Oviductal estrogen receptor α signaling prevents protease-mediated embryo death
- National Institute of Environmental Health Sciences, National Institutes of Health, United States
- Washington State University, United States
Figures
Figure 1 with 1 supplement
Conditional deletion of estrogen receptor α (ERα) from cell type-selective regions of the oviduct.
Representative immunohistochemical analysis of ERα in the oviduct regions indicated from wild-type (WT), conditional knockout (cKO), and mesenchymal cKO mice. Scale bar = 100 μm. ERα protein …
Figure 1—figure supplement 1
Additional images showing immunohistochemical analysis of estrogen receptor α (ERα) in oviduct isthmus.
Wild-type (WT) and conditional knockout (cKO) are indicated. Epithelial cells in cKO completely lacked ERα signal, but no difference in smooth muscle or stromal staining was observed. Scale bar = …
Figure 2 with 1 supplement
Decreased fertilization and increased embryo death in oviducts lacking epithelial estrogen receptor α (ERα).
(A) Images of zygotes and two-cell embryos collected at 0.5 and 1.5 dpc from each genotype. Scale bar = 100 μm. (B) Total embryos collected at the indicated time points (n = 3–11 mice/group). *p< …
Figure 2—figure supplement 1
Representative images of sperm flushed from oviductal isthmus of wild-type (WT) and conditional knockout (cKO) mice.
Scale bar = 20 μm.
Figure 3
Validation of up- and down-regulated genes in conditional knockout (cKO) compared to Wild-type (WT) oviducts at 0.5 and 1.5 dpc using real-time PCR analysis.
The transcripts were selected from microarray datasets for over- and under-expression in cKO oviducts compared to WT at 0.5 or 1.5 dpc, as indicated (n = 4–7 mice/group; mean ± SEM). Data represents …
Figure 4
Aberrant oviduct innate immune function in the absence of oviductal epithelial estrogen receptor α (ERα).
(A) Unsupervised hierarchical clustering of microarray data from wild-type (WT) and conditional knockout (cKO) oviducts at 0.5 and 1.5 dpc. Using a 1.5-fold cutoff, 3263 probes were significantly …
Figure 5 with 1 supplement
Alterations in expression of proteases and protease inhibitors in oviducts lacking epithelial estrogen receptor α (ERα).
Real-time PCR of the indicated (A) proteases and (B) protease inhibitors in wild-type (WT) and conditional knockout (cKO) oviducts at 0.5 dpc (n = 4–7 mice/group; mean ± SEM). (C) Immunoblot …
Figure 5—figure supplement 1
Comparable expression of proteases and protease inhibitors in wild-type (WT) and mesenchymal conditional knockout (cKO) oviduct at 0.5 dpc.
(A) Real-time PCR of the indicated proteases and protease inhibitors in WT and mesenchymal cKO oviducts at 0.5 dpc (n = 4–6 mice/group; mean ± SEM). (B) Immunoblot analysis and (C) normalized signal …
Figure 6 with 1 supplement
Zona pellucida alterations due to elevated protease activity in oviducts lacking epithelial estrogen receptor α (ERα).
(A) Immunoblot analysis of ZP2 protein in eggs retrieved from wild-type (WT) and conditional knockout (cKO) oviducts ∼4 hr after ovulation. Eight eggs from one mouse/lane. (B,C) Quantitation of the …
Figure 6—figure supplement 1
Morphology of WT zygotes after exposure to defensins.
Zygotes were incubated at 37°C in the presence of vehicle (PBS) or a combination of α-defensin 1 and β-defensin 3 recombinant proteins, each at a concentration of 0.5, 5, or 50 μg/mL. Pictures were …
Figure 7
Excessive protease activity in vivo in the conditional knockout (cKO) oviduct leads to embryo development failure.
(A) Percentage of underdeveloped embryos and morula/blastocyst stage embryos retrieved from pseudopregnant wild-type (WT) and cKO recipients that received no protease inhibitors (–PI) or received …
Figure 8
Schematic describing how estrogen receptor α (ERα) in oviduct epithelial cells supports fertilization and early embryo development.
(A) In wild-type mice, estrogen signals to ERα in both stromal and epithelial cells to suppress secretion of innate immune mediators and generate a luminal environment supportive of sperm migration, …
Videos
Video 1
Morphology of zygotes from WT oviducts during protease treatment in vitro.
Zygotes collected from WT oviducts at 24 hr following hCG administration and mating were cultured in PBS containing 0.2% α-chymotrypsin. Images were taken every 5 min for 60 min and are shown at 3 …
Video 2
Morphology of zygotes from cKO oviducts during protease treatment in vitro.
Zygotes collected from cKO oviducts at 24 hr following hCG administration and mating were cultured in PBS containing 0.2% α-chymotrypsin. Images were taken every 5 min for 60 min and are shown at 3 …
Video 3
Protease treatment rapidly cleaves membrane-associated protein despite presence of ZP.
Movie shows green fluorescence signal after ZP-intact oocytes expressing a GPI-linked EGFP on the extracellular surface of the plasma membrane were treated with 0.04% α-chymotrypsin. Baseline …
Tables
Table 1
Highly altered genes in cKO compared to WT oviducts at 0.5 dpc.
| Symbol | Entrez gene name | Fold change (cKO vs WT) | p-value |
|---|---|---|---|
| Drd4 | Dopamine receptor D4 | 38.357 | 3.40E-04 |
| Cdh16 | Cadherin 16, KSP-cadherin | 33.796 | 6.04E-08 |
| Clca1 | Chloride channel accessory 1 | 26.786 | 3.40E-03 |
| Lrrc39 | Leucine-rich repeat containing 39 | 24.885 | 1.97E-06 |
| Olfr632 | Olfactory receptor 632 | 23.183 | 1.45E-08 |
| Sct | Secretin | 21.079 | 4.74E-06 |
| Ost alpha | Organic solute transporter alpha | 20.670 | 1.87E-04 |
| Kif12 | Kinesin family member 12 | 19.814 | 1.37E-05 |
| Enthd1 | ENTH domain containing 1 | 18.375 | 2.03E-03 |
| Or8g2 | Olfactory receptor, family 8, subfamily G, member 2 | 17.596 | 5.42E-05 |
| Trp5 | Transient receptor potential cation channel, member 5 | 16.947 | 1.35E-05 |
| Olfr676 | Olfactory receptor 676 | 16.105 | 9.31E-04 |
| Or1s1 | Olfactory receptor, family 1, subfamily S, member 1 | 15.886 | 8.80E-08 |
| Cdh7 | Cadherin 7, type 2 | 15.772 | 6.51E-10 |
| Chrna6 | Cholinergic receptor, nicotinic, alpha 6 | 15.661 | 4.81E-04 |
| Col8a1 | Collagen, type VIII, alpha 1 | 14.885 | 9.07E-05 |
| Olfr470 | Olfactory receptor 470 | 14.542 | 2.39E-03 |
| Prrt3 | Proline-rich transmembrane protein 3 | 14.292 | 8.79E-03 |
| Pla2g5 | Phospholipase A2, group V | 14.256 | 1.84E-07 |
| Slc35f4 | Solute carrier family 35, member F4 | 14.091 | 2.83E-03 |
| Dhrs9 | Dehydrogenase/reductase (SDR family) member 9 | -13.530 | 6.61E-05 |
| Or1j4 | Olfactory receptor, family 1, subfamily J, member 4 | -13.621 | 8.64E-07 |
| Hiat1 | Hippocampus abundant transcript 1 | -13.909 | 9.65E-04 |
| Znf385b | Zinc finger protein 385B | -14.032 | 4.32E-07 |
| Cyp7a1 | Cytochrome P450, family 7, subfamily A, polypeptide 1 | -14.164 | 1.53E-06 |
| Olfr1316 | Olfactory receptor 1316 | -14.225 | 7.13E-07 |
| Cux1 | Cut-like homeobox 1 | -14.331 | 2.87E-04 |
| Expi | Extracellular proteinase inhibitor | -14.373 | 2.52E-06 |
| Sh2d4b | SH2 domain containing 4B | -15.412 | 1.33E-04 |
| Olfr1196 | Olfactory receptor 1196 | -15.449 | 2.26E-05 |
| Thsd7b | Thrombospondin, type I, domain containing 7B | -16.335 | 9.09E-05 |
| Slc7a14 | Solute carrier family 7 (orphan transporter), member 14 | -16.445 | 5.52E-05 |
| Olfr992 | Olfactory receptor 992 | -17.770 | 9.70E-06 |
| Olfr181 | Olfactory receptor 181 | -18.004 | 8.70E-06 |
| Upk1a | Uroplakin 1A | -18.525 | 2.05E-05 |
| Bpifc | BPI fold containing family C | -18.578 | 1.06E-05 |
| C1orf50 | Chromosome 1 open-reading frame 50 | -22.333 | 3.35E-05 |
| Tshr | Thyroid stimulating hormone receptor | -36.758 | 4.18E-06 |
| Dcpp | Demilune cell and parotid protein | -129.642 | 2.22E-03 |
| C6orf15 | Chromosome 6 open-reading frame 15 | -148.254 | 7.15E-05 |
-
cKO: Conditional knockout; dpc: Days post coitum; WT: Wild-type.
Table 2
Highly altered genes in cKO compared to WT oviducts at 1.5 dpc.
| Symbol | Entrez gene name | Fold change (cKO vs WT) | p-value |
|---|---|---|---|
| Clca1 | Chloride channel accessory 1 | 34.263 | 2.60E-04 |
| Pcdh8 | Protocadherin 8 | 27.010 | 1.34E-05 |
| Sct | Secretin | 13.070 | 6.05E-06 |
| Myom2 | Myomesin (M-protein) 2, 165kDa | 12.163 | 1.16E-05 |
| Klk8 | Kallikrein-related peptidase 8 | 8.736 | 8.45E-04 |
| Crp | C-reactive protein, pentraxin-related | 7.904 | 4.30E-04 |
| C2orf51 | Chromosome 2 open-reading frame 51 | 6.905 | 3.72E-04 |
| Muc4 | Mucin 4, cell surface associated | 5.932 | 1.02E-04 |
| Cntf | Ciliary neurotrophic factor | 5.643 | 1.02E-05 |
| Csn1s1 | Casein alpha s1 | 5.374 | 2.03E-04 |
| Dbh | Dopamine β-hydroxylase | 5.248 | 6.50E-07 |
| Hs6st3 | Heparan sulfate 6-O-sulfotransferase 3 | 5.086 | 3.19E-05 |
| G6pc2 | Glucose-6-phosphatase, catalytic, 2 | 4.370 | 6.53E-04 |
| Nr0b1 | Nuclear receptor subfamily 0, group B, member 1 | 4.231 | 2.95E-05 |
| Krt15 | Keratin 15 | 4.115 | 2.60E-04 |
| Kcnd2 | Potassium voltage-gated channel, member 2 | 4.053 | 2.78E-04 |
| Il18r1 | Interleukin 18 receptor 1 | 4.001 | 2.54E-05 |
| Cxcl17 | Chemokine (C-X-C motif) ligand 17 | 3.954 | 2.79E-07 |
| Nrgn | Neurogranin (protein kinase C substrate, RC3) | 3.881 | 2.85E-04 |
| Trvp6 | Transient receptor potential cation channel member 6 | 3.808 | 2.64E-05 |
| Cntnap2 | Contactin-associated protein-like 2 | -4.471 | 1.41E-04 |
| Gpr64 | G-protein-coupled receptor 64 | -4.527 | 2.05E-06 |
| Ly6a | Lymphocyte antigen 6 complex, locus A | -4.585 | 4.28E-04 |
| Unc5cl | Unc-5 homolog C (C. elegans)-like | -4.637 | 6.55E-04 |
| Sbp | Spermine-binding protein | -4.681 | 6.20E-05 |
| Hpgds | Hematopoietic prostaglandin D synthase | -4.790 | 2.61E-05 |
| Galntl5 | UDP-N-acetyl-α-d-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 | -4.804 | 7.22E-04 |
| Gabra5 | Gamma-aminobutyric acid (GABA) A receptor, alpha 5 | -5.309 | 9.81E-05 |
| Sftpd | Surfactant protein D | -5.410 | 1.14E-04 |
| Uox | Urate oxidase, pseudogene | -5.411 | 2.05E-04 |
| Ctse | Cathepsin E | -6.761 | 8.95E-04 |
| Calml3 | Calmodulin-like 3 | -7.842 | 9.63E-07 |
| Sectm1 | Secreted and transmembrane 1 | -8.130 | 3.06E-05 |
| Reg1a | Regenerating islet-derived 1 alpha | -8.255 | 5.03E-05 |
| Upk1a | Uroplakin 1A | -8.839 | 6.84E-05 |
| Rtn1 | Reticulon 1 | -9.943 | 8.23E-06 |
| Mlc1 | Megalencephalic leukoencephalopathy with subcortical cysts 1 | -11.758 | 3.67E-06 |
| Expi | Extracellular proteinase inhibitor | -13.692 | 1.96E-06 |
| Atp6v1c2 | ATPase, H transporting, V1 subunit C2 | -14.225 | 4.67E-06 |
| C6orf15 | Chromosome 6 open reading frame 15 | -253.722 | 3.51E-07 |
-
cKO: Conditional knockout; dpc: Days post coitum; WT: Wild-type.
Table 3
Selected Ingenuity top biological function categories at 0.5 dpc.
| Category | p-value | # Molecules |
|---|---|---|
| Tissue development | ||
| Tissue development | 3.12E-10 | 362 |
| Cell–cell adhesion | 3.33E-04 | 22 |
| Accumulation of monocytes | 8.34E-04 | 5 |
| Angiogenesis of organ | 1.16E-03 | 15 |
| Accumulation of phagocytes | 1.26E-03 | 22 |
| Development of endothelial tissue | 3.61E-03 | 38 |
| Accumulation of eosinophils | 5.73E-03 | 8 |
| Lipid metabolism | ||
| Synthesis of lipid | 4.66E-08 | 117 |
| Steroid metabolism | 3.13E-06 | 48 |
| Metabolism of cholesterol | 1.42E-04 | 21 |
| Metabolism of prostaglandin | 1.24E-03 | 27 |
| Synthesis of eicosanoid | 2.02E-03 | 32 |
| Synthesis of prostaglandin D2 | 3.75E-03 | 9 |
| Inflammatory response | ||
| Inflammation | 3.52E-04 | 69 |
| Accumulation of monocytes | 8.34E-04 | 5 |
| Accumulation of phagocytes | 1.26E-03 | 22 |
| Accumulation of eosinophils | 5.73E-03 | 8 |
| Accumulation of antigen-presenting cells | 8.80E-03 | 13 |
| Cellular growth and proliferation | ||
| Proliferation of endothelial cells | 3.59E-03 | 32 |
| Proliferation of endocrine cells | 4.48E-03 | 14 |
| Proliferation of chondrocytes | 5.56E-03 | 12 |
| Proliferation of epidermal cells | 7.78E-03 | 20 |
| Proliferation of B-lymphocyte-derived cell lines | 8.20E-03 | 19 |
| Proliferation of Th2 cells | 8.70E-03 | 5 |
-
dpc: Days post coitum.
Table 4
Selected Ingenuity top biological function categories at 1.5 dpc.
| Category | p-value | # Molecules |
|---|---|---|
| Tissue development | ||
| Tissue development | 3.06E-03 | 44 |
| Development of organ | 1.05E-02 | 30 |
| Aggregation of cells | 1.46E-02 | 8 |
| Organization of tissue | 1.48E-02 | 6 |
| Inflammatory response | ||
| Immune response of neutrophils | 4.91E-03 | 4 |
| Chemotaxis of antigen-presenting cells | 6.37E-03 | 5 |
| Immune response of phagocytes | 1.56E-02 | 5 |
| Cellular movement | ||
| Mobilization of cells | 6.75E-03 | 4 |
| Mobilization of neutrophils | 8.24E-03 | 2 |
| Small molecule biochemistry | ||
| Production of eicosanoid | 3.51E-03 | 7 |
| Synthesis of prostaglandin E2 | 6.13E-03 | 5 |
| Synthesis of lipid | 1.13E-02 | 15 |
-
dpc: Days post coitum.
Table 5
Protease, protease inhibitor, and antimicrobial peptide transcripts in cKO compared to WT oviducts at 0.5 dpc.
| Symbol | Entrez gene name | Fold change (cKO vs WT) | p-value |
|---|---|---|---|
| Proteases | |||
| Tmprss15 | Transmembrane protease, serine 15 | 16.41 | 2.33E-09 |
| Klk8 | Kallikrein related-peptidase 8 | 10.34 | 9.85E-04 |
| Prss42 | Protease, serine, 42 | 9.63 | 7.67E-03 |
| Prss7 | Protease, serine, 7 (enterokinase) | 8.54 | 2.34E-02 |
| Klk9 | Kallikrein related-peptidase 9 | 5.62 | 7.06E-06 |
| Prss33 | Protease, serine, 33 | 5.35 | 5.07E-04 |
| Prss51 | Protease, serine, 51 | 2.96 | 1.65E-02 |
| Prss41 | Protease, serine, 41 | 2.69 | 1.36E-04 |
| Klk7 | Kallikrein related-peptidase 7 | 2.63 | 2.55E-05 |
| Prss32 | Protease, serine, 32 | 2.45 | 3.10E-02 |
| Tmprss13 | Transmembrane protease, serine 13 | 2.14 | 6.83E-03 |
| Cma1 | Chymase 1, mast cell | 2.05 | 2.53E-02 |
| Prss35 | Protease, serine, 35 | 1.90 | 3.10E-02 |
| Prss34 | Protease, serine, 34 | 1.89 | 1.92E-02 |
| Mcpt4 | Mast cell protease 4 | 1.82 | 3.45E-02 |
| Prss23 | Protease, serine, 23 | 1.66 | 3.54E-02 |
| Tmprss6 | Transmembrane protease, serine 6 | 1.52 | 4.69E-04 |
| Ctsd | Cathepsin D | 1.51 | 4.89E-02 |
| Prss3 | Protease, serine, 3 | -1.81 | 3.10E-02 |
| Klk1b3 | Kallikrein 1-related peptidase b3 | -2.08 | 2.86E-02 |
| Klk1b8 | Kallikrein 1-related peptidase b8 | -2.31 | 2.44E-03 |
| Prss58 | Protease, serine, 58 | -2.46 | 1.27E-02 |
| Klk1b26 | Kallikrein 1-related peptidase b26 | -4.01 | 4.57E-02 |
| Klk1b11 | Kallikrein 1-related peptidase b11 | -4.04 | 1.25E-02 |
| Klk1 | Kallikrein 1 | -4.08 | 1.11E-03 |
| Prss29 | Protease, serine, 29 | -4.20 | 3.96E-02 |
| Klk12 | Kallikrein related-peptidase 12 | -4.68 | 2.05E-03 |
| Klk1b24 | Kallikrein 1-related peptidase b24 | -6.13 | 3.12E-03 |
| Klk1b21 | Kallikrein 1-related peptidase b21 | -8.85 | 4.72E-03 |
| Klk1b27 | Kallikrein 1-related peptidase b27 | -9.65 | 2.72E-03 |
| Prss28 | Protease, serine, 28 | -28.09 | 2.34E-02 |
| Protease inhibitors | |||
| Serpini2 | Serine (or cysteine) peptidase inhibitor, clade I (pancpin), member 2 | 6.99 | 3.89E-02 |
| Serpinb7 | Serine (or cysteine) peptidase inhibitor, clade B (Ovalbumin), member 7 | 6.28 | 2.63E-02 |
| Serpinb9f | Serine (or cysteine) peptidase inhibitor, clade B, member 9f | 5.97 | 3.82E-02 |
| Serpinb12 | Serine (or cysteine) peptidase inhibitor, clade B, member 12 | 2.05 | 1.12E-02 |
| Serpine2 | Serine (or cysteine) peptidase inhibitor, clade E, member 2 | 1.79 | 4.87E-02 |
| Cstb | Cystatin B (stefin B) | -1.76 | 2.25E-04 |
| Serpinb11 | Serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 11 | -2.10 | 2.99E-03 |
| Fetub | Fetuin beta | -2.25 | 1.14E-02 |
| Csta | Cystatin A (stafin A) | -2.65 | 3.80E-03 |
| Serpine1 | Serine (or cysteine) peptidase inhibitor, clade E, member 1 | -2.69 | 4.02E-02 |
| Serpina3b | Serine (or cysteine) peptidase inhibitor, clade A, member 3B | -3.30 | 2.49E-02 |
| Serpina1b | Serine (or cysteine) peptidase inhibitor, clade A, member 1B | -3.49 | 5.80E-03 |
| Serpina1e | Serine (or cysteine) peptidase inhibitor, clade A, member 1E | -4.04 | 4.02E-02 |
| Serpina9 | Serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 | -4.22 | 2.52E-03 |
| Wfdc18 (or Expi) | WAP four-disulfide core domain 18 (or extracellular proteinase inhibitor) | -13.69 | 1.96E-06 |
| Antimicrobial peptides | |||
| Defb8 | Defensin, beta 8 | 13.12 | 2.78E-02 |
| Defa38 | Defensin, alpha 38 | 3.48 | 2.42E-02 |
| Defa3 | Defensin, alpha 3 | 2.21 | 3.35E-05 |
| Defb116 | Defensin, beta 116 | -2.50 | 1.03E-02 |
| Defb103b | Defensin, beta 103B | -3.24 | 1.06E-03 |
| Defa4 | Defensin, alpha 4 | -5.70 | 3.46E-02 |
| Defb34 | Defensin, beta 34 | -10.02 | 6.15E-05 |
-
cKO: Conditional knockout; dpc: Days post coitum; WT: Wild-type.
Table 6
List of the primer sequences used for real-time RT-PCR reactions.
| Symbol | Entrez gene name | Sequences (Forward ([F]) and Reverse [(R]):5’ → 3’ |
|---|---|---|
| Cdh16 | Cadherin 16 | F: GCATTGCCCAGGTGCACTGGA R: AAGGGTCCTGGAGGCTGGCT |
| Ctsd | Cathepsin D | F: GACAACAATAGGGTCGGCTT R: GCTGGCTTCCTCTACTGGAC |
| Cxcl17 | Chemokine (C-X-C motif) ligand 17 | F: AAGCCACGGGGACCAACACC R: GGCTTGCAGGAACCAATCTTTGC |
| Drd4 | Dopamine receptor 4 | F: TGGACGTCATGCTGTGCACCG R: GGTCACGGCCACGAACCTGTC |
| Fetub | Fetuin B | F: ACGTCTAGCCTTCTGCGATT R: TCCACTGTAAGCCACTCTGC |
| Hpgds | Hemopoietic prostaglandin D synthase | F: GGACTTACAATCCACCAGAGC R: TCCCAGCCAAATCTGTGTTTT |
| Il17 | Interleukin 17 | F: CTGGAGGATAACACTGTGAGAGT R: TGCTGAATGGCGACGGAGTTC |
| Il17rb | Interleukin 17 receptor B | F: TCAGCGCCCATAACATCCCCA R: ACGTGGTTTAGGCAGCCTGGC |
| Klk8 | Kallikrein related-peptidase 8 | F: GTTCCACCCTCTTCCTCAGA R: CTCCCATGAACAGAAGCAGA |
| Krt8 | Keratin 8 | F: TGAAGAAGGATGTGGACTGTGCCT R: ATGCGGGTCTCCTCGTCATACATT |
| Muc4 | Mucin 4 | F: ACCATGTCTTGGGGAACGTC R: ATGCAGGTGAGGTATTCCTGA |
| Rpl7 | Ribosomal protein L7 | F: AGCTGGCCTTTGTCATCAGAA R: GACGAAGGAGCTGCAGAACCT |
| Rtn1 | Reticulon 1 | F: AACGTCGTCGCGGGAACTGT R: AGCTGCCATACCTGTGGATGCAGT |
| Sct | Secretin | F: CCCACGCCGATGCTACTGCT R: TCTTGGGGTCCTGGGAGGTGC |
| Serpina1b | Serine (or cysteine) peptidase inhibitor, clade A, member 1B | F: ATCACCCGGATCTTCAACAA R: CTCATCGATGGTCAGCACAG |
| Serpina9 | Serine (or cysteine) peptidase inhibitor, clade A, member 9 | F: CAGGTGAGACTCCCTTCCTT R: GTGGGAGGACTCTTGGTTGT |
| Serpinb11 | Serine (or cysteine) peptidase inhibitor, clade B, member 11 | F: TCTTCTGAGTGCAGCCAAGT R: AACGCTGAGGGAGTTCTGTT |
| Serpine1 | Serine (or cysteine) peptidase inhibitor, clade E, member 11 | F: ACCGGAATGTGGTCTTCTCT R: TGCCCTTCTCATTGACTTTG |
| Tmprss13 | Transmembrane protease, serine 13 | F: ATAGGTCGCAATGTCCTTCC R:TCTCAAACCACAGTGGGAAC |
| Tshr | Thyroid stimulating hormone receptor | F: CCTGACAGCTATAGACAACGATGCC R: ACGCTGGTGGAAGACACATCTAGCA |
| Wfdc18 (or Expi) | WAP four-disulfide core domain 18 (or extracellular proteinase inhibitor) | F: TTTGTTCTGGTAGCTTTGATTTTCA R: GCGCCAGGTTTTTCTTTGG |
