Nucleosome breathing and remodeling constrain CRISPR-Cas9 function
- University of California, San Francisco, United States
- University of California, Berkeley, United States
- Howard Hughes Medical Institute, University of California, Berkeley, United States
- Lawrence Berkeley National Laboratory, United States
- Howard Hughes Medical Institute, University of California, San Francisco, United States
Figures
Figure 1 with 1 supplement
Cas9 DNA nuclease activity is hindered by nucleosomes.
(A) Schematic of sgRNAs designed against the assembled 601 80/80 nucleosome substrates targeting the flanking regions, entry/exit sites, and near the nucleosomal dyad. (B) Cleavage assay comparing …
-
Figure 1—source data 1
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNAs #2 and #6.
- https://doi.org/10.7554/eLife.13450.004
-
Figure 1—source data 2
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNAs #2 and #6.
- https://doi.org/10.7554/eLife.13450.005
-
Figure 1—source data 3
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNAs #2 and #6.
- https://doi.org/10.7554/eLife.13450.006
-
Figure 1—source data 4
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #5.
- https://doi.org/10.7554/eLife.13450.007
-
Figure 1—source data 5
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #5.
- https://doi.org/10.7554/eLife.13450.008
-
Figure 1—source data 6
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #1.
- https://doi.org/10.7554/eLife.13450.009
-
Figure 1—source data 7
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #1.
- https://doi.org/10.7554/eLife.13450.010
-
Figure 1—source data 8
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #3.
- https://doi.org/10.7554/eLife.13450.011
-
Figure 1—source data 9
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #3.
- https://doi.org/10.7554/eLife.13450.012
-
Figure 1—source data 10
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #4.
- https://doi.org/10.7554/eLife.13450.013
-
Figure 1—source data 11
Replicate gels of Cas9 cleavage of 80/80 601 DNA and nucleosomes with sgRNA #4.
- https://doi.org/10.7554/eLife.13450.014
-
Figure 1—source data 12
Quantification of Figure 1 Cas9 cleavage gels.
- https://doi.org/10.7554/eLife.13450.015
Figure 1—figure supplement 1
Nucleosome positioning blocks Cas9 from binding PAM sites on DNA.
(A) Schematic illustrating the stepwise mechanism of Cas9 binding to DNA targets and subsequent nucleolytic cleavage. (B) Gel shift assay comparing dCas9 binding to 0/0 DNA and nucleosomes while …
-
Figure 1—figure supplement 1—source data 1
-3Replicate gels of dCas9 binding to 0/0 601 DNA and nucleosomes with sgRNA #3.
- https://doi.org/10.7554/eLife.13450.017
-
Figure 1—figure supplement 1—source data 2
-3Replicate gels of dCas9 binding to 0/0 601 DNA and nucleosomes with sgRNA #3.
- https://doi.org/10.7554/eLife.13450.018
-
Figure 1—figure supplement 1—source data 3
-3Replicate gels of dCas9 binding to 0/0 601 DNA and nucleosomes with sgRNA #3.
- https://doi.org/10.7554/eLife.13450.019
-
Figure 1—figure supplement 1—source data 4
Quantification of Figure 1—figure supplement 1 gel shifts.
- https://doi.org/10.7554/eLife.13450.020
Figure 2 with 1 supplement
Higher nucleosomal breathing dynamics enhance Cas9 cleavage.
(A) Schematic illustrating nucleosome breathing and how it can enable Cas9 binding to a target in the nucleosome. (B) Cleavage assay comparing Cas9 cleavage of 601 and 5S 0/0 nucleosomes when loaded …
-
Figure 2—source data 1
Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA core.
- https://doi.org/10.7554/eLife.13450.022
-
Figure 2—source data 2
Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA core.
- https://doi.org/10.7554/eLife.13450.023
-
Figure 2—source data 3
Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA entry.
- https://doi.org/10.7554/eLife.13450.024
-
Figure 2—source data 4
Replicate gels of cleavage of 0/0 5S DNA and nucleosomes with sgRNA entry.
- https://doi.org/10.7554/eLife.13450.025
-
Figure 2—source data 5
Replicate gels of cleavage of 0/0 601 DNA and nucleosomes with sgRNA entry.
- https://doi.org/10.7554/eLife.13450.026
-
Figure 2—source data 6
Replicate gels of cleavage of 0/0 601 DNA and nucleosomes with sgRNA entry.
- https://doi.org/10.7554/eLife.13450.027
-
Figure 2—source data 7
Quantification of Figure 2 Cas9 cleavage gels.
- https://doi.org/10.7554/eLife.13450.028
-
Figure 2—source data 8
Quantification of Figure 2 Cas9 cleavage gels.
- https://doi.org/10.7554/eLife.13450.029
Figure 2—figure supplement 1
Cas9 cleavage assay with 601 and 5S 0/0 nucleosomes.
Representative gel images of Cas9 cleavage experiments with 601 (left) and 5S (right) 0/0 particles using sgRNAs targeting entry (top) or core (bottom) sites, including DNA control experiments. …
Figure 3 with 3 supplements
Chromatin remodeling improves Cas9 cleavage of nucleosomal substrates.
(A) Schematic of Cas9 cleavage assay with remodeling. Cas9 is presented with 601 nucleosomes either untreated or previously remodeled with SNF2h or RSC remodelers. (B) Assay comparing cleavage on …
-
Figure 3—source data 1
Replicate gels of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without prior remodeling by Snf2h.
- https://doi.org/10.7554/eLife.13450.032
-
Figure 3—source Data 2
Replicate gels of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without prior remodeling by Snf2h.
- https://doi.org/10.7554/eLife.13450.033
-
Figure 3—source data 3
Replicate gels of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without prior remodeling by Snf2h.
- https://doi.org/10.7554/eLife.13450.034
-
Figure 3—source data 4
Quantification of Cas9 cleavage gels from Figure 3—source data 1–3.
- https://doi.org/10.7554/eLife.13450.035
-
Figure 3—source data 5
Replicate gels of cleavage of 80/80 DNA and nucleosomes using sgRNA 601_2 with or without prior remodeling by RSC.
- https://doi.org/10.7554/eLife.13450.036
-
Figure 3—source data 6
Replicate gels of cleavage of 80/80 DNA and nucleosomes using sgRNA 601_2 with or without prior remodeling by RSC.
- https://doi.org/10.7554/eLife.13450.037
-
Figure 3—source data 7
Replicate gels of cleavage of 80/80 DNA and nucleosomes using sgRNA 601_2 with or without prior remodeling by RSC.
- https://doi.org/10.7554/eLife.13450.038
-
Figure 3—source data 8
Quantification of Cas9 cleavage gels from Figure 3—source data 5–7.
- https://doi.org/10.7554/eLife.13450.039
Figure 3—figure supplement 1
Cas9 cleavage assays with SNF2h and RSC chromatin remodelers.
(A) Representative gel images of Cas9 cleavage experiments with 601 80/0 asymmetric particles and SNF2h chromatin remodeler, including DNA control experiments. Cas9 was loaded with sgRNA targeting …
Figure 3—figure supplement 2
Simultaneous chromatin remodeling and Cas9 cleavage of nucleosomal substrates.
(A) Assay comparing Cas9 cleavage of 601 80/0 nucleosomes simultaneously with chromatin remodeling byr SNF2h. The 601 80/0 asymmetric nucleosomes are recentered by SNF2h, exposing the exit target …
-
Figure 3—figure supplement 2—source data 1
Gel of cleavage of 80/0 DNA and nucleosomes using sgRNA #4 with or without simultaneous remodeling by Snf2h.
- https://doi.org/10.7554/eLife.13450.042
Figure 3—figure supplement 3
SNF2h and RSC remodel nucleosomes prior to Cas9 cleavage.
Gel‐shift nucleosome remodeling assay comparing positioned and SNF2h‐remodeled 80/0 nucleosomes (left) or RSC-remodeled 80/80 nucleosomes (right). Migration pattern for all three forms (centered, …
-
Figure 3—figure supplement 3—source data 1
Test remodeling gel of 80/0 nucleosomes with Snf2h.
- https://doi.org/10.7554/eLife.13450.044
-
Figure 3—figure supplement 3—source data 2
Test remodeling gel of 80/80 nucleosomes with RSC.
- https://doi.org/10.7554/eLife.13450.045
Tables
Table 1
Spacer sequences for sgRNAs used in biochemistry experiments.
| sgRNA # | Guide sequence | PAM | Target strand | Figures where used |
|---|---|---|---|---|
| 601_1 | CGAGTTCATCCCTTATGTGA | TGG | Antisense | Figure 1D |
| 601_2 (entry) | AATTGAGCGGCCTCGGCACC | GGG | Sense | Figure 1D, Figure 2B–D, Figure 2—figure supplement 1, Figure 3E–H, Figure 3—figure supplement 1D–E |
| 601_3 (core) | CCCCCGCGTTTTAACCGCCA | AGG | Antisense | Figure 1B–D, Figure 1—figure supplement 1B–C, Figure 2B–D, Figure 2—figure supplement 1 |
| 601_4 | GTATATATCTGACACGTGCC | TGG | Sense | Figure 1D |
| 601_5 | TCGCTGTTCAATACATGCAC | AGG | Sense | Figure 1D |
| 601_6 | GCGACCTTGCCGGTGCCAGT | CGG | Antisense | Figure 1D |
| 5S_1 (entry) | TCTGATCTCTGCAGCCAAGC | AGG | Sense | Figure 2B–E, Figure 2—figure supplement 1 |
| 5S_2 (core) | TATGGCCGTAGGCGAGCACA | AGG | Antisense | Figure 2B–E, Figure 2—figure supplement 1 |
Table 2
Sequences for DNA molecules used for biochemical assays (Positioning sequence highlighted in grey).
| Name | Sequence |
|---|---|
| 601 80/80 | CGGGATCCTAATGACCAAGGAAAGCATGATTCTTCACACCGAGTTCATCCCTTATGTGATGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACCTTGCCGGTGCCAGTCGGATAGTGTTCCGAGCTCCCACTCTAGAGGATCCCCGGGTACCGA |
| 601 0/0 | CTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT |
| 601 80/0 | CGGGATCCTAATGACCAAGGAAAGCATGATTCTTCACACCGAGTTCATCCCTTATGTGATGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTGCCGagGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT |
| 5S 0/0 | GGCCCGACCCTGCTTGGCTGCAGAGATCAGACGATATCGGGCACTTTCAGGGTGGTATGGCCGTAGGCGAGCACAAGGCTGACTTTTCCTCCCCTTGTGCTGCCTTCTGGGGGGGGCCCAGCCGGATCCCCGGGCGAGCTCGAATT |
