HeyL-Rev	RT-qPCR primers	CCAATCGTCGCAATTCAGAAAG
Insl3-Fwd	RT-qPCR primers	ATTGCTCCCCACCTCCTGGCTATG
Insl3-Rev	RT-qPCR primers	GGTCATGATGGGGCTTCTTGGGGA
Notch2-Fwd	RT-qPCR primers	ATATCGACGACTGCCCCAAC
Notch2-Rev	RT-qPCR primers	CCATAGCCTCCGTTTCGGTT
Nr2f2-Fwd	RT-qPCR primers	CGGAGGAACCTGAGCTACAC
Nr2f2-Rev	RT-qPCR primers	CGGAGGAACCTGAGCTACAC
Pdgfa-Fwd	RT-qPCR primers	CAGTGTCAAGGTGGCCAAAGT
Pdgfa-Rev	RT-qPCR primers	CAGTGTCAAGGTGGCCAAAGT
Pdgfb-Fwd	RT-qPCR primers	GATCTCTCGGAACCTCATCG
Pdgfb-Rev	RT-qPCR primers	GATCTCTCGGAACCTCATCG
Pdgfra-Fwd	RT-qPCR primers	TCCATGCTAGACTCAGAAGTCA
Pdgfra-Rev	RT-qPCR primers	TCCCGGTGGACACAATTTTT
Sdha-Fwd	RT-qPCR primers	TGTTCAGTTCCACCCCACA
Sdha-Rev	RT-qPCR primers	TCTCCACGACACCCTTCTG
Sgpl1-Fwd	RT-qPCR primers	CTGAAGGACTTCGAGCCTTATTT
Sgpl1-Rev	RT-qPCR primers	CTGAAGGACTTCGAGCCTTATTT
Sox9-Fwd	RT-qPCR primers	GCGGAGCTCAGCAAGACTCTG
Sox9-Rev	RT-qPCR primers	ATCGGGGTGGTCTTTCTTGTG
Tbp-Fwd	RT-qPCR primers	GCTCTGGAATTGTACCGCAG
Tbp-Rev	RT-qPCR primers	TGACTGCAGCAAATCGCTTG

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

1. Ademi H
2. Djari C
3. Mayère C
4. Neirijnck Y
5. Sararols P
6. Rands CM
7. Stévant I
8. Conne B
9. Nef S
(2022) Deciphering the origins and fates of steroidogenic lineages in the mouse testis
Cell Reports 39:110935.

https://doi.org/10.1016/j.celrep.2022.110935
- PubMed
- Google Scholar
1. Amato CM
2. Yao HHC
3. Zhao F
(2022) One tool for many jobs: Divergent and conserved actions of androgen signaling in male internal reproductive tract and external genitalia
Frontiers in Endocrinology 13:910964.

https://doi.org/10.3389/fendo.2022.910964
- PubMed
- Google Scholar
(1993) The expression of the Wilms’ tumour gene, WT1, in the developing mammalian embryo
Mechanisms of Development 40:85–97.

https://doi.org/10.1016/0925-4773(93)90090-k
- PubMed
- Google Scholar
1. Baba T
2. Otake H
3. Sato T
4. Miyabayashi K
5. Shishido Y
6. Wang C-Y
7. Shima Y
8. Kimura H
9. Yagi M
10. Ishihara Y
11. Hino S
12. Ogawa H
13. Nakao M
14. Yamazaki T
15. Kang D
16. Ohkawa Y
17. Suyama M
18. Chung B-C
19. Morohashi K-I
(2014) Glycolytic genes are targets of the nuclear receptor Ad4BP/SF-1
Nature Communications 5:3634.

https://doi.org/10.1038/ncomms4634
- PubMed
- Google Scholar
1. Baba T
2. Otake H
3. Inoue M
4. Sato T
5. Ishihara Y
6. Moon J-Y
7. Tsuchiya M
8. Miyabayashi K
9. Ogawa H
10. Shima Y
11. Wang L
12. Sato R
13. Yamazaki T
14. Suyama M
15. Nomura M
16. Choi MH
17. Ohkawa Y
18. Morohashi K-I
(2018) Ad4BP/SF-1 regulates cholesterol synthesis to boost the production of steroids
Communications Biology 1:18.

https://doi.org/10.1038/s42003-018-0020-z
- PubMed
- Google Scholar
1. Bardoux P
2. Zhang P
3. Flamez D
4. Perilhou A
5. Lavin TA
6. Tanti J-F
7. Hellemans K
8. Gomas E
9. Godard C
10. Andreelli F
11. Buccheri MA
12. Kahn A
13. Le Marchand-Brustel Y
14. Burcelin R
15. Schuit F
16. Vasseur-Cognet M
(2005) Essential role of chicken ovalbumin upstream promoter-transcription factor II in insulin secretion and insulin sensitivity revealed by conditional gene knockout
Diabetes 54:1357–1363.

https://doi.org/10.2337/diabetes.54.5.1357
- PubMed
- Google Scholar
(2009) Activation of the Hedgehog pathway in the mouse fetal ovary leads to ectopic appearance of fetal Leydig cells and female pseudohermaphroditism
Developmental Biology 329:96–103.

https://doi.org/10.1016/j.ydbio.2009.02.025
- PubMed
- Google Scholar
1. Barsoum I
2. Yao HHC
(2011) Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells
Biology of Reproduction 84:894–899.

https://doi.org/10.1095/biolreprod.110.088997
- PubMed
- Google Scholar
(2018) Loss of function of the nuclear receptor NR2F2, encoding COUP-TF2, causes testis development and cardiac defects in 46,XX children
American Journal of Human Genetics 102:487–493.

https://doi.org/10.1016/j.ajhg.2018.01.021
- PubMed
- Google Scholar
(2007) GATA-4 is required for sex steroidogenic cell development in the fetal mouse
Developmental Dynamics 236:203–213.

https://doi.org/10.1002/dvdy.21004
- PubMed
- Google Scholar
(2006) Development of a steroidogenic factor 1/Cre transgenic mouse line
Genesis 44:419–424.

https://doi.org/10.1002/dvg.20231
- PubMed
- Google Scholar
(2003) Pdgfr-alpha mediates testis cord organization and fetal Leydig cell development in the XY gonad
Genes & Development 17:800–810.

https://doi.org/10.1101/gad.1052503
- PubMed
- Google Scholar
1. Buaas FW
2. Gardiner JR
3. Clayton S
4. Val P
5. Swain A
(2012) In vivo evidence for the crucial role of SF1 in steroid-producing cells of the testis, ovary and adrenal gland
Development 139:4561–4570.

https://doi.org/10.1242/dev.087247
- PubMed
- Google Scholar
1. Carré G-A
2. Siggers P
3. Xipolita M
4. Brindle P
5. Lutz B
6. Wells S
7. Greenfield A
(2018) Loss of p300 and CBP disrupts histone acetylation at the mouse Sry promoter and causes XY gonadal sex reversal
Human Molecular Genetics 27:190–198.

https://doi.org/10.1093/hmg/ddx398
- PubMed
- Google Scholar
(2000) Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules
Biology of Reproduction 63:1825–1838.

https://doi.org/10.1095/biolreprod63.6.1825
- PubMed
- Google Scholar
1. Cool J
2. DeFalco T
3. Capel B
(2012) Testis formation in the fetal mouse: dynamic and complex de novo tubulogenesis
Wiley Interdisciplinary Reviews. Developmental Biology 1:847–859.

https://doi.org/10.1002/wdev.62
- PubMed
- Google Scholar
1. Cui S
2. Ross A
3. Stallings N
4. Parker KL
5. Capel B
6. Quaggin SE
(2004) Disrupted gonadogenesis and male-to-female sex reversal in Pod1 knockout mice
Development 131:4095–4105.

https://doi.org/10.1242/dev.01266
- PubMed
- Google Scholar
(2011) Two distinct origins for Leydig cell progenitors in the fetal testis
Developmental Biology 352:14–26.

https://doi.org/10.1016/j.ydbio.2011.01.011
- PubMed
- Google Scholar
(2013) Testosterone levels influence mouse fetal Leydig cell progenitors through notch signaling
Biology of Reproduction 88:91.

https://doi.org/10.1095/biolreprod.112.106138
- PubMed
- Google Scholar
(2022) The nuclear receptors SF1 and COUP-TFII cooperate on the Insl3 promoter in Leydig cells
Reproduction 164:31–40.

https://doi.org/10.1530/REP-22-0109
- PubMed
- Google Scholar
1. Estermann MA
2. Grimm SA
3. Kitakule AS
4. Rodriguez KF
5. Brown PR
6. McClelland K
7. Amato CM
8. Yao HH-C
(2025) NR2F2 regulation of interstitial cell fate in the embryonic mouse testis and its impact on differences of sex development
Nature Communications 16:3987.

https://doi.org/10.1038/s41467-025-59183-6
- PubMed
- Google Scholar
1. Ganapathi M
2. Matsuoka LS
3. March M
4. Li D
5. Brokamp E
6. Benito-Sanz S
7. White SM
8. Lachlan K
9. Ahimaz P
10. Sewda A
11. Bastarache L
12. Thomas-Wilson A
13. Stoler JM
14. Bramswig NC
15. Baptista J
16. Stals K
17. Demurger F
18. Cogne B
19. Isidor B
20. Bedeschi MF
21. Peron A
22. Amiel J
23. Zackai E
24. Schacht JP
25. Iglesias AD
26. Morton J
27. Schmetz A
28. Undiagnosed Diseases Network
29. Seidel V
30. Lucia S
31. Baskin SM
32. Thiffault I
33. Cogan JD
34. Gordon CT
35. Chung WK
36. Bowdin S
37. Bhoj E
(2023) Heterozygous rare variants in NR2F2 cause a recognizable multiple congenital anomaly syndrome with developmental delays
European Journal of Human Genetics 31:1117–1124.

https://doi.org/10.1038/s41431-023-01434-5
- PubMed
- Google Scholar
1. Gao F
2. Maiti S
3. Alam N
4. Zhang Z
5. Deng JM
6. Behringer RR
7. Lécureuil C
8. Guillou F
9. Huff V
(2006) The Wilms tumor gene, Wt1, is required for Sox9 expression and maintenance of tubular architecture in the developing testis
PNAS 103:11987–11992.

https://doi.org/10.1073/pnas.0600994103
- PubMed
- Google Scholar
1. Haider SG
(2004) Cell biology of Leydig cells in the testis
International Review of Cytology 233:181–241.

https://doi.org/10.1016/S0074-7696(04)33005-6
- PubMed
- Google Scholar
(2015) Regulation of testicular descent
Pediatric Surgery International 31:317–325.

https://doi.org/10.1007/s00383-015-3673-4
- PubMed
- Google Scholar
1. Inoue M
2. Shima Y
3. Miyabayashi K
4. Tokunaga K
5. Sato T
6. Baba T
7. Ohkawa Y
8. Akiyama H
9. Suyama M
10. Morohashi K
(2016) Isolation and characterization of fetal leydig progenitor cells of male mice
Endocrinology 157:1222–1233.

https://doi.org/10.1210/en.2015-1773
- PubMed
- Google Scholar
1. Inoue M
2. Baba T
3. Takahashi F
4. Terao M
5. Yanai S
6. Shima Y
7. Saito D
8. Sugihara K
9. Miura T
10. Takada S
11. Suyama M
12. Ohkawa Y
13. Morohashi K-I
(2022) Tmsb10 triggers fetal Leydig differentiation by suppressing the RAS/ERK pathway
Communications Biology 5:974.

https://doi.org/10.1038/s42003-022-03941-5
- PubMed
- Google Scholar
1. Jeyasuria P
2. Ikeda Y
3. Jamin SP
4. Zhao L
5. De Rooij DG
6. Themmen APN
7. Behringer RR
8. Parker KL
(2004) Cell-specific knockout of steroidogenic factor 1 reveals its essential roles in gonadal function
Molecular Endocrinology 18:1610–1619.

https://doi.org/10.1210/me.2003-0404
- PubMed
- Google Scholar
1. Karl J
2. Capel B
(1998) Sertoli cells of the mouse testis originate from the coelomic epithelium
Developmental Biology 203:323–333.

https://doi.org/10.1006/dbio.1998.9068
- PubMed
- Google Scholar
(2014) Fetal programming of adult Leydig cell function by androgenic effects on stem/progenitor cells
PNAS 111:E1924–E1932.

https://doi.org/10.1073/pnas.1320735111
- PubMed
- Google Scholar
1. Kothandapani A
2. Lewis SR
3. Noel JL
4. Zacharski A
5. Krellwitz K
6. Baines A
7. Winske S
8. Vezina CM
9. Kaftanovskaya EM
10. Agoulnik AI
11. Merton EM
12. Cohn MJ
13. Jorgensen JS
(2020) GLI3 resides at the intersection of hedgehog and androgen action to promote male sex differentiation
PLOS Genetics 16:e1008810.

https://doi.org/10.1371/journal.pgen.1008810
- PubMed
- Google Scholar
1. Kumar DL
2. DeFalco T
(2018) A perivascular niche for multipotent progenitors in the fetal testis
Nature Communications 9:4519.

https://doi.org/10.1038/s41467-018-06996-3
- PubMed
- Google Scholar
1. Lee K
2. Jeong J
3. Kwak I
4. Yu C-T
5. Lanske B
6. Soegiarto DW
7. Toftgard R
8. Tsai M-J
9. Tsai S
10. Lydon JP
11. DeMayo FJ
(2006) Indian hedgehog is a major mediator of progesterone signaling in the mouse uterus
Nature Genetics 38:1204–1209.

https://doi.org/10.1038/ng1874
- PubMed
- Google Scholar
1. Li S-Y
2. Gu X
3. Heinrich A
4. Hurley EG
5. Capel B
6. DeFalco T
(2021) Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesis†
Biology of Reproduction 105:958–975.

https://doi.org/10.1093/biolre/ioab098
- PubMed
- Google Scholar
(2016) Mapping lineage progression of somatic progenitor cells in the mouse fetal testis
Development 143:3700–3710.

https://doi.org/10.1242/dev.135756
- PubMed
- Google Scholar
(2014) Expression patterns of DLK1 and INSL3 identify stages of Leydig cell differentiation during normal development and in testicular pathologies, including testicular cancer and Klinefelter syndrome
Human Reproduction 29:1637–1650.

https://doi.org/10.1093/humrep/deu124
- PubMed
- Google Scholar
(2008) Ovarian development in mice requires the GATA4-FOG2 transcription complex
Development 135:3731–3743.

https://doi.org/10.1242/dev.024653
- PubMed
- Google Scholar
1. Manuylov NL
2. Zhou B
3. Ma Q
4. Fox SC
5. Pu WT
6. Tevosian SG
(2011) Conditional ablation of Gata4 and Fog2 genes in mice reveals their distinct roles in mammalian sexual differentiation
Developmental Biology 353:229–241.

https://doi.org/10.1016/j.ydbio.2011.02.032
- PubMed
- Google Scholar
1. Mayère C
2. Regard V
3. Perea-Gomez A
4. Bunce C
5. Neirijnck Y
6. Djari C
7. Bellido-Carreras N
8. Sararols P
9. Reeves R
10. Greenaway S
11. Simon M
12. Siggers P
13. Condrea D
14. Kühne F
15. Gantar I
16. Tang F
17. Stévant I
18. Batti L
19. Ghyselinck NB
20. Wilhelm D
21. Greenfield A
22. Capel B
23. Chaboissier M-C
24. Nef S
(2022) Origin, specification and differentiation of a rare supporting-like lineage in the developing mouse gonad
Science Advances 8:eabm0972.

https://doi.org/10.1126/sciadv.abm0972
- PubMed
- Google Scholar
(2021) Identification of novel genes and pathways regulated by the orphan nuclear receptor COUP-TFII in mouse MA-10 Leydig cells†
Biology of Reproduction 105:1283–1306.

https://doi.org/10.1093/biolre/ioab131
- PubMed
- Google Scholar
(2022) Chicken ovalbumin upstream promoter transcription factor type II interacts and functionally cooperates with GATA4 to regulate anti-Müllerian hormone receptor type 2 transcription in mouse MA-10 Leydig cells
Andrology 10:1411–1425.

https://doi.org/10.1111/andr.13266
- PubMed
- Google Scholar
(2014a) The INSL3 gene is a direct target for the orphan nuclear receptor, COUP-TFII, in Leydig cells
Journal of Molecular Endocrinology 53:43–55.

https://doi.org/10.1530/JME-13-0290
- PubMed
- Google Scholar
(2014b) The nuclear receptor NR2F2 activates star expression and steroidogenesis in mouse MA-10 and MLTC-1 Leydig cells
Biology of Reproduction 91:26.

https://doi.org/10.1095/biolreprod.113.115790
- PubMed
- Google Scholar
1. Miyabayashi K
2. Katoh-Fukui Y
3. Ogawa H
4. Baba T
5. Shima Y
6. Sugiyama N
7. Kitamura K
8. Morohashi K
(2013) Aristaless related homeobox gene, Arx, is implicated in mouse fetal Leydig cell differentiation possibly through expressing in the progenitor cells
PLOS ONE 8:e68050.

https://doi.org/10.1371/journal.pone.0068050
- PubMed
- Google Scholar
1. Miyabayashi K
2. Shima Y
3. Inoue M
4. Sato T
5. Baba T
6. Ohkawa Y
7. Suyama M
8. Morohashi K-I
(2017) Alterations in fetal Leydig cell gene expression during fetal and adult development
Sexual Development 11:53–63.

https://doi.org/10.1159/000453323
- PubMed
- Google Scholar
(2020) Coordination of multiple cellular processes by NR5A1/NR5A1
Endocrinology and Metabolism 35:756–764.

https://doi.org/10.3803/EnM.2020.402
- PubMed
- Google Scholar
1. Nef S
2. Parada LF
(1999) Cryptorchidism in mice mutant for Insl3
Nature Genetics 22:295–299.

https://doi.org/10.1038/10364
- PubMed
- Google Scholar
1. Nicol B
2. Grimm SA
3. Chalmel F
4. Lecluze E
5. Pannetier M
6. Pailhoux E
7. Dupin-De-Beyssat E
8. Guiguen Y
9. Capel B
10. Yao HH-C
(2019) RUNX1 maintains the identity of the fetal ovary through an interplay with FOXL2
Nature Communications 10:5116.

https://doi.org/10.1038/s41467-019-13060-1
- PubMed
- Google Scholar
(2000) Localization of 17beta-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis--androstenedione is the major androgen secreted by fetal/neonatal leydig cells
Endocrinology 141:2631–2637.

https://doi.org/10.1210/endo.141.7.7545
- PubMed
- Google Scholar
1. Padua MB
2. Jiang T
3. Morse DA
4. Fox SC
5. Hatch HM
6. Tevosian SG
(2015) Combined loss of the GATA4 and GATA6 transcription factors in male mice disrupts testicular development and confers adrenal-like function in the testes
Endocrinology 156:1873–1886.

https://doi.org/10.1210/en.2014-1907
- PubMed
- Google Scholar
1. Park HL
2. Bai C
3. Platt KA
4. Matise MP
5. Beeghly A
6. Hui CC
7. Nakashima M
8. Joyner AL
(2000) Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation
Development 127:1593–1605.

https://doi.org/10.1242/dev.127.8.1593
- PubMed
- Google Scholar
1. Pereira FA
2. Qiu Y
3. Zhou G
4. Tsai MJ
5. Tsai SY
(1999) The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development
Genes & Development 13:1037–1049.

https://doi.org/10.1101/gad.13.8.1037
- PubMed
- Google Scholar
(2001) A developmental study of the Desert hedgehog-null mouse testis
Biology of Reproduction 65:1392–1402.

https://doi.org/10.1095/biolreprod65.5.1392
- PubMed
- Google Scholar
1. Polvani S
2. Pepe S
3. Milani S
4. Galli A
(2019) COUP-TFII in health and disease
Cells 9:101.

https://doi.org/10.3390/cells9010101
- PubMed
- Google Scholar
1. Qin J
2. Tsai MJ
3. Tsai SY
(2008) Essential roles of COUP-TFII in Leydig cell differentiation and male fertility
PLOS ONE 3:e3285.

https://doi.org/10.1371/journal.pone.0003285
- PubMed
- Google Scholar
1. Reyes AP
2. León NY
3. Frost ER
4. Harley VR
(2023) Genetic control of typical and atypical sex development
Nature Reviews. Urology 20:434–451.

https://doi.org/10.1038/s41585-023-00754-x
- PubMed
- Google Scholar
(2018) At the crossroads of fate-somatic cell lineage specification in the fetal gonad
Endocrine Reviews 39:739–759.

https://doi.org/10.1210/er.2018-00010
- PubMed
- Google Scholar
1. Sararols P
2. Stévant I
3. Neirijnck Y
4. Rebourcet D
5. Darbey A
6. Curley MK
7. Kühne F
8. Dermitzakis E
9. Smith LB
10. Nef S
(2021) Specific transcriptomic signatures and dual regulation of steroidogenesis between fetal and adult mouse Leydig cells
Frontiers in Cell and Developmental Biology 9:695546.

https://doi.org/10.3389/fcell.2021.695546
- PubMed
- Google Scholar
(2008) The PDGF signaling pathway controls multiple steroid-producing lineages
Genes & Development 22:3255–3267.

https://doi.org/10.1101/gad.1723908
- PubMed
- Google Scholar
(2003) Pbx1 is essential for adrenal development and urogenital differentiation
Genesis 37:123–130.

https://doi.org/10.1002/gene.10235
- PubMed
- Google Scholar
(2019) Anogenital distance as a toxicological or clinical marker for fetal androgen action and risk for reproductive disorders
Archives of Toxicology 93:253–272.

https://doi.org/10.1007/s00204-018-2350-5
- PubMed
- Google Scholar
1. Shima Y
2. Miyabayashi K
3. Haraguchi S
4. Arakawa T
5. Otake H
6. Baba T
7. Matsuzaki S
8. Shishido Y
9. Akiyama H
10. Tachibana T
11. Tsutsui K
12. Morohashi K
(2013) Contribution of Leydig and Sertoli cells to testosterone production in mouse fetal testes
Molecular Endocrinology 27:63–73.

https://doi.org/10.1210/me.2012-1256
- PubMed
- Google Scholar
1. Shima Y
2. Morohashi K
(2017) Leydig progenitor cells in fetal testis
Molecular and Cellular Endocrinology 445:55–64.

https://doi.org/10.1016/j.mce.2016.12.006
- Google Scholar
1. Shima Y
2. Miyabayashi K
3. Sato T
4. Suyama M
5. Ohkawa Y
6. Doi M
7. Okamura H
8. Suzuki K
(2018) Fetal Leydig cells dedifferentiate and serve as adult Leydig stem cells
Development 145:dev169136.

https://doi.org/10.1242/dev.169136
- PubMed
- Google Scholar
1. Shima Y
(2019) Development of fetal and adult Leydig cells
Reproductive Medicine and Biology 18:323–330.

https://doi.org/10.1002/rmb2.12287
- PubMed
- Google Scholar
(2018) Deciphering cell lineage specification during male sex determination with single-cell RNA sequencing
Cell Reports 22:1589–1599.

https://doi.org/10.1016/j.celrep.2018.01.043
- PubMed
- Google Scholar
(2019) Dissecting cell lineage specification and sex fate determination in gonadal somatic cells using single-cell transcriptomics
Cell Reports 26:3272–3283.

https://doi.org/10.1016/j.celrep.2019.02.069
- PubMed
- Google Scholar
1. Swift MR
2. Pham VN
3. Castranova D
4. Bell K
5. Poole RJ
6. Weinstein BM
(2014) SoxF factors and Notch regulate nr2f2 gene expression during venous differentiation in zebrafish
Developmental Biology 390:116–125.

https://doi.org/10.1016/j.ydbio.2014.03.018
- PubMed
- Google Scholar
(2024) Characterization of the human fetal gonad and reproductive tract by single-cell transcriptomics
Developmental Cell 59:529–544.

https://doi.org/10.1016/j.devcel.2024.01.006
- PubMed
- Google Scholar
1. Tang H
2. Brennan J
3. Karl J
4. Hamada Y
5. Raetzman L
6. Capel B
(2008) Notch signaling maintains Leydig progenitor cells in the mouse testis
Development 135:3745–3753.

https://doi.org/10.1242/dev.024786
- PubMed
- Google Scholar
(2020) Mouse gonad development in the absence of the pro-ovary factor WNT4 and the pro-testis factor SOX9
Cells 9:1103.

https://doi.org/10.3390/cells9051103
- PubMed
- Google Scholar
1. van den Driesche S
2. Walker M
3. McKinnell C
4. Scott HM
5. Eddie SL
6. Mitchell RT
7. Seckl JR
8. Drake AJ
9. Smith LB
10. Anderson RA
11. Sharpe RM
(2012) Proposed Role for COUP-TFII in regulating fetal Leydig cell steroidogenesis, perturbation of which leads to masculinization disorders in rodents
PLOS ONE 7:e37064.

https://doi.org/10.1371/journal.pone.0037064
- Google Scholar
(2022) Insights Into the roles of GATA factors in mammalian testis development and the control of fetal testis gene expression
Frontiers in Endocrinology 13:902198.

https://doi.org/10.3389/fendo.2022.902198
- PubMed
- Google Scholar
(2024) Evidence for NR2F2/COUP-TFII involvement in human testis development
Scientific Reports 14:17869.

https://doi.org/10.1038/s41598-024-68860-3
- PubMed
- Google Scholar
1. Wen Q
2. Cheng CY
3. Liu Y-X
(2016) Development, function and fate of fetal Leydig cells
Seminars in Cell & Developmental Biology 59:89–98.

https://doi.org/10.1016/j.semcdb.2016.03.003
- Google Scholar
(2002) Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis
Genes & Development 16:1433–1440.

https://doi.org/10.1101/gad.981202
- PubMed
- Google Scholar
1. Yokoyama T
2. Omotehara T
3. Hirano T
4. Kubota N
5. Yanai S
6. Hasegawa C
7. Takada T
8. Mantani Y
9. Hoshi N
(2018) Identification of reference genes for quantitative PCR analyses in developing mouse gonads
The Journal of Veterinary Medical Science 80:1534–1539.

https://doi.org/10.1292/jvms.18-0417
- PubMed
- Google Scholar
1. Yu C-T
2. Tang K
3. Suh JM
4. Jiang R
5. Tsai SY
6. Tsai M-J
(2012) COUP-TFII is essential for metanephric mesenchyme formation and kidney precursor cell survival
Development 139:2330–2339.

https://doi.org/10.1242/dev.076299
- PubMed
- Google Scholar
1. Zhou B
2. Ma Q
3. Rajagopal S
4. Wu SM
5. Domian I
6. Rivera-Feliciano J
7. Jiang D
8. von Gise A
9. Ikeda S
10. Chien KR
11. Pu WT
(2008) Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart
Nature 454:109–113.

https://doi.org/10.1038/nature07060
- PubMed
- Google Scholar
1. Zidoune H
2. Ladjouze A
3. Chellat-Rezgoune D
4. Boukri A
5. Dib SA
6. Nouri N
7. Tebibel M
8. Sifi K
9. Abadi N
10. Satta D
11. Benelmadani Y
12. Bignon-Topalovic J
13. El-Zaiat-Munsch M
14. Bashamboo A
15. McElreavey K
(2022) Novel genomic variants, atypical phenotypes and evidence of a Digenic/Oligogenic contribution to disorders/differences of sex development in a large North African cohort
Frontiers in Genetics 13:900574.

https://doi.org/10.3389/fgene.2022.900574
- PubMed
- Google Scholar
1. Zimmermann S
2. Steding G
3. Emmen JM
4. Brinkmann AO
5. Nayernia K
6. Holstein AF
7. Engel W
8. Adham IM
(1999) Targeted disruption of the Insl3 gene causes bilateral cryptorchidism
Molecular Endocrinology 13:681–691.

https://doi.org/10.1210/mend.13.5.0272
- PubMed
- Google Scholar

Article and author information

Author details

Aitana Perea-Gomez

Université Côte d'Azur, CNRS, INSERM, iBV, Nice, France

Contribution
Conceptualization, Formal analysis, Supervision, Investigation, Methodology, Writing - original draft, Writing - review and editing

For correspondence
Aitana.PEREA-GOMEZ@univ-cotedazur.fr

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-7788-038X
Natividad Bellido Carreras

Université Côte d'Azur, CNRS, INSERM, iBV, Nice, France

Contribution
Investigation

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-1207-0711
Magali Dhellemmes

Université Côte d'Azur, CNRS, INSERM, iBV, Nice, France

Contribution
Investigation

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0001-7983-3221
Furong Tang

Université Côte d'Azur, CNRS, INSERM, iBV, Nice, France

Contribution
Investigation

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0001-7546-7500
Coralie Le Gallo

Université Côte d'Azur, CNRS, INSERM, iBV, Nice, France

Contribution
Investigation

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0009-0000-5079-4791
Marie-Christine Chaboissier

Université Côte d'Azur, CNRS, INSERM, iBV, Nice, France

Contribution
Conceptualization, Formal analysis, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing

For correspondence
marie-christine.chaboissier@univ-cotedazur.fr

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-0934-8217

Funding

Agence Nationale de la Recherche (ANR-23-CE14-0012)

Marie-Christine Chaboissier

China Scholarship Council

Furong Tang

Agence Nationale de la Recherche (Heterosex)

Marie-Christine Chaboissier

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We acknowledge the help from members of the Experimental Histopathology Platform, the PRISM Imaging Platform, and the Animal House at iBV (Institut de Biologie Valrose, Université Côte d'Azur, CNRS, Inserm, iBV, France). We are grateful to members of the A Schedl, MC Chaboissier, and S Nef groups for helpful discussions and to D Wilhelm for critical reading of the manuscript. We are indebted to Dr. Chaponnier, Dr. Inoue, Pr Morohashi, Dr. M Vasseur-Cognet, and Dr. Wilhelm for sharing mouse lines and reagents. This research was funded by Agence Nationale de la Recherche ANR-23-CE14-0012, Heterosex, and by a scholarship from the China Scholarship Council (to FT).

Ethics

The experiments described herein were carried out in compliance with the relevant institutional and French animal welfare laws, guidelines, and policies (APAFIS APAFIS#12789-2017121515109323 v1 and APAFIS#44072-2023061915491990 v5).

Version history

Preprint posted: September 25, 2024
Sent for peer review: November 19, 2024
Reviewed Preprint version 1: January 3, 2025
Reviewed Preprint version 2: June 10, 2025
Version of Record published: July 10, 2025

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.103783. This DOI represents all versions, and will always resolve to the latest one.

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.