1. Developmental Biology
Download icon

Oviductal estrogen receptor α signaling prevents protease-mediated embryo death

  1. Wipawee Winuthayanon  Is a corresponding author
  2. Miranda L Bernhardt
  3. Elizabeth Padilla-Banks
  4. Page H Myers
  5. Matthew L Edin
  6. Fred B Lih
  7. Sylvia C Hewitt
  8. Kenneth S Korach
  9. Carmen J Williams  Is a corresponding author
  1. National Institute of Environmental Health Sciences, National Institutes of Health, United States
  2. Washington State University, United States
Research Article
Cite this article as: eLife 2015;4:e10453 doi: 10.7554/eLife.10453
Voice your concerns about research culture and research communication: Have your say in our 7th annual survey.
8 figures, 3 videos and 6 tables

Figures

Figure 1 with 1 supplement
Conditional deletion of estrogen receptor α (ERα) from cell type-selective regions of the oviduct.

Representative immunohistochemical analysis of ERα in the oviduct regions indicated from wild-type (WT), conditional knockout (cKO), and mesenchymal cKO mice. Scale bar = 100 μm. ERα protein expression in the cKO uterus was reported previously (Winuthayanon et al., 2010).

https://doi.org/10.7554/eLife.10453.003
Figure 1—figure supplement 1
Additional images showing immunohistochemical analysis of estrogen receptor α (ERα) in oviduct isthmus.

Wild-type (WT) and conditional knockout (cKO) are indicated. Epithelial cells in cKO completely lacked ERα signal, but no difference in smooth muscle or stromal staining was observed. Scale bar = 100 μm.

https://doi.org/10.7554/eLife.10453.004
Figure 2 with 1 supplement
Decreased fertilization and increased embryo death in oviducts lacking epithelial estrogen receptor α (ERα).

(A) Images of zygotes and two-cell embryos collected at 0.5 and 1.5 dpc from each genotype. Scale bar = 100 μm. (B) Total embryos collected at the indicated time points (n = 3–11 mice/group). *p< 0.05 vs WT at similar time-point; ns, no significant difference vs WT at similar time-point. (C) Total ovulated oocytes from WT and cKO females after stimulation with gonadotropins (n = 10–16 mice/group). (D) Number of sperm present in the indicated regions of WT and cKO oviducts following mating. Graph shows number of sperm within cumulus cell masses in the ampulla (n = 5 mice/group) and relative number of sperm flushed from the isthmus region (n = 6 mice/group). *, significant difference compared to WT at designated location, Mann–Whitney test, p <0.01. (E) IVF efficiency. Cumulus-oocyte complexes (COCs) were collected from the oviducts or ovaries of superovulated WT and cKO females and then inseminated. Cumulus cells were removed from one set of oviduct COCs prior to insemination (cumulus cell-free). Graph indicates the percentage of eggs fertilized out of the total collected (n = 5–7 mice/group). (F) Development in vitro of zygotes collected from oviducts of WT and cKO mice. Embryo morphology recorded after 24 hr (two-cell stage), 48 hr (four- to eight-cell stage), and 72 hr (morula and blastocyst stages) (n = 4–5 mice/group). (G,H) Development in vitro of zygotes generated by IVF of oocytes from (G) oviducts (n = 5–7 mice/group) or (H) ovaries of WT and cKO mice (n = 5–7 mice/group). All graphs represent mean ± SEM. *, significant difference compared to WT at designated time point, p<0.05. cKO: Conditional knockout; dpc: Days post coitum; IVF: In vitro fertilization; WT: Wild-type.

https://doi.org/10.7554/eLife.10453.005
Figure 2—figure supplement 1
Representative images of sperm flushed from oviductal isthmus of wild-type (WT) and conditional knockout (cKO) mice. 

Scale bar = 20 μm.

https://doi.org/10.7554/eLife.10453.006
Validation of up- and down-regulated genes in conditional knockout (cKO) compared to Wild-type (WT) oviducts at 0.5 and 1.5 dpc using real-time PCR analysis.

The transcripts were selected from microarray datasets for over- and under-expression in cKO oviducts compared to WT at 0.5 or 1.5 dpc, as indicated (n = 4–7 mice/group; mean ± SEM). Data represents relative expression level normalized to Rpl7. *, significant difference compared to WT at same time point, p<0.05. dpc: Days post coitum.

https://doi.org/10.7554/eLife.10453.007
Aberrant oviduct innate immune function in the absence of oviductal epithelial estrogen receptor α (ERα).

(A) Unsupervised hierarchical clustering of microarray data from wild-type (WT) and conditional knockout (cKO) oviducts at 0.5 and 1.5 dpc. Using a 1.5-fold cutoff, 3263 probes were significantly different between WT and cKO oviducts at 0.5 dpc, whereas only 321 probes were different at 1.5 dpc. The heat map shows log2 transformed and standardized g Processed Signals (signal intensities). Green color represents probes with intensity less than mean; red color represents probes with intensity more than mean. Each horizontal bar represents data from a single animal; n = 4 mice/group. (B) Real-time PCR of hematopoietic prostaglandin D synthase (Hpgds) transcript in WT and cKO oviducts at 0.5 and 1.5 dpc (n = 4–7 mice/group). (C) Immunoblot of HPGDS expression in WT and cKO oviducts at 0.5 dpc; β-actin was used as a loading control. Protein lysate from one mouse in each lane; n = 4–5 mice/group. (D) Real-time PCR of interleukin-17 (Il17), interleukin-17 receptor b (Il17rb), and chemokine (CXC motif) ligand 17 (Cxcl17)transcripts in WT and cKO oviducts at 0.5 and 1.5 dpc (n = 4–7 mice/group). (E) Prostaglandin profile in whole oviduct tissues from WT and cKO at 0.5 dpc. 6ketoPGF, 6-keto-prostaglandin F; TXB2, thromboxane B2; PGF, prostaglandin F; PGD2, prostaglandin D2; PGE2, prostaglandin E2; and 8isoPGF, 8-iso-prostaglandin F (n = 6–7 mice/group). (F) Number of fertilized eggs (zygotes) after insemination in the presence of PGE2 and number of morulae and blastocysts 3 days after treating zygotes with 1 μM PGE2 as compared to vehicle control (n = 36–40 oocytes/group). For all panels, graphs represent mean ± SEM and asterisks indicate significant difference compared to WT at designated time point, p<0.05. dpc: Days post coitum; HPGDS: hematopoietic prostaglandin D synthase.

https://doi.org/10.7554/eLife.10453.008
Figure 5 with 1 supplement
Alterations in expression of proteases and protease inhibitors in oviducts lacking epithelial estrogen receptor α (ERα).

Real-time PCR of the indicated (A) proteases and (B) protease inhibitors in wild-type (WT) and conditional knockout (cKO) oviducts at 0.5 dpc (n = 4–7 mice/group; mean ± SEM). (C) Immunoblot analysis of fetuin B in WT and cKO oviducts; β-actin served as a loading control. Protein lysate from one mouse in each lane; n = 4–5 mice/group. (D) Quantitation of fetuin B signal intensity normalized to β-actin. (E) Fetuin B localization in WT and cKO oviducts at 0.5 dpc. Images shown are representative of n = 4 mice/group. Scale bar = 50 μm. For all panels, asterisk indicates significant difference compared to WT, p<0.05. dpc: Days post coitum.

https://doi.org/10.7554/eLife.10453.014
Figure 5—figure supplement 1
Comparable expression of proteases and protease inhibitors in wild-type (WT) and mesenchymal conditional knockout (cKO) oviduct at 0.5 dpc.

(A) Real-time PCR of the indicated proteases and protease inhibitors in WT and mesenchymal cKO oviducts at 0.5 dpc (n = 4–6 mice/group; mean ± SEM). (B) Immunoblot analysis and (C) normalized signal intensities of fetuin B protein to β-actin in WT and mesenchymal cKO oviducts at 0.5 dpc. dpc: Days post coitum.

https://doi.org/10.7554/eLife.10453.015
Figure 6 with 1 supplement
Zona pellucida alterations due to elevated protease activity in oviducts lacking epithelial estrogen receptor α (ERα).

(A) Immunoblot analysis of ZP2 protein in eggs retrieved from wild-type (WT) and conditional knockout (cKO) oviducts ∼4 hr after ovulation. Eight eggs from one mouse/lane. (B,C) Quantitation of the percentage intact ZP2 protein (B) and percentage conversion from intact ZP2 to cleaved ZP2 (C) in ovulated eggs from WT and cKO oviducts (n = 6 mice/group); *p<0.05. (D) Immunoblot analysis of ZP2 in zygotes retrieved from WT and cKO oviducts ∼10 hr after fertilization. Ten zygotes pooled from 3 mice per lane. (E) Percentage conversion from intact ZP2 to cleaved ZP2 in zygotes from WT and cKO oviducts. Graph presents data from 7 pools of 10 embryos per group; mean ± SEM. *p <0.05, T-test. (F) Images of zygotes from WT and cKO oviducts stained for cortical granules. Arrowheads indicate cortical granule contents in the perivitelline space. Scale bar = 20 μm. (G) Percentage ZP lysis over time in zygotes retrieved from WT and cKO oviducts and incubated in 0.2% α-chymotrypsin. Each line represents data from one mouse. (H) Images of WT and cKO zygotes after 90 min incubation in 0.2% α-chymotrypsin (n = 3–4 mice/group). Scale bar = 50 μm. (I) Time to lysis for zygotes cultured in 0.4% α-chymotrypsin with ZP either intact or removed using treatment with acidic Tyrode’s solution or manual microdissection, as indicated. Graph presents data from 15–21 embryos per treatment over three independent experiments; mean ± SEM. *p<0.05, ANOVA. (J) [Na]i in WT zygotes exposed to vehicle, 0.2% α-chymotrypsin (protease), or 0.2% α-chymotrypsin and recombinant defensins (protease defensin). Graph shows relative [Na]i as indicated by SBFI 340/380 ratio (n = 10–12 embryos/group; mean ± SEM). *p <0.05, ANOVA. cKO: Conditional knockout; MII: Metaphase II; [Na]i: Intracellular sodium; SBFI: Sodium-binding benzofuran isophthalate;WT: Wild-type; ZP: Zona pellucida.

https://doi.org/10.7554/eLife.10453.016
Figure 6—figure supplement 1
Morphology of WT zygotes after exposure to defensins.

Zygotes were incubated at 37°C in the presence of vehicle (PBS) or a combination of α-defensin 1 and β-defensin 3 recombinant proteins, each at a concentration of 0.5, 5, or 50 μg/mL. Pictures were taken at the indicated time-points. Scale bar = 50 μm.

https://doi.org/10.7554/eLife.10453.017
Excessive protease activity in vivo in the conditional knockout (cKO) oviduct leads to embryo development failure.

(A) Percentage of underdeveloped embryos and morula/blastocyst stage embryos retrieved from pseudopregnant wild-type (WT) and cKO recipients that received no protease inhibitors (–PI) or received protease inhibitors ( PI) during embryo transfer (n = 5–12 mice/group and 42–64 embryos/group; mean ± SEM, *p <0.05). (B) Representative images of embryos retrieved from WT and cKO recipients at 3.5 dpc in –PI and PI groups. Arrowheads indicate examples of underdeveloped embryos. Scale bars = 50 μm.

https://doi.org/10.7554/eLife.10453.021
Schematic describing how estrogen receptor α (ERα) in oviduct epithelial cells supports fertilization and early embryo development.

(A) In wild-type mice, estrogen signals to ERα in both stromal and epithelial cells to suppress secretion of innate immune mediators and generate a luminal environment supportive of sperm migration, fertilization, and preimplantation embryo development. (B) In mice lacking ERα in oviduct epithelial cells, estrogen signaling to stromal cells alone cannot suppress secretion of oviduct immune mediators, resulting in increased protease activity. There is a failure of sperm migration, impaired fertilization, and lysis of successfully fertilized embryos. Embryos can be rescued by inserting protease inhibitors into the oviduct lumen. (C) In mice lacking ERα in oviduct stromal cells, the luminal environment fully supports fertilization and embryo development.

https://doi.org/10.7554/eLife.10453.022

Videos

Video 1
Morphology of zygotes from WT oviducts during protease treatment in vitro. 

Zygotes collected from WT oviducts at 24 hr following hCG administration and mating were cultured in PBS containing 0.2% α-chymotrypsin. Images were taken every 5 min for 60 min and are shown at 3 frames/s. hCG: Human chorionic gonadotropin; WT: Wild-type.

https://doi.org/10.7554/eLife.10453.018
Video 2
Morphology of zygotes from cKO oviducts during protease treatment in vitro. 

Zygotes collected from cKO oviducts at 24 hr following hCG administration and mating were cultured in PBS containing 0.2% α-chymotrypsin. Images were taken every 5 min for 60 min and are shown at 3 frames/s. cKO: Conditional knockout; hCG: Human chorionic gonadotropin.

https://doi.org/10.7554/eLife.10453.019
Video 3
Protease treatment rapidly cleaves membrane-associated protein despite presence of ZP.

Movie shows green fluorescence signal after ZP-intact oocytes expressing a GPI-linked EGFP on the extracellular surface of the plasma membrane were treated with 0.04% α-chymotrypsin. Baseline imaging was performed for 5 min and then imaging was paused for 1 min to allow addition of α-chymotrypsin to the imaging drop. The movie file shows the last frame of baseline imaging, followed by subsequent images taken every 10 s, shown at 3 frames/s. This pattern of fluorescence loss is representative of 5 imaging experiments, each using 6–12 EGFP-GPI-expressing oocytes. (Note that treatment with 0.2% α-chymotrypsin caused complete loss of signal too rapidly to be visualized). ZP: Zona pellucida.

https://doi.org/10.7554/eLife.10453.020

Tables

Table 1

Highly altered genes in cKO compared to WT oviducts at 0.5 dpc.

https://doi.org/10.7554/eLife.10453.009
SymbolEntrez gene nameFold change (cKO vs WT)p-value
Drd4 Dopamine receptor D438.3573.40E-04
Cdh16 Cadherin 16, KSP-cadherin33.7966.04E-08
Clca1 Chloride channel accessory 126.7863.40E-03
Lrrc39 Leucine-rich repeat containing 3924.8851.97E-06
Olfr632 Olfactory receptor 63223.1831.45E-08
Sct Secretin21.0794.74E-06
Ost alpha Organic solute transporter alpha20.6701.87E-04
Kif12 Kinesin family member 1219.8141.37E-05
Enthd1 ENTH domain containing 118.3752.03E-03
Or8g2 Olfactory receptor, family 8, subfamily G, member 217.5965.42E-05
Trp5 Transient receptor potential cation channel, member 516.9471.35E-05
Olfr676 Olfactory receptor 67616.1059.31E-04
Or1s1 Olfactory receptor, family 1, subfamily S, member 115.8868.80E-08
Cdh7 Cadherin 7, type 215.7726.51E-10
Chrna6 Cholinergic receptor, nicotinic, alpha 615.6614.81E-04
Col8a1 Collagen, type VIII, alpha 114.8859.07E-05
Olfr470 Olfactory receptor 47014.5422.39E-03
Prrt3 Proline-rich transmembrane protein 314.2928.79E-03
Pla2g5 Phospholipase A2, group V14.2561.84E-07
Slc35f4 Solute carrier family 35, member F414.0912.83E-03
Dhrs9 Dehydrogenase/reductase (SDR family) member 9-13.5306.61E-05
Or1j4 Olfactory receptor, family 1, subfamily J, member 4-13.6218.64E-07
Hiat1 Hippocampus abundant transcript 1-13.9099.65E-04
Znf385b Zinc finger protein 385B-14.0324.32E-07
Cyp7a1 Cytochrome P450, family 7, subfamily A, polypeptide 1-14.1641.53E-06
Olfr1316 Olfactory receptor 1316-14.2257.13E-07
Cux1 Cut-like homeobox 1-14.3312.87E-04
Expi Extracellular proteinase inhibitor-14.3732.52E-06
Sh2d4b SH2 domain containing 4B-15.4121.33E-04
Olfr1196 Olfactory receptor 1196-15.4492.26E-05
Thsd7b Thrombospondin, type I, domain containing 7B-16.3359.09E-05
Slc7a14 Solute carrier family 7 (orphan transporter), member 14-16.4455.52E-05
Olfr992 Olfactory receptor 992-17.7709.70E-06
Olfr181 Olfactory receptor 181-18.0048.70E-06
Upk1a Uroplakin 1A-18.5252.05E-05
Bpifc BPI fold containing family C-18.5781.06E-05
C1orf50 Chromosome 1 open-reading frame 50-22.3333.35E-05
Tshr Thyroid stimulating hormone receptor-36.7584.18E-06
Dcpp Demilune cell and parotid protein-129.6422.22E-03
C6orf15 Chromosome 6 open-reading frame 15-148.2547.15E-05
  1. cKO: Conditional knockout; dpc: Days post coitum; WT: Wild-type.

Table 2

Highly altered genes in cKO compared to WT oviducts at 1.5 dpc.

https://doi.org/10.7554/eLife.10453.010
SymbolEntrez gene nameFold change (cKO vs WT)p-value
Clca1 Chloride channel accessory 134.2632.60E-04
Pcdh8 Protocadherin 827.0101.34E-05
Sct Secretin13.0706.05E-06
Myom2 Myomesin (M-protein) 2, 165kDa12.1631.16E-05
Klk8 Kallikrein-related peptidase 88.7368.45E-04
Crp C-reactive protein, pentraxin-related7.9044.30E-04
C2orf51 Chromosome 2 open-reading frame 516.9053.72E-04
Muc4 Mucin 4, cell surface associated5.9321.02E-04
Cntf Ciliary neurotrophic factor5.6431.02E-05
Csn1s1 Casein alpha s15.3742.03E-04
Dbh Dopamine β-hydroxylase5.2486.50E-07
Hs6st3 Heparan sulfate 6-O-sulfotransferase 35.0863.19E-05
G6pc2 Glucose-6-phosphatase, catalytic, 24.3706.53E-04
Nr0b1 Nuclear receptor subfamily 0, group B, member 14.2312.95E-05
Krt15 Keratin 154.1152.60E-04
Kcnd2 Potassium voltage-gated channel, member 24.0532.78E-04
Il18r1 Interleukin 18 receptor 14.0012.54E-05
Cxcl17 Chemokine (C-X-C motif) ligand 173.9542.79E-07
Nrgn Neurogranin (protein kinase C substrate, RC3)3.8812.85E-04
Trvp6 Transient receptor potential cation
channel member 6
3.8082.64E-05
Cntnap2 Contactin-associated protein-like 2-4.4711.41E-04
Gpr64 G-protein-coupled receptor 64-4.5272.05E-06
Ly6a Lymphocyte antigen 6 complex, locus A-4.5854.28E-04
Unc5cl Unc-5 homolog C (C. elegans)-like-4.6376.55E-04
Sbp Spermine-binding protein-4.6816.20E-05
Hpgds Hematopoietic prostaglandin D synthase-4.7902.61E-05
Galntl5 UDP-N-acetyl-α-d-galactosamine:polypeptide
N-acetylgalactosaminyltransferase-like 5
-4.8047.22E-04
Gabra5 Gamma-aminobutyric acid (GABA)
A receptor, alpha 5
-5.3099.81E-05
Sftpd Surfactant protein D-5.4101.14E-04
Uox Urate oxidase, pseudogene-5.4112.05E-04
Ctse Cathepsin E-6.7618.95E-04
Calml3 Calmodulin-like 3-7.8429.63E-07
Sectm1 Secreted and transmembrane 1-8.1303.06E-05
Reg1a Regenerating islet-derived 1 alpha-8.2555.03E-05
Upk1a Uroplakin 1A-8.8396.84E-05
Rtn1 Reticulon 1-9.9438.23E-06
Mlc1 Megalencephalic leukoencephalopathy
with subcortical cysts 1
-11.7583.67E-06
Expi Extracellular proteinase inhibitor-13.6921.96E-06
Atp6v1c2 ATPase, H transporting, V1 subunit C2-14.2254.67E-06
C6orf15 Chromosome 6 open reading frame 15-253.7223.51E-07
  1. cKO: Conditional knockout; dpc: Days post coitum; WT: Wild-type.

Table 3

Selected Ingenuity top biological function categories at 0.5 dpc.

https://doi.org/10.7554/eLife.10453.011
Categoryp-value# Molecules
Tissue development
Tissue development3.12E-10362
Cell–cell adhesion3.33E-0422
Accumulation of monocytes8.34E-045
Angiogenesis of organ1.16E-0315
Accumulation of phagocytes1.26E-0322
Development of endothelial tissue3.61E-0338
Accumulation of eosinophils5.73E-038
Lipid metabolism
Synthesis of lipid4.66E-08117
Steroid metabolism3.13E-0648
Metabolism of cholesterol1.42E-0421
Metabolism of prostaglandin1.24E-0327
Synthesis of eicosanoid2.02E-0332
Synthesis of prostaglandin D23.75E-039
Inflammatory response
Inflammation3.52E-0469
Accumulation of monocytes8.34E-045
Accumulation of phagocytes1.26E-0322
Accumulation of eosinophils5.73E-038
Accumulation of antigen-presenting cells8.80E-0313
Cellular growth and proliferation
Proliferation of endothelial cells3.59E-0332
Proliferation of endocrine cells4.48E-0314
Proliferation of chondrocytes5.56E-0312
Proliferation of epidermal cells7.78E-0320
Proliferation of B-lymphocyte-derived
cell lines
8.20E-0319
Proliferation of Th2 cells8.70E-035
  1. dpc: Days post coitum.

Table 4

Selected Ingenuity top biological function categories at 1.5 dpc.

https://doi.org/10.7554/eLife.10453.012
Categoryp-value# Molecules
Tissue development
Tissue development3.06E-0344
Development of organ1.05E-0230
Aggregation of cells1.46E-028
Organization of tissue1.48E-026
Inflammatory response
Immune response of neutrophils4.91E-034
Chemotaxis of antigen-presenting cells6.37E-035
Immune response of phagocytes1.56E-025
Cellular movement
Mobilization of cells6.75E-034
Mobilization of neutrophils8.24E-032
Small molecule biochemistry
Production of eicosanoid3.51E-037
Synthesis of prostaglandin E26.13E-035
Synthesis of lipid1.13E-0215
  1. dpc: Days post coitum.

Table 5

Protease, protease inhibitor, and antimicrobial peptide transcripts in cKO compared to WT oviducts at 0.5 dpc.

https://doi.org/10.7554/eLife.10453.013
SymbolEntrez gene nameFold change (cKO vs WT)p-value
Proteases
Tmprss15 Transmembrane protease, serine 1516.412.33E-09
Klk8 Kallikrein related-peptidase 810.349.85E-04
Prss42 Protease, serine, 429.637.67E-03
Prss7 Protease, serine, 7 (enterokinase)8.542.34E-02
Klk9 Kallikrein related-peptidase 95.627.06E-06
Prss33 Protease, serine, 335.355.07E-04
Prss51 Protease, serine, 512.961.65E-02
Prss41 Protease, serine, 412.691.36E-04
Klk7 Kallikrein related-peptidase 72.632.55E-05
Prss32 Protease, serine, 322.453.10E-02
Tmprss13 Transmembrane protease, serine 132.146.83E-03
Cma1 Chymase 1, mast cell2.052.53E-02
Prss35 Protease, serine, 351.903.10E-02
Prss34 Protease, serine, 341.891.92E-02
Mcpt4 Mast cell protease 41.823.45E-02
Prss23 Protease, serine, 231.663.54E-02
Tmprss6 Transmembrane protease, serine 61.524.69E-04
Ctsd Cathepsin D1.514.89E-02
Prss3 Protease, serine, 3-1.813.10E-02
Klk1b3 Kallikrein 1-related peptidase b3-2.082.86E-02
Klk1b8 Kallikrein 1-related peptidase b8-2.312.44E-03
Prss58 Protease, serine, 58-2.461.27E-02
Klk1b26 Kallikrein 1-related peptidase b26-4.014.57E-02
Klk1b11 Kallikrein 1-related peptidase b11-4.041.25E-02
Klk1 Kallikrein 1-4.081.11E-03
Prss29 Protease, serine, 29-4.203.96E-02
Klk12 Kallikrein related-peptidase 12-4.682.05E-03
Klk1b24 Kallikrein 1-related peptidase b24-6.133.12E-03
Klk1b21 Kallikrein 1-related peptidase b21-8.854.72E-03
Klk1b27 Kallikrein 1-related peptidase b27-9.652.72E-03
Prss28 Protease, serine, 28-28.092.34E-02
Protease inhibitors
Serpini2 Serine (or cysteine) peptidase inhibitor, clade I (pancpin), member 26.993.89E-02
Serpinb7 Serine (or cysteine) peptidase inhibitor, clade B (Ovalbumin), member 76.282.63E-02
Serpinb9f Serine (or cysteine) peptidase inhibitor,
clade B, member 9f
5.973.82E-02
Serpinb12 Serine (or cysteine) peptidase inhibitor,
clade B, member 12
2.051.12E-02
Serpine2 Serine (or cysteine) peptidase inhibitor,
clade E, member 2
1.794.87E-02
Cstb Cystatin B (stefin B)-1.762.25E-04
Serpinb11 Serine (or cysteine) peptidase inhibitor,
clade B (ovalbumin), member 11
-2.102.99E-03
Fetub Fetuin beta-2.251.14E-02
Csta Cystatin A (stafin A)-2.653.80E-03
Serpine1 Serine (or cysteine) peptidase inhibitor,
clade E, member 1
-2.694.02E-02
Serpina3b Serine (or cysteine) peptidase inhibitor,
clade A, member 3B
-3.302.49E-02
Serpina1b Serine (or cysteine) peptidase inhibitor,
clade A, member 1B
-3.495.80E-03
Serpina1e Serine (or cysteine) peptidase inhibitor,
clade A, member 1E
-4.044.02E-02
Serpina9 Serine (or cysteine) peptidase inhibitor,
clade A (alpha-1 antiproteinase,
antitrypsin), member 9
-4.222.52E-03
Wfdc18 (or Expi)WAP four-disulfide core domain
18 (or extracellular proteinase inhibitor)
-13.691.96E-06
Antimicrobial peptides
Defb8 Defensin, beta 813.122.78E-02
Defa38 Defensin, alpha 383.482.42E-02
Defa3 Defensin, alpha 32.213.35E-05
Defb116 Defensin, beta 116-2.501.03E-02
Defb103b Defensin, beta 103B-3.241.06E-03
Defa4 Defensin, alpha 4-5.703.46E-02
Defb34 Defensin, beta 34-10.026.15E-05
  1. cKO: Conditional knockout; dpc: Days post coitum; WT: Wild-type.

Table 6

List of the primer sequences used for real-time RT-PCR reactions.

https://doi.org/10.7554/eLife.10453.023
SymbolEntrez gene nameSequences (Forward ([F]) and Reverse [(R]):5’ → 3’
Cdh16 Cadherin 16F: GCATTGCCCAGGTGCACTGGA
R: AAGGGTCCTGGAGGCTGGCT
Ctsd Cathepsin DF: GACAACAATAGGGTCGGCTT
R: GCTGGCTTCCTCTACTGGAC
Cxcl17 Chemokine (C-X-C motif) ligand 17F: AAGCCACGGGGACCAACACC
R: GGCTTGCAGGAACCAATCTTTGC
Drd4 Dopamine receptor 4F: TGGACGTCATGCTGTGCACCG
R: GGTCACGGCCACGAACCTGTC
Fetub Fetuin BF: ACGTCTAGCCTTCTGCGATT
R: TCCACTGTAAGCCACTCTGC
Hpgds Hemopoietic prostaglandin D synthaseF: GGACTTACAATCCACCAGAGC
R: TCCCAGCCAAATCTGTGTTTT
Il17 Interleukin 17F: CTGGAGGATAACACTGTGAGAGT
R: TGCTGAATGGCGACGGAGTTC
Il17rb Interleukin 17 receptor BF: TCAGCGCCCATAACATCCCCA
R: ACGTGGTTTAGGCAGCCTGGC
Klk8 Kallikrein related-peptidase 8F: GTTCCACCCTCTTCCTCAGA
R: CTCCCATGAACAGAAGCAGA
Krt8 Keratin 8F: TGAAGAAGGATGTGGACTGTGCCT
R: ATGCGGGTCTCCTCGTCATACATT
Muc4 Mucin 4F: ACCATGTCTTGGGGAACGTC
R: ATGCAGGTGAGGTATTCCTGA
Rpl7 Ribosomal protein L7F: AGCTGGCCTTTGTCATCAGAA
R: GACGAAGGAGCTGCAGAACCT
Rtn1 Reticulon 1F: AACGTCGTCGCGGGAACTGT
R: AGCTGCCATACCTGTGGATGCAGT
Sct SecretinF: CCCACGCCGATGCTACTGCT
R: TCTTGGGGTCCTGGGAGGTGC
Serpina1b Serine (or cysteine) peptidase inhibitor, clade A, member 1BF: ATCACCCGGATCTTCAACAA
R: CTCATCGATGGTCAGCACAG
Serpina9 Serine (or cysteine) peptidase inhibitor, clade A, member 9F: CAGGTGAGACTCCCTTCCTT
R: GTGGGAGGACTCTTGGTTGT
Serpinb11 Serine (or cysteine) peptidase inhibitor, clade B, member 11F: TCTTCTGAGTGCAGCCAAGT
R: AACGCTGAGGGAGTTCTGTT
Serpine1 Serine (or cysteine) peptidase inhibitor, clade E, member 11F: ACCGGAATGTGGTCTTCTCT
R: TGCCCTTCTCATTGACTTTG
Tmprss13 Transmembrane protease, serine 13F: ATAGGTCGCAATGTCCTTCC
R:TCTCAAACCACAGTGGGAAC
Tshr Thyroid stimulating hormone receptorF: CCTGACAGCTATAGACAACGATGCC
R: ACGCTGGTGGAAGACACATCTAGCA
Wfdc18 (or Expi)WAP four-disulfide core domain 18 (or extracellular proteinase inhibitor)F: TTTGTTCTGGTAGCTTTGATTTTCA
R: GCGCCAGGTTTTTCTTTGG

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)