Uev1A counteracts oncogenic Ras stimuli in both polyploid and diploid cells

  1. Qi Zhang
  2. Yunfeng Wang
  3. Xueli Fu
  4. Ziguang Wang
  5. Yang Zhang
  6. Lizhong Yan
  7. Yuejia Wang
  8. Muhan Yang
  9. Dongze Song
  10. Ruixing Zhang
  11. Hongru Zhang  Is a corresponding author
  12. Shian Wu  Is a corresponding author
  13. Shaowei Zhao  Is a corresponding author
  1. Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, China
  2. Department of Biochemistry and Molecular Biology, College of Life Sciences, Nankai University, China
  3. Nankai International Advanced Research Institute (SHENZHEN FUTIAN), China

eLife Assessment

This valuable study examines the role of E2 ubiquitin enzyme, Uev1a in tissue resistance to oncogenic RasV12 in Drosophila melanogaster polyploid germline cells and human cancer cell lines. The solid evidence suggests that Uev1a works with the E3 ligase APC/C to degrade Cyclin A. This work would be of interest to researchers in germline biology and cancer.

https://doi.org/10.7554/eLife.107104.3.sa0

Abstract

Oncogenic Ras is known to induce DNA replication stress, leading to cellular senescence or death. In contrast, we found that it can also trigger polyploid Drosophila ovarian nurse cells to die by inducing aberrant division stress. To explore intrinsic protective mechanisms against this specific form of cellular stress, here, we conducted a genome-wide genetic screen and identified the E2 enzyme Uev1A as a key protector. Reducing its expression levels exacerbates the nurse cell death induced by oncogenic Ras, while overexpressing it or its human homologs, UBE2V1 and UBE2V2, mitigates this effect. Although Uev1A is primarily known for its non-proteolytic functions, our studies demonstrate that it collaborates with the E3 APC/C complex to mediate the proteasomal degradation of Cyclin A, a key cyclin that drives cell division. Furthermore, Uev1A and UBE2V1/2 also counteract oncogenic Ras-driven tumorigenesis in diploid cells, suppressing the overgrowth of germline tumors in Drosophila and human colorectal tumor xenografts in nude mice, respectively. Remarkably, elevated expression levels of UBE2V1/2 correlate with improved survival rates in human colorectal cancer patients harboring oncogenic KRAS mutations, indicating that their upregulation could represent a promising therapeutic strategy.

Introduction

Although the human body contains trillions of cells that could potentially be targeted by oncogenic mutations, cancers arise infrequently throughout a human lifetime, suggesting the presence of effective resistance mechanisms (Lowe et al., 2004). One key mechanism involves the induction of DNA replication stress by these oncogenic mutations, leading to cellular senescence or death (Hills and Diffley, 2014; Kotsantis et al., 2018). This mechanism is mediated through the activation of the DNA damage response (DDR) pathway and the tumor suppressor protein p53, which are triggered by DNA double-strand breaks (DSBs). Only the cells that escape senescence and death, such as those harboring p53 mutations, can undergo transformation by oncogenic mutations, thereby initiating tumorigenesis (Gaillard et al., 2015; Igarashi et al., 2024; Macheret and Halazonetis, 2015). Among the most frequently mutated oncogenes in human cancers are the RAS genes (KRAS, NRAS, and HRAS), which mutations are present in 20–30% of all cancer cases (Gimple and Wang, 2019; Sanchez-Vega et al., 2018). These mutations often occur at codons 12, 13, and 61, resulting in RAS small GTPases being locked in a constitutively active, GTP-bound state (Moore et al., 2020). Notably, previous studies have shown that oncogenic HRASG12V can induce DNA replication stress via the DDR pathway, ultimately leading to cellular senescence (Di Micco et al., 2006; Serrano et al., 1997).

The Ras oncogene at 85D gene (Ras85D, hereafter referred to as Ras) in Drosophila exhibits high homology to human RAS genes (Neuman-Silberberg et al., 1984). Our previous research demonstrated that oncogenic RasG12V triggers cell death in Drosophila ovarian nurse cells (Zhang et al., 2024b), a type of post-mitotic germ cells that undergo G/S endoreplication to become polyploid (Hammond and Laird, 1985; Figure 1A). Notably, oncogenic RasG12V promotes the division of mitotic germ cells, the precursors to nurse cells. Furthermore, monoallelic deletion of the cyclin A (cycA) or cyclin-dependent kinase 1 (cdk1) gene (cycA+/- or cdk1+/-) suppresses RasG12V-induced nurse cell death (Zhang et al., 2024b). While CycA, a key cyclin promoting cell division, is not expressed in normal nurse cells (Lilly et al., 2000; Lilly and Spradling, 1996), its ectopic expression in nurse cells can trigger their death (as observed in this study). These findings suggest that the nurse cell death induced by oncogenic RasG12V is primarily due to aberrant promotion of cell division. Drosophila ovarian nurse cells thus offer a valuable model for studying this specific form of cellular stress.

Genetic screen identifies Uev1A as a crucial protector against RasG12V-induced nurse cell death.

(A) Schematic cartoon for Drosophila ovariole. During oogenesis, germline stem cell (GSC) undergoes asymmetric division to generate two daughter cells: one that self-renews and maintains GSC identity, and the other, called a cystoblast, that differentiates to support oogenesis. As differentiation progresses, each cystoblast performs four rounds of division with incomplete cytokinesis to produce 16 interconnected cystocytes, establishing a germline cyst. This germline cyst is then surrounded by epithelial follicle cells to form an egg chamber. Within each egg chamber, one of the 16 germ cells becomes the oocyte, while the remaining 15 differentiate into nurse cells. These nurse cells undergo G/S endocycling, becoming polyploid to aid in oocyte development. (B) Representative germarium and early-stage egg chamber with Flag-RasG12V overexpression driven by bam-GAL4-VP16. The red arrow denotes an early-stage egg chamber. (C) Genetic screening strategy. Genotype of ‘bam>RasGG12V’: bam-GAL4-VP16/FM7;; UASp-RasG12V/TM6B. (D) Representative ovaries and egg chambers (DAPI staining). The red arrows in (D) denote degrading egg chambers. Scale bars: 200 μm. (E) Quantification data. 30 ovaries from 7-day-old flies were quantified for each genotype. Statistical significance was determined using t test (groups = 2) or one-way ANOVA (groups >2): ** (p<0.01) and *** (p<0.001).

Ubiquitination not only mediates protein degradation through the proteasome or lysosome but also plays crucial regulatory roles in various biological processes (Dikic, 2017; Kwon and Ciechanover, 2017). These functions are largely determined by the topological structures of the polyubiquitin chains, where ubiquitin can be linked to another ubiquitin via any of its seven lysine (K) residues or its first methionine residue. Among these, K11- and K48-linked polyubiquitin primarily mediates the proteasomal degradation. In contrast, K63 linkage facilitates the lysosomal degradation of protein aggregates and damaged organelles through autophagy. Additionally, K63 linkage is involved in non-degradative processes such as DNA repair, kinase activation, and protein transport (Kwon and Ciechanover, 2017). Ubc13 is a ubiquitin-conjugating (E2) enzyme that specifically catalyzes the formation of the K63 linkage. However, this activity requires a unique cofactor known as Ubc variant (Uev). Uev proteins lack the catalytic cysteine residue necessary for ubiquitin thioester formation; instead, they work with Ubc13 to form a functional E2 complex (Hofmann and Pickart, 1999; McKenna et al., 2001). These E2 enzymes have been shown to play regulatory roles in various biological processes, including cell death (Ma et al., 2013), DNA repair (Broomfield et al., 1998), DDR, and innate immunity (Andersen et al., 2005; Bai et al., 2020; Zhou et al., 2005). However, it still remains unknown whether they also possess proteasomal proteolytic functions and whether such functions hold significant biological roles.

In this study, to investigate the intrinsic protective mechanisms against RasG12V-induced nurse cell death in Drosophila, we conducted a genome-wide genetic screen and identified Uev1A as a crucial protector. Mechanistically, Uev1A works in conjunction with the anaphase-promoting complex or cyclosome (APC/C) to degrade the essential cyclin CycA via the proteasome, highlighting the critical role of its proteolytic function. Additionally, Uev1A and its human homologs, UBE2V1 and UBE2V2, also counteract oncogenic Ras-driven tumorigenesis in diploid cells, inhibiting the overgrowth of Drosophila germline tumors and human colorectal tumor xenografts in nude mice, respectively. These findings suggest that upregulation of UBE2V1/2 could represent a promising therapeutic approach for human colorectal cancers with RAS mutations.

Results

Genetic screen identifies Uev1A as a crucial protector against RasG12V-induced nurse cell death

While oncogenic RasG12V triggers cell death in nurse cells, it does not have the same effect in cystocytes, the precursor cells before differentiating into nurse cells (Zhang et al., 2024b). To confirm RasG12V expression in cystocytes, we generated a UASz-flag-RasG12V transgenic fly strain, which phenocopied the effects observed with the previously used UASp-RasG12V. RAS small GTPases need to be anchored to the inner cell membrane for their proper function (Willingham et al., 1980). Using bam-GAL4-VP16 (Chen and McKearin, 2003), we overexpressed RasG12V specifically in cystocytes (bam>flag-RasG12V) at 29°C and observed membrane-localized Flag signals, validating the normal expression of RasG12V (Figure 1B). Also, Flag signals were detected in some early-stage nurse cells, although these signals gradually diminished over time (Figure 1B). During cell death, nurse cell nuclei progress through distinct morphological stages: from large and round, to disorganized and condensed, and finally to completely fragmented into small, spherical structures (Figure 1D). Given the interconnection and synchronous death of all nurse cells within an egg chamber, we quantified this death phenotype at the egg-chamber level. Notably, nurse cell death remained very low in bam>flag-RasG12V fly ovaries (Figure 1D and E). This may be attributed to either insufficient levels of the oncoproteins or the presence of a protective mechanism.

To explore the potential protective mechanism, we conducted a genetic modifier screen by introducing individual genome-wide Deficiencies (361 lines) into bam>RasGG12V flies (bam>RasGG12V; Deficiency/+, Figure 1C). Of note, ovaries from bam>RasGG12V; Df#7584/++ flies exhibited the highest incidence of degrading egg chambers with dying nurse cells per ovary (see Source data 1). One gene deleted in this deficiency line is uev1a, and RNAi targeting uev1a reproduced the phenotype seen with Df#7584 (Figure 1D and E). In this and all subsequent experiments, we quantified the nurse-cell-death phenotype using the percentage of degrading to total egg chambers per ovary (Figure 1E), a method that is more precise than our approach in the genetic screen. To further verify the role of uev1a, we generated a UASz-uev1a transgenic fly strain. Overexpression of Uev1A, but not GFP (UASp-GFP; Zhang et al., 2024a), successfully rescued the nurse-cell-death phenotype in bam>RasGG12V; Df#7584/++ fly ovaries (Figure 1D and E), confirming that Uev1A is a crucial protector against RasG12V-induced nurse cell death.

Protective role of Uev1A against the nurse cell death induced by direct overexpression of RasG12V

In contrast to the scenario above (bam>RasGG12V), direct overexpression of RasG12V in nurse cells using nos-GAL4-VP16 (Rørth, 1998; Van Doren et al., 1998) (nos>RasGG12V) resulted in substantial cell death even at 25°C (Figure 2A and D; Zhang et al., 2024b). Such observation prompted us to investigate the role of Uev1A in this context. Notably, the incidence of dying nurse cells was markedly elevated in nos>RasGG12V+uev1a-RNAi ovaries compared to the nos>RasGG12V+GFP-RNAi control ovaries (Figure 2A and D). To further validate this, we generated two uev1a mutants using the CRISPR/Cas9 technique: uev1aΔ1 and uev1aΔ2. Both mutations consist of small deletions that cause frame shifts within the second coding exon of the uev1a gene (Figure 2B). Of note, flies with the uev1aΔ1/Δ1, uev1aΔ1/Δ2, uev1aΔ1/Df#7584, uev1aΔ2/Δ2, or uev1aΔ2/Df#7584 genotype could not survive into adults, suggesting that both mutations are strong loss-of-function alleles. Consistent with the effects observed with uev1a-RNAi, either mutation markedly increased the incidence of dying nurse cells in nos>RasGG12V ovaries (Figure 2C and D).

Figure 2 with 1 supplement see all
Uev1A protects against the nurse cell death induced by direct overexpression of RasG12V.

(A, C, and F) Representative samples (DAPI staining). (B) Molecular information of the uev1aΔ1 and uev1aΔ2 mutations. The red dashed lines represent nucleotide deletions. (D and G) Quantification data. 30 ovaries from 3-day-old flies were quantified for each genotype. Statistical significance was determined using t test (groups = 2) or one-way ANOVA (groups>2): **** (p<0.0001). (E) Protein sequence alignment of Uev1A, UBE2V1, and UBE2V2. It was performed using CLUSTALW and ESPript 3.0 software.

We next investigated whether upregulating Uev1A could mitigate the nurse cell death induced by direct overexpression of RasG12V. Remarkably, compared to the nos>RasGG12V+lacZ control ovaries, the incidence of dying nurse cells was significantly reduced in nos>RasGG12V+Uev1A ovaries (Figure 2F and G). Uev1A has two human homologs, UBE2V1 and UBE2V2, which share 67% (85%) and 67% (86%) sequence identities (similarities) with Uev1A, respectively (Figure 2E). We generated transgenic fly strains for both UASz-UBE2V1 and UASz-UBE2V2. Notably, overexpression of either UBE2V1 or UBE2V2, but not lacZ (UASz-lacZ; Zhang et al., 2024b), significantly mitigated RasG12V-induced nurse cell death, similar to the effects observed with Uev1A overexpression (Figure 2F and G). Taken together, these results further confirm the protective role of Uev1A against RasG12V-induced nurse cell death.

Then, we were intrigued by the potential of Uev1A to protect against the nurse cell death induced by other oncogenic mutations. Yorkie (Yki), a key oncoprotein in the Hippo pathway (Huang et al., 2005), has a hyperactive form known as Yki3SA (Oh and Irvine, 2009). Its overexpression (nos>Yki3SA; UASz-Yki3SA; Zhang et al., 2024a) at 29°C, but not at 25°C, could induce nurse cell death (Figure 2—figure supplement 1), albeit much less severe than that induced by nos>RasGG12V at 25°C (compared with Figure 2A and D). Of note, the nurse cell death induced by oncogenic Yki3SA was significantly alleviated by Uev1A overexpression (Figure 2—figure supplement 1), implying a broad role of Uev1A in this process. However, due to the mild effect of Yki3SA on triggering nurse cell death, we focused on RasG12V in our subsequent studies.

The DDR pathway and p53 play opposite roles in RasG12V-induced nurse cell death

To investigate how Uev1A protects against RasG12V-induced nurse cell death, we first sought to further explore the mechanisms driving this cell death. Since egg chambers contain both nurse cells and oocytes (Figure 1A), we considered the possibility that the death signal could originate from oocytes. The Bicaudal D (BicD) gene is essential for oocyte determination, and egg chambers deficient in it fail to specify oocytes (Suter and Steward, 1991). We confirmed this by using nos>BicD-RNAi (Figure 3—figure supplement 1A). Importantly, nurse cell death was much more pronounced in nos>BicD-RNAi+RasGG12V egg chambers than in nos >BicD-RNAi+GFP control ones (Figure 3—figure supplement 1A and B), indicating that the death signal is intrinsic to nurse cells rather than originating from oocytes.

Oncogenic RAS can induce DNA replication stress in diploid cells, thereby activating the DDR pathway and p53 to trigger cellular senescence or death (Di Micco et al., 2006; Serrano et al., 1997). To investigate whether DDR plays a similar role in RasG12V-induced nurse cell death, we targeted two key DDR genes: telomere fusion (tefu, encoding Drosophila ATM) (Oikemus et al., 2004; Silva et al., 2004; Song et al., 2004) and loki (lok, encoding Drosophila Chk2) (Masrouha et al., 2003; Xu et al., 2001). Strikingly, knockdown of either gene markedly enhanced this cell death (Figure 3A and B), revealing a protective role for the DDR pathway. By contrast, knockdown of p53 suppressed this cell death (Figure 3A and B), demonstrating opposing functions for DDR and p53 in this context. To assess DNA DSBs and the ensuing DDR, we monitored the phosphorylation of γH2AV, the Drosophila histone variant analogous to mammalian H2AX (Lake et al., 2013). As egg chamber developmental stages are difficult to discern during degradation, we compared size-matched egg chambers, which are typically stage-matched under normal conditions and have comparable antibody penetration. Elevated γH2AV staining was observed in degrading nos>RasGG12V egg chambers compared to nos>GFP controls (Figure 3C), indicating a heightened burden of DNA DSBs.

Figure 3 with 3 supplements see all
Roles of the DNA damage response (DDR) pathway and p53 in RasG12V-induced nurse cell death.

(A) Representative ovaries (DAPI staining). Scale bars: 200 μm. (B) Quantification data. 30 ovaries from 3-day-old flies were quantified for each genotype. Statistical significance was determined using one-way ANOVA: **** (p<0.0001). (C and E) Representative samples. Scale bars: 20 μm. (D) Schematic cartoon for uev1a-flag knock-in.

Given that RNAi targeting tefu or lok phenocopied that of uev1a, we hypothesized that Uev1A protects against RasG12V-induced nurse cell death through the DDR pathway. If so, Uev1A may also be upregulated in response to RasG12V-driven stress. To test this, we initially attempted to generate an antibody against Uev1A using its full protein sequence as the antigen; however, this approach was unsuccessful. As an alternative, we created a uev1a-flag knock-in fly strain by inserting the coding sequence of a 3xFlag tag immediately before the stop codon (‘TAG’) of the uev1a gene (Figure 3D). These knock-in flies were homozygous viable and fertile, indicating that the Flag insertion did not disrupt Uev1A’s normal function. Previous studies have shown that Uev1A can activate JNK signaling (Ma et al., 2013), which acts in the surrounding follicle cells to promote nurse cell removal during late oogenesis (Timmons et al., 2016). Indeed, we detected Uev1A-Flag signals in such follicle cells (Figure 3—figure supplement 2), confirming that these signals reflect endogenous Uev1a expression in Drosophila ovaries. Surprisingly, Uev1A-Flag signals were low in both nos>RasGG12V; uev1a-flag/++ and uev1a-flag/++ control nurse cells, with no significant differences between the two groups (Figure 3E). This suggests that Uev1A expression remains at basal levels, rather than being upregulated by RasG12V-driven stress in this context. Although we cannot rule out the possibility that Uev1A may play a role in the DDR pathway at these basal levels, these findings prompted us to explore its potential proteolytic function as an E2 enzyme.

Following the Occam’s Razor principle, we first investigated whether Uev1A is involved in downregulating RasG12V oncoprotein levels. To address the challenges of analyzing membrane-localized signals in nos>flag-RasG12V nurse cells due to severe cell death, we performed this assay in bam>flag-RasG12V ovaries at 29°C. Notably, similar membrane-localized Flag signals were detected in both bam>flag-RasG12V+Uev1A and bam>flag-RasG12V+GFP control germ cells, including nurse cells (Figure 3—figure supplement 3). This result suggests that Uev1A does not downregulate RasG12V oncoprotein levels.

Uev1A downregulates CycA protein levels in RasG12V-induced dying nurse cells

Our previous research demonstrated that oncogenic RasG12V promotes germline stem cell (GSC) over-proliferation by activating the mitogen-activated protein kinase (MAPK) pathway (Zhang et al., 2024b). This finding led us to investigate whether the same pathway influences RasG12V-induced nurse cell death. Notably, knockdown of downstream of raf1 (dsor1, encoding Drosophila MAPKK) (Tsuda et al., 1993) or rolled (rl, encoding Drosophila MAPK) (Biggs and Zipursky, 1992) significantly mitigated RasG12V-induced nurse cell death (Figure 4A and B), highlighting the pivotal role of the MAPK pathway in this process.

Uev1A collaborates with CycA to mitigate RasG12V-induced nurse cell death.

(A, C, E, and F) Representative ovaries. DAPI staining in (A and C). Scale bars: 200 μm in (A and C), 20 μm in (E and F). (B, D, and G) Quantification data. 30 ovaries (B and D) and 15 size-matched egg chambers (G) from 3-day-old flies were quantified for each genotype. Statistical significance was determined using t test (groups = 2) or one-way ANOVA (groups >2): **** (p<0.0001).

The Ras/MAPK pathway is well known to promote cell cycle progression (Gimple and Wang, 2019). Our previous work demonstrated that reducing the gene dosage of CycA or Cdk1 suppresses RasG12V-induced nurse cell death (Zhang et al., 2024b). In addition to CycA and Cdk1, Cyclin B (CycB) and String (Stg) are two other essential regulators that drive cell division (Figure 4C; Edgar and Lehner, 1996). To determine if individual overexpression of these regulators could induce nurse cell death, we tested each and found that only CycA triggered this phenotype (Figure 4C and D). Notably, this cell death was suppressed by co-overexpression of CycA and Uev1A (Figure 4C and D), indicating a genetic interaction between them. In line with previous findings (Lilly et al., 2000; Lilly and Spradling, 1996), CycA protein was undetectable in wild-type endocycling nurse cells when assessed using an anti-CycA antibody (Whitfield et al., 1990; Figure 4E). In stark contrast, it was abundantly expressed in dying nos>RasGG12V nurse cells (Figure 4E), underscoring a critical role for CycA in this cell death process. Additionally, we assessed CycA protein levels in size-matched nos>RasGG12V nurse cells under either uev1a or GFP (control) knockdown condition. Notably, uev1a knockdown increased CycA levels compared with the controls (Figure 4F and G), demonstrating that Uev1A downregulates CycA protein levels in RasG12V-induced dying nurse cells.

Uev1A collaborates with the APC/C complex to mitigate RasG12V-induced nurse cell death

It is well established that the APC/C complex primarily functions as an E3 ligase to facilitate the degradation of CycA during cell cycle progression (Sudakin et al., 1995). Thus, a compelling model to explain our findings is that Uev1A collaborates with the APC/C complex to degrade CycA. Cell division cycle 27 (Cdc27, Drosophila APC3) is an essential part of the substrate recognition TPR lobe within the APC/C complex (Yamano, 2019). In bam>RasGG12V+cdc27-RNAi ovaries, we observed dying nurse cells, a phenotype that was exacerbated with mutations in either uev1aΔ1 or uev1aΔ2 (Figure 5A and B). Furthermore, knocking down cdc27 could increase the incidence of dying nurse cells in bam>RasGG12V+uev1a-RNAi ovaries (Figure 5A and B). Also, we investigated Fizzy-related (Fzr), the Drosophila homolog of Cdh1, that is a critical activator of APC/C-dependent proteolysis. It is known that Fzr functions to downregulate mitotic cyclins, including CycA, during cell entry into endocycles (Sigrist and Lehner, 1997). Remarkably, nearly all egg chambers in bam>RasGG12V+uev1a-RNAi+fzr-RNAi ovaries exhibited degradation (Figure 5A and B). Additionally, we knocked down three additional APC/C complex genes in bam>RasGG12V+uev1a-RNAi ovaries: shattered (shtd, encoding Drosophila APC1) (Tanaka-Matakatsu et al., 2007), morula (mr, encoding Drosophila APC2) (Kashevsky et al., 2002), and lemming A (lmgA, encoding Drosophila APC11) (Nagy et al., 2012). Among these factors, Shtd is a critical component of the scaffolding platform, while Mr and LmgA are essential components of the catalytic modules within the APC/C complex (Yamano, 2019). However, no significant enhancement in nurse cell death was observed, which may be due to the relatively mild phenotype of nurse cell death in bam>RasGG12V+uev1a-RNAi ovaries. Therefore, we switched to knocking down these genes in nos>RasGG12V ovaries. Notably, knockdown of any of them could significantly exacerbate RasG12V-induced nurse cell death (Figure 5C and D), similar to the effect observed with Uev1A downregulation. Collectively, these findings provide genetic evidence that Uev1A collaborates with the APC/C complex to mitigate RasG12V-induced nurse cell death.

Figure 5 with 2 supplements see all
Uev1A collaborates with the anaphase-promoting complex or cyclosome (APC/C) complex to mitigate RasG12V-induced nurse cell death.

(A and C) Representative ovaries (DAPI staining). The red arrows in (A) denote degrading egg chambers. Scale bars: 200 μm. (B and D) Quantification data. 30 ovaries from 7-day-old (B) or 3-day-old (D) flies were quantified for each genotype. Statistical significance was determined using one-way ANOVA: **** (p<0.0001).

Then, we investigated whether Uev1A and the APC/C complex protect nurse cells from death during normal oogenesis. Given that the G2/M-promoting CycA is absent in the G/S-endocycling nurse cells (Figure 4E; Lilly et al., 2000; Lilly and Spradling, 1996), we used the cystocyte-specific driver, bam-GAL4-VP16, to conduct the assays at 29°C. Similar to nurse cells, Uev1A expression was at basal levels in cystocytes, with some expression detected in inner sheath cells and epithelial follicle cells (Figure 5—figure supplement 1). Remarkably, nearly all egg chambers in bam>fzr-RNAi ovaries exhibited degradation (Figure 5—figure supplement 2), underscoring Fzr’s critical regulatory role in this context. Uev1A typically partners with Bendless (Ben), the Drosophila homolog of mammalian Ubc13 (Muralidhar and Thomas, 1993; Oh et al., 1994), to perform the E2 enzyme function (Sancho et al., 1998; Zhou et al., 2005). Ovaries with the bam>cdc27-RNAi, bam>cdc27-RNAi+uev1a-RNAi, or bam>cdc27-RNAi+ben-RNAi genotype showed minimal degradation of egg chambers (Figure 5—figure supplement 2). However, degraded egg chambers were prevalent in bam>cdc27-RNAi+ben-RNAi; uev1aΔ1/++ and bam>cdc27-RNAi+ben-RNAi; uev1aΔ2/++ ovaries, where Uev1A, Ben, and Cdc27 are all downregulated (Figure 5—figure supplement 2). These results suggest that Uev1A, Ben, and the APC/C complex also work together to protect nurse cells from death during normal oogenesis.

Uev1A and the APC/C complex work together to degrade CycA via the proteasome

The APC/C complex is known to collaborate with the E2 enzymes UBE2C (Drosophila homolog: Vihar) and UBE2S (Drosophila homolog: Ube2S) to facilitate the proteasomal degradation of CycA during cell cycle progression (Greil et al., 2022; Yamano, 2019). This degradation involves the assembly of branched ubiquitin chains, incorporating K11, K48, and K63 linkages through a two-step mechanism (Meyer and Rape, 2014). However, the involvement of Uev1A in this process remains unexplored. To explore it, we performed biochemical assays in cultured Drosophila Schneider 2 (S2) cells, overexpressing tag-fused proteins using act-GAL4 to enhance expression efficiency. Co-immunoprecipitation (co-IP) assays revealed that Uev1A interacts with several components of the APC/C complex, including Mr (Drosophila APC2), Cdc16 (Drosophila APC6), and Cdc23 (Drosophila APC8). In addition, Cdc27 was found to interact with CycA (Figure 6A and B, Figure 6—figure supplement 1). Remarkably, RNAi targeting uev1a, ben, or cdc27 significantly stabilized CycA proteins after the treatment with cycloheximide (CHX), an inhibitor of protein synthesis (Figure 6C and D and Figure 6—figure supplement 2). Since the K63 linkage primarily mediates lysosomal degradation via autophagy (Kwon and Ciechanover, 2017), we tested CycA stabilization with a chloroquine (CQ, a lysosome inhibitor) or MG132 (a proteasome inhibitor) treatment. Notably, MG132, but not CQ, treatment significantly stabilized CycA proteins (Figure 6E). These results suggest that Uev1A, Ben, and Cdc27 cooperate to promote CycA degradation through the proteasome rather than the lysosome.

Figure 6 with 2 supplements see all
Uev1A, Ben, and Cdc27 work together to degrade CycA through the proteasome.

(A and B) Co-immunoprecipitation (co-IP) assays. The tagged proteins were co-expressed in S2 cells to assess physical interactions. As shown in (A), Uev1A interacts specifically with three APC/C subunits: Mr (APC2), Cdc16 (APC6), and Cdc23 (APC8). Assays in (B) demonstrate a physical interaction between CycA and Cdc27 (APC3). (C–E) CycA stability assays. CHX: a protein-synthesis inhibitor; MG132: a proteasome inhibitor; CQ: a lysosome inhibitor. In (D), the relative levels of CycA proteins were quantified using the following formula: (Mean gray value of the CycA/β-Actin band at n hours post-treatment) ÷ (Mean gray value of the CycA/β-Actin band at 0 hr). Three independent replicates were conducted at each time point, and statistical significance was determined using two-way ANOVA with multiple comparisons: **** (p<0.0001). (F and G) CycA ubiquitination assays in S2 cells. As shown in (F), Cdc27 promotes CycA ubiquitination in a Uev1A/Ben-dependent manner. Assays in (G) indicate that the K11 and K63 of ubiquitin are required for CycA ubiquitination.

Figure 6—source data 1

PDF files that contain original western blots indicating the relevant bands and treatments.

https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-data1-v1.zip
Figure 6—source data 2

Original files for western blot analysis.

https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-data2-v1.zip

To directly validate this, we performed ubiquitination assays for CycA in S2 cells. Cdc27 significantly enhanced CycA ubiquitination, while this effect was markedly reduced upon the knockdown of uev1a, ben, or both (Figure 6F). This result indicates that both Uev1A and Ben are essential for APC/C-mediated proteasomal degradation of CycA. Furthermore, we explored the roles of the seven lysine (K) residues in ubiquitin for polyubiquitin chain formation. The 7KR (lysine to arginine) mutation completely abolished Cdc27-promoted polyubiquitination of CycA. Intriguingly, the 6KR+K48 mutation, in which all K residues except K48 were mutated to R residues, failed to restore polyubiquitination. In contrast, either 6KR+K11 or 6KR+K63 mutation significantly restored polyubiquitination (Figure 6G). These findings suggest that the K11 and K63 linkages are primarily responsible for CycA polyubiquitination in Drosophila cells. Together with previous studies (Hofmann and Pickart, 1999; McKenna et al., 2001), we propose that Uev1A and Ben mediate the K63 linkage in this process.

Uev1A inhibits the overgrowth of Drosophila germline tumors driven by oncogenic RasG12V

Given the absence of cell division in normal polyploid nurse cells (Hammond and Laird, 1985), their death induced by division-promoting RasG12V represents an artificial stress. Notably, Uev1A was not upregulated in response to this stress (Figure 3E), and it executed the function through degrading CycA (Figures 46). These findings prompted us to investigate whether Uev1A also counteracts oncogenic Ras-driven tumorigenesis in diploid cells, which undergo normal cell division. Our prior research demonstrated that oncogenic RasG12V markedly promotes the overgrowth of diploid bam-deficient germline tumors (Zhang et al., 2024b), which are highly resistant to cell death (Zhang et al., 2023; Zhao et al., 2018). Intriguingly, knocking down uev1a significantly enhanced the overgrowth of these tumors, while overexpressing Uev1A suppressed it (Figure 7A and B). These results indicate that Uev1A also plays a role in counteracting oncogenic Ras-driven tumorigenesis in diploid cells.

Uev1A inhibits the overgrowth of germline tumors induced by oncogenic RasG12V.

(A and C) Representative ovaries (DAPI staining). All images in (A) are of the same magnification. Scar bars in (C): 200 μm. (B) Quantification data for ovarian size. The largest 2D area of each ovary in a single confocal focal plane was scanned, and its size was measured using ImageJ. 30 ovaries from 3-day-old flies were analyzed for each genotype. (D) Representative samples. The germline stem cells (GSCs) within stem cell niches are outlined by yellow dashed lines. Both images are of the same magnification. (E) Quantification data for GSC numbers per germarium. Germ cells that directly contact cap cells and contain dot-like spectrosomes were counted as GSCs. 100 germaria from 14-day-old flies were quantified for each genotype. In (B and E), statistical significance was determined using t test: n.s. (p>0.05) and * (p<0.05).

Considering the therapeutic potential of gene upregulation in inhibiting tumor growth, a critical concern is its impact on normal physiological processes. In this study, we examined the impact of Uev1A overexpression on Drosophila oogenesis and GSC maintenance. Notably, the nos>Uev1A flies remained fertile, and their ovaries appeared morphologically similar to those of the nos>lacZ control flies (Figure 7C), indicating normal oogenesis. Furthermore, each germarium in the ovaries of 14-day-old nos>Uev1A flies contained a similar number of GSCs as those in the nos>lacZ control flies (Figure 7D and E). These results suggest that Uev1A overexpression does not disrupt normal oogenesis and GSC maintenance.

UBE2V1 and UBE2V2 inhibit the overgrowth of human colorectal tumors driven by oncogenic KRAS

Our findings in Drosophila prompted us to explore the tumor-suppressive effects of UBE2V1 and UBE2V2 on the growth of RAS-mutant human tumors. Using the Kaplan-Meier plotter (https://kmplot.com/analysis), we first evaluated the correlation between UBE2V1/2 expression and prognosis in several types of RAS-mutant cancer patients, including melanoma, myeloma, lung cancer, and colorectal cancer. Among them, higher expression levels of UBE2V1/2 were significantly associated with improved relapse-free survival in KRAS-mutant colorectal cancer patients (Figure 8A). RNA-seq data from The Cancer Genome Atlas (TCGA) showed that UBE2V1 and UBE2V2 are transcribed at similar levels in colorectal cancer patients with oncogenic RAS mutations (including KRAS, HRAS, and NRAS) as in those without such mutations (Figure 8—figure supplement 1). These findings suggest that UBE2V1 and UBE2V2 are not upregulated in response to oncogenic RAS mutations, paralleling the behavior of Uev1A in Drosophila ovarian nurse cells (Figure 3E).

Figure 8 with 2 supplements see all
Prognostic significance and tumor-suppressive effects of UBE2V1 and UBE2V2 on KRAS-mutant colorectal cancer.

(A) Kaplan-Meier analysis of relapse-free survival in KRAS-mutant colorectal cancer patients with high or low expression levels of UBE2V1 and UBE2V2. (B and E) The knockdown efficiency assays. The relative mRNA levels were normalized to GAPDH. (C–G) Assays to evaluate the effects of UBE2V1- and UBE2V2-RNAi on colony formation and cell viability in SW480 and HCT116 cells. In (B, C, E, and F), three independent replicates were conducted, and statistical significance was determined using t test. In (D and G), five (D) and six (G) independent replicates were conducted at each time point, and statistical significance was determined using two-way ANOVA with multiple comparisons. * (p<0.05), *** (p<0.001), and **** (p<0.0001).

To investigate the potential tumor-suppressive roles of UBE2V1 and UBE2V2 in KRAS-mutant colorectal cancer, we performed individual knockdowns of each gene in two human colorectal cancer cell lines: SW480 cells (carrying the KRASG12V mutation) and HCT116 cells (carrying the KRASG13D mutation). Notably, individual knockdown of either UBE2V1 or UBE2V2 only mildly affected the proliferation of SW480 cells (Figure 8—figure supplement 2), suggesting potential functional redundancy between the two proteins. However, combined knockdown of UBE2V1 and UBE2V2 significantly enhanced colony formation and cell viability in both SW480 and HCT116 cells, as demonstrated by clonogenic and CCK8 assays (Figure 8B–G). These results indicate that UBE2V1 and UBE2V2 exert tumor-suppressive effects in colorectal cancer cells harboring oncogenic KRAS mutations.

Next, we examined whether overexpression of UBE2V1 or UBE2V2 could suppress the growth of SW480 and HCT116 cells. The overexpression efficiency of each protein was confirmed by western blotting (Figure 9—figure supplement 1A). Using 5-ethynyl-2’-deoxyuridine (EdU) incorporation assays, we found that overexpression of either UBE2V1 or UBE2V2 significantly inhibited the proliferation of both cancer cell lines in vitro (Figure 9—figure supplement 2A and B). This antiproliferative effect was further supported by clonogenic and cell viability assays (Figure 9—figure supplement 2C–E).

To validate the tumor-suppressive effects of UBE2V1 and UBE2V2 in vivo, we established stable SW480 cell lines overexpressing each protein, with overexpression confirmed by western blotting (Figure 9—figure supplement 1B). In subcutaneous tumorigenesis assays using Balb/c nude mice, overexpression of either UBE2V1 or UBE2V2 significantly inhibited tumor formation compared to control (Figure 9A and B). Immunohistochemical analysis of the resulting tumors showed a marked decrease in Cyclin A expression and Ki-67-positive cells, indicating reduced proliferation (Figure 9C and D). Notably, the tumor-suppressive effect of UBE2V1 was more robust than that of UBE2V2, consistent with the stronger protective effect of UBE2V1 against RasG12V-induced nurse cell death in Drosophila (Figure 2F and G). Taken together, these findings provide strong evidence for the tumor-suppressive roles of UBE2V1 and UBE2V2 in KRAS-mutant colorectal cancer.

Figure 9 with 2 supplements see all
Overexpression of UBE2V1 or UBE2V2 suppresses the growth of KRAS-mutant colorectal cancer.

(A and B) Subcutaneous tumorigenesis assays in nude mice, where tumors were excised, photographed, and weighed 28 days after tumor cell injection. (C and D) Immunohistochemical staining to assess CycA expression and Ki-67 positivity in tumor tissues. All images in (C) are of the same magnification. In (B-1), six independent replicates were conducted, and statistical significance was determined using two-way ANOVA with multiple comparisons. In (B-2 and D), six independent replicates were conducted, and statistical significance was determined using one-way ANOVA. ** (p<0.01), *** (p<0.001), and **** (p<0.0001). (E) Working model. By degrading CycA, Uev1A and the E3 APC/C complex counteract oncogenic Ras stimuli, thereby protecting against cell death in polyploid Drosophila nurse cells and suppressing overgrowth in diploid Drosophila germline and human colorectal tumor cells.

Discussion

It is well established that oncogenic Ras can induce DNA replication stress, leading to cellular senescence or death (Hills and Diffley, 2014; Kotsantis et al., 2018). However, our previous (Zhang et al., 2024b) and current findings demonstrated that oncogenic RasG12V can also trigger cell death in polyploid Drosophila ovarian nurse cells through aberrantly promoting their division. In this study, we performed a genome-wide genetic screen and identified the E2 enzyme Uev1A as a crucial protector against this specific form of cellular stress. Mechanistically, Uev1A collaborates with the APC/C complex (E3) to facilitate the proteasomal degradation of CycA, which overexpression alone can also trigger nurse cell death. Furthermore, Uev1A and its human homologs, UBE2V1 and UBE2V2, counteract oncogenic Ras-driven tumorigenesis in diploid Drosophila germline and human colorectal tumor cells, respectively. These findings highlight the critical role of Uev1A in counteracting oncogenic Ras stimuli in both polyploid and diploid cells (Figure 9E).

Our studies reveal that the DDR pathway protects against RasG12V-induced nurse cell death (Figure 3A and B), suggesting that this cellular stress both activates and is subsequently suppressed by the DDR. In contrast, p53 promotes nurse cell death under the same conditions (Figure 3A and B). Interestingly, previous research has also demonstrated distinct roles of p53 and Lok, a crucial DDR regulator, in regulating nurse cell death during mid-oogenesis. While Lok overexpression triggers nurse cell death, p53 overexpression does not. Furthermore, Lok-induced nurse cell death remains unaffected by p53 mutation, indicating that its mechanism operates independently of p53 (Bakhrat et al., 2010). The underlying mechanisms driving these differences warrant further investigation.

Of note, the suppressive effects of Uev1A on RasG12V; bamRNAi germline tumors in Drosophila were less pronounced than that of UBE2V1/2 on oncogenic KRASG12V-driven human colorectal tumor xenografts in nude mice (compare Figure 7A and B with Figure 9A and B). Our previous research has shown that RasG12V; bam-/- germline tumor cells divide infrequently (Zhang et al., 2024b). This suggests that the relatively weak suppression observed in these tumors may be due to the fact that Uev1A’s mechanism of action is cell cycle-dependent: the more frequently tumor cells divide, the more effectively Uev1A can suppress tumor overgrowth. We did not observe significant negative effects of Uev1A overexpression on GSC maintenance in Drosophila ovaries (Figure 7D and E). This is likely because GSCs also divide infrequently (Morris and Spradling, 2011). Therefore, these findings underscore the importance of considering the potential negative effects of Uev1A/UBE2V1/2 overexpression in other contexts, particularly when cells divide rapidly.

RAS oncoproteins have long been considered ‘undruggable’, due to the lack of deep-binding, targetable pockets (Moore et al., 2020). To date, targeted therapies have been approved only for KRASG12C (Canon et al., 2019; Ou et al., 2022; Skoulidis et al., 2021). Recently, small-molecule pan-KRAS degraders, developed using the proteolysis-targeting chimeras (PROTACs) strategy, have shown promise (Popow et al., 2024), though their clinical effectiveness and safety remain to be fully validated. Alternatively, targeting key regulators in the RAS signaling pathway—such as SOS, SHP2, Farnesyltransferase, Raf, MEK, ERK, and PI3K—has emerged as an attractive therapeutic approach (Moore et al., 2020). Recent research has also explored the strategy of hyperactivating oncogenic RAS to trigger cell death as a potential means to suppress the overgrowth of human colon tumor xenografts in nude mice (Dias et al., 2024). Additionally, targeting the cellular dependencies driven by oncogenic RAS may trigger RAS-specific synthetic lethality, presenting a promising therapeutic approach (Moore et al., 2020). Our findings highlight the tumor-suppressive effects of UBE2V1 and UBE2V2 on human colorectal tumors driven by oncogenic KRAS (Figures 8 and 9). Notably, both of these two E2 enzymes are relatively small, with UBE2V1 consisting of 147 amino acid residues and UBE2V2 145 residues (Figure 2E). This raises the exciting possibility that their upregulation, through mRNA delivery or small-molecule agonists, could offer a promising therapeutic approach for human cancer.

Materials and methods

Fly husbandry

Request a detailed protocol

Cross experiments were conducted at 25°C, except for some performed at 29°C as noted.

Transgenic flies

UASz-flag-RasG12V, UASz-uev1a, UASz-UBE2V1, and UASz-UBE2V2

Request a detailed protocol

The coding sequences (CDSs) of flag-RasG12V, uev1a-RA, UBE2V1, and UBE2V2 were cloned into the pUASz1.0 vector. These plasmids were then microinjected into fertilized fly embryos with the genotype ‘nos-int; attP40’, resulting in the generation of transgenic fly strains. The DNA sequence encoding 3xFlag was as follows: ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGCTT.

uev1a Δ1 and uev1a Δ2 mutants

Request a detailed protocol

The gRNA targeting the second coding exon of the uev1a gene was designed with the DNA sequence ‘GATCCAGCTCCTCCAGTAAGCGG’ and cloned into the pCFD3 vector. The plasmids were then microinjected into fertilized fly embryos with the genotype ‘nos-int; attP40’ to generate transgenic fly strain. These transgenic flies were subsequently crossed with ‘nos-cas9; FRT2A’ flies to generate uev1a knockout mutants, whose molecular information was identified by Sanger sequencing.

uev1a-flag knock-in

Request a detailed protocol

The gRNA targeting the second-to-last coding exon of the uev1a gene was designed with the DNA sequence ‘GTTATAAACCGGAGCGTTGGTGG’ and cloned into the pU6-BbsI-chiRNA vector. The homology arms consisted of 991 bp upstream of the stop codon (‘TAG’), followed by a 3xFlag tag sequence, the ‘TAG’ stop codon, and 979 bp downstream of ‘TAG’. To prevent cleavage by the gRNA, the targeting sequence within the upstream homology arm was mutated to ‘CCTACCCTGCGCTTCATTA’, ensuring that the amino acid sequence remained unaltered. These DNA sequences were synthesized into the pUASz1.0 vector between the BamHI and KpnI sites and used as a double-stranded DNA (dsDNA) donor for homologous recombination-mediated repair. The pU6-uev1a-gRNA-2 (100 ng/μL) and pUASz-uev1a-donor (100 ng/μL) plasmids were then co-injected into fertilized fly embryos with the genotype ‘nos-cas9 (on X)’ (Kondo and Ueda, 2013). The resulting uev1a-flag knock-in fly strain was identified by PCR and confirmed by Sanger sequencing.

Immunofluorescent staining

Request a detailed protocol

Fly ovaries were dissected in the PBS solution, fixed by the 4% paraformaldehyde solution (diluted in PBS) for 3 hr, washed by the PBST solution (0.3% Triton X-100 diluted in PBS) for 1 hr at room temperature (RT), then incubated with the primary antibodies (diluted in PBST) overnight at 4°C, washed by the PBST solution for 1 hr at RT, incubated with the secondary antibodies and 0.1 μg/mL DAPI (diluted in PBST) overnight at 4°C, washed by the PBST solution for 1 hr at RT, and subsequently mounted using 70% glycerol (autoclaved).

Construction of plasmids used in S2 cells

Request a detailed protocol

The CDSs of the genes were amplified from the cDNAs derived from either S2 cells or adult wild-type (w1118) flies and subsequently cloned into the pUASt-attB vector. N- or C-terminal tags were incorporated based on prior studies or structural predictions from AlphaFold. The following proteins were tagged at the N-terminus: APC4, Ben, CDC16, CDC23, Cdc27, CycA, Fzr, Fzy, Ida, Mr, Ub, Ub7KR, Ub6KR+K11, Ub6KR+K48, Ub6KR+K63, and Uev1A. In contrast, APC7 was tagged at the C-terminus.

Culture and transfection of S2 cells

Request a detailed protocol

S2 cells were cultured in insect medium with 10% FBS and incubated at 27°C without CO2. To transfect, cells were plated in six-well plates to reach 70% confluence and incubated for 3 hr at 27°C. Then, a pre-complexed mixture of plasmid DNA and X-tremeGENE HP DNA transfection reagent was added slowly to the cultures. The transfection process followed the manufacturer’s instructions. After gentle mixing, cells were incubated at 27°C, and samples were collected 36 hr after transfection.

Immunoprecipitation, immunoblotting, ubiquitination, and protein stability assays in S2 cells

Immunoprecipitation assay

Request a detailed protocol

The transfected S2 cells were lysed using NP-40 lysis buffer supplemented with protease inhibitors at 4°C for 30 min. The supernatants were incubated with primary antibodies at 4°C for 3 hr, followed by incubation with Protein G Sepharose for 2 hr. The beads were washed five times with NP-40 lysis buffer and boiled for 5 min in 2× SDS protein loading buffer (0.25 M Tris-HCl [pH 6.8], 78 mg/mL DTT, 100 mg/mL SDS, 50% glycerol, and 5 mg/mL bromophenol blue). Then the samples were subjected to western blotting.

Immunoblotting assay

Request a detailed protocol

After 36 hr of transfection, the S2 cells were harvested and lysed in 2× SDS protein loading buffer. The lysates were then boiled for 5 min and subjected to western blotting.

Ubiquitination assay

Request a detailed protocol

S2 cells were transiently transfected with the indicated plasmid combinations. 30 hr post-transfection, cells were treated with 50 μM MG132 for 6 hr. Proteins were then immunoprecipitated and analyzed by western blotting.

Protein stability assay

Request a detailed protocol

S2 cells were treated with 20 µg/mL of the protein synthesis inhibitor CHX for specified time intervals prior to harvesting.

RNAi assay in S2 cells

Request a detailed protocol

Two double-stranded RNAs (dsRNAs) targeting distinct regions of the relevant genes were synthesized using the T7 RiboMAX Express RNAi System. S2 cells were seeded in six-well tissue culture plates and treated with 15 μg of dsRNA in the culture medium, followed by incubation for 24 hr. Expression plasmids were then transiently transfected into the cells, after which an additional 10 μg of dsRNA was added. The cells were cultured for another 36 hr before harvesting. As a negative control, dsRNA targeting the AcGFP gene was used. Templates for dsRNA synthesis were generated by PCR amplification of S2 cell genomic DNA using the primers listed in the Key resources table.

Human cell culture

Request a detailed protocol

The human colon cancer cell lines SW480 and HCT116, as well as the human embryonic kidney cell line 293T, were purchased from the American Type Culture Collection (ATCC), authenticated by STR profiling, and tested negative for mycoplasma contamination. These cell lines were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% FBS, and the cultures were maintained at 37°C with 5% CO2 in a humidified incubator.

Gene knockdown assay

Request a detailed protocol

Short hairpin RNA (shRNA) constructs were generated using the lentiviral vector pLKO-CMV-copGFP-puro. Lentiviral particles were produced by co-transfecting each shRNA plasmid together with the packaging plasmids psPAX2 and pMD2.G into 293T cells using Lipofectamine 2000, following the manufacturer’s protocol. SW480 and HCT116 cells were subsequently transduced with the harvested lentiviral supernatants to establish stable cell lines expressing shNC (negative control), shUBE2V1, or shUBE2V2. The shRNA sequences were included in the Key resources table.

Overexpression assay

Request a detailed protocol

The lentiviral vector pCDH-CMV was used for gene overexpression, while pMD2.G and psPAX2 served as lentiviral packaging plasmids. Target plasmids, pCDH-CMV-UBE2V1 and pCDH-CMV-UBE2V2, were synthesized by the GENEWIZ company (Suzhou, China). Plasmids were transfected into 293T cells using Lipofectamine 2000 to generate lentiviral particles, according to the manufacturer’s protocol. SW480 and HCT116 cells were then transduced with these lentiviruses to establish stable cell lines expressing UBE2V1 and UBE2V2, respectively. To select for stably transduced cells, the cultures were maintained in medium containing 2 µg/mL puromycin.

Quantitative real-time PCR

Request a detailed protocol

Total RNA was extracted using the TriQuick Reagent kit and reverse-transcribed into cDNA using the SPARKscript II All-in-one RT SuperMix kit. Quantitative real-time PCR was performed using the SYBR Green Premix Pro Taq HS qPCR kit. GAPDH was used as the endogenous control for normalization. The relative mRNA levels of target genes were determined using the 2−ΔΔCT method. The primer sequences were listed in the Key resources table.

EdU incorporation assay

Request a detailed protocol

Cells were seeded in 24-well plates at a density of 100,000 cells per well. Cell proliferation was assessed using the EdU incorporation assay kit, following the manufacturer’s instructions. Briefly, EdU reagent was added to the culture medium, and cells were incubated for 2 hr to label DNA-synthesizing cells. After incubation, the medium containing EdU was removed, and cells were washed with PBS, fixed with fixative solution for 10 min, and then subjected to a click reaction for fluorescence labeling. Fluorescence microscopy was used to capture images and calculate the percentage of EdU+ cells.

Colony formation assay

Request a detailed protocol

Cells were seeded in six-well plates at a density of 500 cells per well and cultured at 37°C in a 5% CO2 incubator for 10 days without medium change. After 10 days, cells were gently washed with PBS to remove non-adherent cells, then stained with 0.5% crystal violet solution (containing 10% methanol and 1% acetic acid) for 15 min. The plates were subsequently rinsed with water to remove excess stain and air-dried. Colonies were photographed and counted using image analysis software.

CCK8 cell viability assay

Request a detailed protocol

Cells were seeded in 96-well plates at a density of 2000 cells per well. Cell viability was assessed over 5 days using a CCK8 kit following the manufacturer’s instructions. Measurements were taken on day 0 (baseline) and daily from day 1 to day 4. At each time point, 10 µL of CCK8 solution was added to each well, and the plates were incubated for 2 hr at 37°C in a humidified incubator. Absorbance at 450 nm was measured using a microplate reader to assess cell viability and proliferation dynamics throughout the experimental period.

Western blotting

Request a detailed protocol

Cells were lysed with RIPA buffer containing protease inhibitors, and protein concentrations were determined using a BCA Protein Assay Kit. Protein samples (20 µg per lane) were separated by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked with 5% non-fat milk and incubated overnight at 4°C with primary antibodies. Following washes, membranes were incubated with HRP-conjugated secondary antibodies and developed using ECL. Band intensities were quantified by densitometry.

Immunohistochemistry assay

Request a detailed protocol

Tissue sections were deparaffinized with xylene, rehydrated through a graded ethanol series, and subjected to antigen retrieval in citrate buffer (pH 6.0) at 98°C for 10 min. Endogenous peroxidase activity was blocked using 3% hydrogen peroxide, and nonspecific binding was blocked with 5% BSA. Sections were incubated overnight at 4°C with primary antibodies. After incubation with HRP-conjugated secondary antibodies, sections were developed using DAB, counterstained with hematoxylin, and mounted. Images were captured using a light microscope.

Animal experiment

Request a detailed protocol

Male Balb/c nude mice (7-week-old) were used to assess the tumorigenic potential of SW480 colon cancer cells. The mice were housed under specific pathogen-free conditions with a 12 hr light/dark cycle and had ad libitum access to food and water. SW480 cells were stably transfected with either the empty vector pCDH-CMV (control), pCDH-CMV-UBE2V1 (UBE2V1-OE), or pCDH-CMV-UBE2V2 (UBE2V2-OE), and 5×106 cells were subcutaneously injected into the right flank of each mouse. Each group consisted of six mice. Tumor growth was monitored approximately 1 week after injection. Tumor volumes were measured every 4 days using calipers and calculated using the formula: volume = length × width2/2. The experiment was terminated when tumors reached ~1000 mm3. The mouse experiments in this study were approved by the Institutional Animal Care and Use Committee at Nankai University (Approval Number: 2025-SYDWLL-000588). All animal procedures were conducted in compliance with the committee’s protocols and under its supervision. Mice were humanely euthanized in accordance with institutional and national ethical guidelines.

Image collection and processing

Request a detailed protocol

Fluorescent images were captured using a Zeiss LSM 710 confocal microscope (Carl Zeiss AG, BaWü, GER) and processed with Adobe Photoshop 2022 (San Jose, CA, USA), ImageJ (NIH, Bethesda, MD, USA), and ZEN 3.0 SR imaging software (Carl Zeiss).

Appendix 1

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Mus musculus)Balb/c (CAnN.Cg-Foxn1nu/Crl) nude miceBeijing Vital River Laboratory Animal Technology Co., Ltd.401
Genetic reagent (Drosophila melanogaster)bam-GAL4-VP16Chen and McKearin, 2003
Genetic reagent (D. melanogaster)nos-GAL4-VP16Van Doren et al., 1998
Genetic reagent (D. melanogaster)nos-cas9Kondo and Ueda, 2013
Genetic reagent (D. melanogaster)FRT2ABDSC1997
Genetic reagent (D. melanogaster)puc-lacZBloomington Drosophila Stock Center (BDSC)98329
Genetic reagent (D. melanogaster)UAS-bam-RNAiBDSC33631
Genetic reagent (D. melanogaster)UASp-BicD-RNAiTsingHua Fly Center (THFC)THU4454
Genetic reagent (D. melanogaster)UASp-cdc27-RNAiTHFCTH201500102.S
Genetic reagent (D. melanogaster)UASp-Cdk1BDSC65396
Genetic reagent (D. melanogaster)UASp-CycABDSC85308
Genetic reagent (D. melanogaster)UASp-CycBBDSC85312
Genetic reagent (D. melanogaster)UASp-dsor1-RNAiTHFCTHU0677
Genetic reagent (D. melanogaster)UASp-fzr-RNAiTHFCTH201500745.S
Genetic reagent (D. melanogaster)UASp-GFPZhang et al., 2024a
Genetic reagent (D. melanogaster)UASp-GFP-RNAiBDSC44412, 44415
Genetic reagent (D. melanogaster)UASz-lacZZhang et al., 2024b
Genetic reagent (D. melanogaster)UASp-lmgA-RNAiTHFCTHU4085
Genetic reagent (D. melanogaster)UASp-lok-RNAiTHFCTH01867.N
Genetic reagent (D. melanogaster)UASp-mr-RNAiTHFCTHU5250
Genetic reagent (D. melanogaster)UASp-p53-RNAiTHFCTHU5318
Genetic reagent (D. melanogaster)UASp-RasG12VZhang et al., 2024b
Genetic reagent (D. melanogaster)UASp-rl-RNAiTHFCTHU3530
Genetic reagent (D. melanogaster)UASp-shtd-RNAiTHFCTH201500835.S
Genetic reagent (D. melanogaster)UASp-StgBDSC58439
Genetic reagent (D. melanogaster)UASp-tefu-RNAiTHFCTHU5591
Genetic reagent (D. melanogaster)UASp-uev1a-RNAiBDSC66947
Genetic reagent (D. melanogaster)UASz-flag-RasG12VThis paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)UASz-UBE2V1This paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)UASz-UBE2V2This paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)UASz-uev1aThis paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)UASz-Yki3SAZhang et al., 2024a
Genetic reagent (D. melanogaster)nos-int; attP40BDSC79604
Genetic reagent (D. melanogaster)uev1a Δ1This paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)uev1a Δ2This paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)uev1a-flagThis paperConstruction information described
in the Materials and methods section
Genetic reagent (D. melanogaster)All deficiency Drosophila strains (including 7584)The Core Facility of Drosophila Resource and Technology (CEMCS), Chinese Academy of Sciences (CAS), ChinaThe stock numbers are the same as in BDSC
Cell line (D. melanogaster)Schneider 2 (S2) cellsBeyotime BiotechnologyCat# C7925, RRID:CVCL_Z232
Cell line (Homo sapiens)293T cellsThe American Type Culture Collection (ATCC)Cat# CRL-3216, RRID:CVCL_0063
Cell line (H. sapiens)HCT116 cellsATCCCat# CCL-247, RRID:CVCL_VU38
Cell line (H. sapiens)SW480 cellsATCCCat# CCL-228, RRID:CVCL_0546
Transfected construct (H. sapiens)Control shRNAThis paperCCTAAGGTTAAGTCGCCCTCG
Transfected construct (H. sapiens)UBE2V1 shRNA #1This paperCTCGGGCAGATGACATGAAAT
Transfected construct (H. sapiens)UBE2V1 shRNA #2This paperGCATCACCACAGGCTGGCTCA
Transfected construct (H. sapiens)UBE2V2 shRNA #1This paperGTCTTAAATCAACAACCTTCT
Transfected construct (H. sapiens)UBE2V2 shRNA #2This paperGCTCCTCCGTCAGTTAGATTT
AntibodyAnti-α-Spectrin (Mouse monoclonal)Developmental Studies Hybridoma Bank (DSHB)RRID:AB_528473IF (1:100)
AntibodyAnti-β-Actin (Mouse monoclonal)AbmartRRID:AB_2936240WB (1:5000)
AntibodyAnti-β-Actin (Mouse monoclonal)ZenbioCat# 200068-8F10WB (1:5000)
AntibodyAnti-CycA (Rabbit polyclonal)Whitfield et al., 1990IF (1:1000)
AntibodyAnti-Flag (Mouse monoclonal)SigmaCat# F1804, RRID:AB_262044IF (1:500)
AntibodyAnti-Flag (Mouse monoclonal)UtibodyCat# UM3009IP (1:200), WB (1:5000)
AntibodyAnti-γH2AV (Mouse monoclonal)DSHBPRID: AB_2618077IF (1:200)
AntibodyAnti-HA (Mouse monoclonal)UtibodyCat# UM3004IP (1:200), WB (1:3000)
AntibodyAnti-Myc (Mouse monoclonal)UtibodyCat# UM3011IP (1:200), WB (1:3000)
AntibodyAnti-UBE2V2 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-377254WB (1:2000)
AntibodyAnti-α-Tubulin (Rabbit polyclonal)ProteintechCat# 14555-1-APWB (1:5000)
AntibodyAnti-β-Tubulin (Rabbit polyclonal)ZenbioCat# 380628WB (1:5000)
AntibodyAnti-CycA (Rabbit polyclonal)ImmunowayCat# YT1167IF (1:200)
AntibodyAnti-Flag (Rabbit monoclonal)ZenbioCat# R24091IP (1:200), WB (1:5000)
AntibodyAnti-HA (Rabbit monoclonal)ZenbioCat# 301113IP (1:200), WB (1:3000)
AntibodyAnti-Ki67 (Rabbit polyclonal)ProteintechCat# 27309-1-APIF (1:2000)
AntibodyAnti-Myc (Rabbit polyclonal)ABclonalCat# AE009IP (1:200), WB (1:3000)
AntibodyAnti-UBE2V1 (Rabbit polyclonal)WanleibioCat# WL04482WB (1:2000)
AntibodyAlexa Fluor 546 goat anti-mouseInvitrogenCat# A-11030IF (1:2000)
AntibodyHRP Goat anti-Mouse IgG(H+L)SIMUBIOTECHCat# S2002IF (1:2000)
AntibodyHRP Goat anti-Rabbit IgG(H+L)SIMUBIOTECHCat# S2001IF (1:2000)
Recombinant DNA reagentpCDH-CMVAddgeneRRID:Addgene_72265
Recombinant DNA reagentpCDH-CMV-UBE2V1This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpCDH-CMV-UBE2V2This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpCFD3AddgeneRRID:Addgene_49410
Recombinant DNA reagentpCFD3-uev1a-gRNA-1This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpLKO-CMV-puroAddgeneRRID:Addgene_131700
Recombinant DNA reagentpLKO-CMV-copGFP-puro-shNCThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpLKO-CMV-copGFP-puro-shUBE2V1-#1This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpLKO-CMV-copGFP-puro-shUBE2V1-#2This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpLKO-CMV-copGFP-puro-shUBE2V2-#1This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpLKO-CMV-copGFP-puro-shUBE2V2-#2This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpMD2.GAddgeneRRID:Addgene_12259
Recombinant DNA reagentpsPAX2AddgeneRRID:Addgene_12260
Recombinant DNA reagentpU6-BbsI-chiRNAAddgeneRRID:Addgene_45946
Recombinant DNA reagentpU6-uev1a-gRNA-2This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-attBDrosophila Genomics Resource Center (DGRC)RRID:DGRC_1419
Recombinant DNA reagentpUASt-APC7-MycThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Flag-benThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Flag-cycAThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-HA-UbThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-HA-Ub7KRThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-HA-Ub6KR+K11This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-HA-Ub6KR+K48This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-HA-Ub6KR+K63This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-HA-uev1aThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-APC4This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-Cdc16This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-Cdc23This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-Cdc27This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-FzrThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-FzyThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-IdaThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASt-Myc-MrThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASz1.0DGRCRRID:DGRC_1431
Recombinant DNA reagentpUASz-flag-RasG12VThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASz-UBE2V1This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASz-UBE2V2This paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASz-uev1aThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASz-uev1a-donorThis paperConstruction information described
in the Materials and methods section
Recombinant DNA reagentpUASz-Yki3SAThis paperConstruction information described
in the Materials and methods section
Sequence-based reagentuev1a#1_FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGAACGGAATTTCCGCTTACTG
Sequence-based reagentuev1a#1_RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGACGGACCGATGATCATGCC
Sequence-based reagentuev1a#2_FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGACACTAAAGATCGAGTGCG
Sequence-based reagentuev1a#2_RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGATGCCAGCTTCAGGTTCTC
Sequence-based reagentben#1_FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGACCACGTCGCATCATCAAG
Sequence-based reagentben#1_RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGAAGTCTTCGACGGCATATTTC
Sequence-based reagentben#2_FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGACAGATCCGGACCATATTG
Sequence-based reagentben#2_RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGATCAGTCTTCGACGGCATATTTC
Sequence-based reagentcdc27#1_FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGATCGCCCAGGATCTGATTAAC
Sequence-based reagentcdc27#1_RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGAGCAGCGACAGATCCTTCTTC
Sequence-based reagentcdc27#2_FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGAGATGATGGGCAAAAAGCTAAAG
Sequence-based reagentcdc27#2_RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGACCATCGGCCGATTGTTTC
Sequence-based reagentAcGFP-FThis paperPCR primersGAATTAATACGACTCACTATAGGGAGATGCACCACCGGCAAGCTGCCTG
Sequence-based reagentAcGFP-RThis paperPCR primersGAATTAATACGACTCACTATAGGGAGAGGCCAGCTGCACGCTGCCATC
Sequence-based reagentGAPDH-FThis paperPCR primersACAACTTTGGTATCGTGGAAGG
Sequence-based reagentGAPDH-RThis paperPCR primersGCCATCACGCCACAGTTTC
Sequence-based reagentUBE2V1-FThis paperPCR primersCGGGCTCGGGAGTAAAAGTC
Sequence-based reagentUBE2V1-RThis paperPCR primersAGGCCCAATTATCATCCCTGT
Sequence-based reagentUBE2V2-FThis paperPCR primersTGGACAGGCATGATTATTGGGC
Sequence-based reagentUBE2V2-RThis paperPCR primersCTAACACTGGTATGCTCCGGG
Commercial assay or kitBCA Protein Assay KitBeyotime BiotechnologyCat# P0012
Commercial assay or kitCCK8 KitAPExBIOCat# K1018
Commercial assay or kitEdU Incorporation Assay KitBeyotime BiotechnologyCat# C0075
Commercial assay or kitSPARKscript II All-in-one RT SuperMix kitSparkJadeCat# AG0305-C
Commercial assay or kitSYBR Green Premix Pro Taq HS qPCR kitACCURATE BIOLOGYCat# AG11701-S
Commercial assay or kitT7 RiboMAX Express RNAi SystemPromegaCat# P1700
Commercial assay or kitTriQuick Reagent kitSolarbioCat# R1100
Chemical compound, drugChloroquine (CQ)SelleckCat# S6999
Chemical compound, drugCycloheximide (CHX)MCECat# HY-12320
Chemical compound, drugMG132SelleckCat# S2619
Chemical compound, drugProtein G SepharoseCytivaCat# 17061801
Chemical compound, drugPuromycinSolarbioCat# P8230
Software, algorithmAdobe Photoshop 2022San Jose, CA, USARRID:SCR_014199
Software, algorithmImageJNIHRRID:SCR_003070
Software, algorithmGraphPad PrismGraphPad Software, IncRRID:SCR_002798
OtherDMSOMacklinCat# D6258
OtherDulbecco’s Modified Eagle MediumGibcoCat# C11995500BT
OtherFetal Bovine Serum (FBS)LonseraCat# S711-001S
OtherInsect Culture MediumUnionCat# UK1000
OtherLipofectamine 2000Thermo Fisher11668027

Data availability

The results of the deficiency screening are provided in Source data 1. All genotypes are listed in Source data 2, and the raw quantification data can be found in Source data 3.

References

Article and author information

Author details

  1. Qi Zhang

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Software, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Contributed equally with
    Yunfeng Wang, Xueli Fu and Ziguang Wang
    Competing interests
    No competing interests declared
  2. Yunfeng Wang

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Software, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Contributed equally with
    Qi Zhang, Xueli Fu and Ziguang Wang
    Competing interests
    No competing interests declared
  3. Xueli Fu

    Department of Biochemistry and Molecular Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Software, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Contributed equally with
    Qi Zhang, Yunfeng Wang and Ziguang Wang
    Competing interests
    No competing interests declared
  4. Ziguang Wang

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Software, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Contributed equally with
    Qi Zhang, Yunfeng Wang and Xueli Fu
    Competing interests
    No competing interests declared
  5. Yang Zhang

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  6. Lizhong Yan

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  7. Yuejia Wang

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  8. Muhan Yang

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  9. Dongze Song

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  10. Ruixing Zhang

    Department of Biochemistry and Molecular Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  11. Hongru Zhang

    1. Department of Biochemistry and Molecular Biology, College of Life Sciences, Nankai University, Tianjin, China
    2. Nankai International Advanced Research Institute (SHENZHEN FUTIAN), Shenzhen, China
    Contribution
    Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Software, Supervision, Validation, Visualization, Writing – review and editing
    For correspondence
    hrzhang@nankai.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0009-0000-7447-8750
  12. Shian Wu

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Project administration, Writing – review and editing
    For correspondence
    wusa@nankai.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4990-6594
  13. Shaowei Zhao

    Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, Tianjin, China
    Contribution
    Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    swzhao@nankai.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4544-7215

Funding

National Natural Science Foundation of China (32270841)

  • Shaowei Zhao

National Natural Science Foundation of China (32070871)

  • Shaowei Zhao

National Natural Science Foundation of China (32170714)

  • Shian Wu

National Natural Science Foundation of China (32400759)

  • Hongru Zhang

Natural Science Foundation of Tianjin (S24ZDD020)

  • Hongru Zhang

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We gratefully thank Eric H Baehrecke, Michael Buszczak, Zheng Guo, Yuu Kimata, Ruth Lehmann, Erika Matunis, Addgene, ATCC, BDSC, CEMCS, DGRC, GenBank, and THFC for providing antibodies, plasmids, cell lines, and fly strains. This study was supported by National Natural Science Foundation of China (NSFC) grants to Shaowei Zhao (32270841, 32070871), Shian Wu (32170714), and Hongru Zhang (32400759), as well as by a Natural Science Foundation of Tianjin grant (S24ZDD020) to Hongru Zhang.

Ethics

The mouse experiments in this study were approved by the Institutional Animal Care and Use Committee at Nankai University (Approval Number: 2025-SYDWLL-000588). All animal procedures were conducted in compliance with the committee's protocols and under its supervision. Mice were humanely euthanized in accordance with institutional and national ethical guidelines.

Version history

  1. Sent for peer review:
  2. Preprint posted:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.107104. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2025, Zhang, Wang, Fu et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 686
    views
  • 61
    downloads
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Qi Zhang
  2. Yunfeng Wang
  3. Xueli Fu
  4. Ziguang Wang
  5. Yang Zhang
  6. Lizhong Yan
  7. Yuejia Wang
  8. Muhan Yang
  9. Dongze Song
  10. Ruixing Zhang
  11. Hongru Zhang
  12. Shian Wu
  13. Shaowei Zhao
(2026)
Uev1A counteracts oncogenic Ras stimuli in both polyploid and diploid cells
eLife 14:RP107104.
https://doi.org/10.7554/eLife.107104.3

Share this article

https://doi.org/10.7554/eLife.107104