Set1/COMPASS and Mediator are repurposed to promote epigenetic transcriptional memory

8 figures and 2 tables

Figures

Figure 1 with 1 supplement
Sfl1 binds to the MRS to promote transcriptional memory.

(A) Chromatin immunoprecipitation (ChIP) of Sfl1-GFP from wild type and mrs mutant INO1 strains, quantified relative to the input fraction using primers to amplify the INO1 promoter (−348 to −260) or the PRM1 CDS, a repressed locus. The averages of three biological replicates are shown ± standard error of the mean. *p<0.05, compared with repressing conditions (Student’s t-test). (B) Left: representative confocal micrographs of INO1-LacO in a strain expressing GFP-LacI and PHO88-mCherry scored as either nucleoplasmic or nuclear periphery. Right: quantified chromatin localization of the percentage of the population in which the indicated locus colocalized with the nuclear envelope. INO1-LacO in either a wild type or sfl1∆ strain was localized in cells grown in repressing (+inositol), activating (-inositol) or memory conditions (switched from medium lacking inositol to medium containing 100 μM inositol for 3 hr (−ino → +ino). *p<0.05, compared with repressing conditions (Student’s t-test). URA3:LexA-LacO was localized in cells expressing either LexA or LexA-Sfl1 grown under repressing conditions. *p<0.05, compared with LexA alone (Student’s t-test). The hatched blue line indicates the baseline for this assay (Brickner and Walter, 2004). (C and D) ChIP of RNA polymerase II from wild-type and slf1∆ cells fixed at indicated time points during activation (C) and reactivation (D). At time = 0, cells were shifted from repressing medium containing 100 μM inositol (red arrow in schematic) to medium without inositol (green arrow in schematic). For reactivation, cells were shifted from activating medium to repressing medium containing 100 μM inositol for 3 hr. Left panels were quantified relative to input using the INO1 promoter primer set (-348 to -260, relative to the ATG); right panels were quantified relative to input using INO1 coding sequence primer set (+663 to +798, relative to ATG). *p<0.05, compared with the repressing condition (Student’s t-test). (E and F) INO1 activation (E) or reactivation (F) in wild type and sfl1∆ cells (schematic as in C and D). Cells were harvested at the indicated time points, and INO1 mRNA levels were quantified relative to ACT1 mRNA levels by RT-qPCR. The averages of three biological replicates are shown ± standard error of the mean. *p<0.05, compared with the same time point in the SFL1 strain (Student’s t-test).

https://doi.org/10.7554/eLife.16691.003
Figure 1—figure supplement 1
Sfl1 binding to the INO1 promoter is regulated by its context.

(A) Chromatin immunoprecipitation (ChIP) of Sfl1-GFP from cells having the MRS or mrs mutant inserted beside URA3 grown under the indicated conditions. The recovery of the INO1 promoter, URA3, the SUC2 promoter and PRM1 was quantified by qPCR relative to input. Averages of three biological replicates and standard error of the mean. *p<0.05, compared with repressing condition (Student’s t-test). (B) Confocal sum projections of stacks of SFL1-GFP cells grown under the indicated conditions, imaged using identical settings. Scale bar = 5 µm.

https://doi.org/10.7554/eLife.16691.004
Figure 2 with 1 supplement
H3K4 dimethylation is an essential memory mark that is deposited by COMPASS.

(A and B) Chromatin immunoprecipitation using anti-H3K4me2 from wild-type, sfl1∆ or mrs mutant strains grown under repressing, activating or memory conditions, quantified using the INO1 promoter primer set (−348 to −260) or, as a negative control, the PRM1 CDS primer set. *p<0.05, compared with the repressing condition (Student’s t-test). (B) Recovery was quantified relative to input fractions using the promoter primer set or three different primer sets at the following postitions: pro, -348 to -260; CDS1, +41 to +161; CDS2, +361 to +499; CDS3, +663 to +798. (C) ChIP using anti-RNAPII from wild type and histone mutant (H3K4A or H3K4R) strains grown under repressing, activating and memory conditions using primers to the INO1 promoter or PRM1 CDS. *p<0.05, compared with the repressing condition (Student’s t-test). (D) Top: immunoblot against H3K4me2 or Tubulin in whole cell extracts from the indicated strains. A strain expressing Rpl13-FKBP and having the COMPASS subunit Swd1 tagged with FRB-GFP was treated with 1 µg/ml rapamycin. Bottom: confocal micrographs of Swd1-FRB-GFP at the indicated times after addition of rapamycin. (E and F) ChIP of H3K4me2 (E) and RNAPII (F) from Swd1-FRB-GFP strain grown under activation (-ino) or memory conditions (−ino → +ino) using primers to amplify the INO1 promoter or the PRM1 CDS. Cells were fixed at the indicated times after addition of either DMSO (mock) or rapamycin. *p<0.05, compared with t = 0 (Student’s t-test).

https://doi.org/10.7554/eLife.16691.005
Figure 2—figure supplement 1
Chromatin signature of transcriptional memory.

Chromatin immunoprecipitation (ChIP) using anti-acetyl H3 (A), anti-acetyl H4 (B), anti-H3K4me3 (C) and anti-H3K4me2 (D) from either wild-type or mrs mutant strains grown under repressing, activating or memory conditions. ACT1 coding sequence serves as a positive control and GAL1 promoter serves as a negative control. *p<0.05, compared with the repressing condition (Student’s t-test). (E and F) Chromatin immunoprecipitation (ChIP) using anti-H3K4me2 (E) or anti-RNAPII (F) for CRY1 cells and HHY168 cells after 3 hr of rapamycin treatment. (G) Immunoblots against histone H3, H3K4me1 and H3K4me3 from lysates prepared from HHY168 (no FRB) or ADY23 (Swd1-FRB-GFP) at the indicated times after addition of 1 µg/ml rapamycin.

https://doi.org/10.7554/eLife.16691.006
Transcriptional memory leads to remodeling of COMPASS.

(A) ChIP against COMPASS subunits Swd1-GFP, Bre2-GFP, Sdc1-GFP, and Spp1-GFP from cells grown under repressing, activating or memory conditions. (B and C) ChIP against Spp1-GFP at the indicated times either after shifting cells from activating to repressing conditions (B) or after shifting cells back from repressing to activating conditions following 3 hr of repression (C). All ChIP experiments are averages of three biological replicates ± standard error of the mean, quantified relative to input using primers to amplify the INO1 promoter (−348 to −260) or the PRM1 CDS. *p<0.05, compared with the repressing condition (A) or compared with the 0 min time point (B and C) (Student’s t-test).

https://doi.org/10.7554/eLife.16691.007
Figure 4 with 1 supplement
Set3 recruitment to the INO1 promoter under memory conditions requires both Sfl1 and the PHD finger.

(A) ChIP against Set3-GFP from cells grown under repressing, activating or memory conditions +/- rapamycin. (B) ChIP against SET3-GFP from wild type, sfl1∆ or set3-W140A cells grown under repressing, activating or memory conditions. (C and D) ChIP against RNAPII (C) and H3K4me2 (D) from wild type an set3-W140A strains grown under repressing, activating or memory conditions. For A–D, *p<0.05, compared with the repressing condition (Student’s t-test). (E and F) ChIP sequencing against H3K4me3 (E) and H3K4me2 (F) from wild type (left) and set3∆ (right) strains grown under repressing, activating and memory conditions using primers to amplify the INO1 promoter (−348 to −260) or the PRM1 CDS. (G) Confocal micrographs of Set3-FRB-GFP at the indicated times after addition of rapamycin. (H and I) ChIP of H3K4me2 (H) and RNAPII (I) from Set3-FRB-GFP strain grown under activation (-ino) or memory conditions (−ino → +ino). Cells were fixed at the indicated times after addition of either DMSO (mock) or rapamycin. All ChIP experiments were quantified by qPCR and are plotted as averages of three biological replicates ± standard error of the mean. *p<0.05, compared with t=0 (Student’s t-test).

https://doi.org/10.7554/eLife.16691.008
Figure 4—source data 1

Genome wide analysis in wild type and set3∆ cells for H3K4me2 and H3K4me3 Chip-Seq.

Pairwise comparisons in separate sheets including: Set3-dependent H3K4me2 loci, Loci showing high H3K4me3 under activating vs repressing conditions, Loci showing Set3-dependent H3K4me3 under activating conditions vs repressing conditions, Loci showing higher H3K4me3 in the WT vs set3∆ strains under activating conditions and Loci that show higher H3K4me2 in the WT vs set3∆ under all conditions. Pairwise comparisons were conducted by the following procedure: For each condition, we pooled the ChIP-seq reads from the two replicates into one sample since the ChIP-seq signal from the two replicates were exceedingly similar. Then we calculated the reads coverage score for each pooled sample. The reads coverage score at a given genomic location is defined as the number reads that cover this location after extending each single-end read from start position downstream 150 bp. This score was further normalized by the total number of aligned reads of each sample for comparisons between samples. Second, we divided the genome into overlapping bins using a sliding window of width = 500 bp and a step size of 250 bp. Under this strategy, two consecutive windows will have 250 bp overlap, such that any ChIP signal, as long as shorter than 250 bp, will be completely covered in one window. This could help better detect the differential ChIP signal (compared to using non-overlap 500 bp windows where signal may split at the window boundary). Third, for each window, we define the total coverage score y as the summation of reads coverage score from all base pairs within the window. To illustrate our method for differential ChIP-seq analysis, we consider comparing the H3K4 tri-methylation between Repressed (REP) vs Memory (STR) conditions. We define a relative distance measure (D) between these two conditions as Di= yiREPyiSTR12(yiREP+yiSTR), i=1, , m.where yiREP and yiSTR are the total coverage score in the ith window for REP and STR conditions respectively. Likewise, we define the average coverage score in the log scale as Ai=log(12(yiREP+yiSTR)). As smaller yi values tend to be unstable, the same Di value at different average magnitude of ChIP signal may have different significance (Figure 4—source data 1). We propose an adaptive criterion to select windows with significant difference. 1. For biological significance, we only considered the windows whose average signal exceeds the 10% quantile genome-wide. 2. The remaining range of Ai from 0.10 quantile to its maximum is divided into consecutive bins with bin width of 0.1 (in the log scale). 3. For windows within each bin, we selected windows that corresponded to the lower or upper αth quantile or more extreme as putative significantly differentially methylated region. For example, in the REP vs. STR WT tri-methylation comparison, we are interested in regions that have lower tri-methylation in the REP condition. Thus we only select windows within each bin whose Di values are no greater than the lower αth qunatile. In this study the top 3% was used. All adjacent or overlapping windows were selected from this pipeline and merged together. For comparisons in which we expected the two samples to have a similar ChIP signal, we chose the windows corresponding to the middle 60% Di values of the distribution.

https://doi.org/10.7554/eLife.16691.009
Figure 4—figure supplement 1
Loss of Set3 has no effect on histone acetylation or H3K4me3 at the INO1 promoter.

(A) Chromatin immunoprecipitation (ChIP) using anti-H3K4me3 (A), anti-acetyl H3 (B) and anti-acetyl H4 (C) from either wild-type or set3Δ grown under repressing, activating or memory conditions. GAL1 promoter and PRM1 serve as a negative controls. *p<0.05, compared with the repressing condition (Student’s t-test).

https://doi.org/10.7554/eLife.16691.010
Molecular requirements for PIC assembly during transcriptional memory.

(A, D, G and J) Confocal micrographs of the indicated proteins fused to FRB-GFP before or after treatment with rapamycin for 90 min. (B, E, H and K) ChIP against RNAPII from strains expressing Spt15-FRB-GFP (B), Med1-FRB-GFP (E), TFB1-FRB-GFP (H) or Kin28-FRB-GFP (K), grown under either activating or memory conditions, before or after treatment 1 µg/ml of rapamycin. (C, F, I and L) ChIP against H3K4me2 from strains expressing Spt15-FRB-GFP (C), Med1-FRB-GFP (F), TFB1-FRB-GFP (I) or Kin28-FRB-GFP (L), grown under either activating or memory conditions, before or after treatment 1 µg/ml of rapamycin. All ChIP experiments are averages of three biological replicates ± standard error of the mean, quantified as in panel 1A, using primers to amplify the INO1 promoter (−348 to −260) or the PRM1 CDS. Mock treatment had no effect (not shown). *p<0.05, compared with 0 min rapamycin (Student’s t-test).

https://doi.org/10.7554/eLife.16691.011
Transcriptional memory leads to Ssn3/Cdk8-dependent poised preinitiation complex.

(A) ChIP against Med1-GFP, Med13-GFP or Ssn8-GFP from cells grown under repressing, activating or memory conditions. (B) ChIP against Ssn3-FRB-GFP from cells grown in repressing, activating or memory conditions. (A and B) *p<0.05, compared with the repressing condition (Student’s t-test). (C) ChIP against RNAPII from strains expressing Ssn3-FRB-GFP grown under either repressing or memory conditions, before or after treatment 1 µg/ml of rapamycin using primers to amplify the INO1 promoter (−348 to −260) or the PRM1 CDS. Inset: confocal micrographs of Ssn3-FRB-GFP expressing cells before or after treatment with 1 mg/ml of rapamycin for 30 min. *p<0.05, compared with t = 0 (Student’s t-test). (D and E) INO1 activation (D) or reactivation (E) in Ssn3-FRB-GFP cells. For activation at time = 0, cells were shifted from medium containing 100 μM inositol (repressing conditions; red arrow in schematic) to medium without inositol (activating conditions; green arrow in schematic). For reactivation, cells were shifted from activating medium to repressing medium containing 100 μM inositol for 3 hr. Cells were treated ±1 µg/ml rapamycin for 45 min before transferring to activating conditions. Cells were harvested at the indicated time points, and INO1 mRNA levels were quantified relative to ACT1 mRNA levels by RT-qPCR. The averages of three biological replicates are shown ± standard error of the mean. *p<0.05, compared with the same time point in the mock-treated culture (Student’s t-test). (F and G) ChIP against RNAPII (F) or Cdk8 (G) from HeLa cells before, during (24 hr) or 48 hr after treatment with 50 ng/mL Interferon-γ. Recovery of the indicated promoters or coding sequences (CDS) of genes that exhibit transcriptional memory (HLA-DRA, HLA-DPB1, HLA-DQB1 and OAS2) and a gene that does not (HIVEP2) was quantified relative to input by qPCR. *p<0.05, compared with the uninducing condition (Student’s t-test). (A-F) Averages of three biological replicates ± standard error of the mean.

https://doi.org/10.7554/eLife.16691.012
Salt-induced transcriptional memory leads to dimethylation of H3K4 and binding of poised RNAPII.

(A) mRNA levels of three genes that exhibit transcriptional memory (PGM2, PMT5 & YGP1) and one gene that does not (HSP31) at the indicated times after treatment with 0.5mM H2O2. Prior to treatment with H2O2, cells were grown either in rich media (no salt; red lines) or treated with 0.7M NaCl for 1 hr and then allowed to recover for 2 hr in rich media (after salt; blue lines). mRNA levels were quantified relative to ACT1 by RT-qPCR. Shown are the averages of three biological replicates ± standard error of the mean. *p<0.05, compared with the same time point in the no salt culture (Student’s t-test). (B) mRNA levels of three genes that exhibit transcriptional memory (PGM2, PMT5 & YGP1) and one gene that does not (HSP31) from set3∆ mutant cells at the indicated times after treatment with 0.5 mM H2O2 same data as in (A). (C and D) ChIP against RNAPII (C), H3K4me2 (D) from wild-type and set3∆ cells grown either in the absence of salt (no salt) or treated with 0.7M NaCl for 1 hr and allowed to recover for 2 hr in rich medium (after salt). (E) ChIP against Ssn3-FRB-GFP cells grown either in the absence of salt (no salt) or treated with 0.7M NaCl for 1 hr and allowed to recover for 2 hr in rich medium (after salt). All ChIP experiments are averages of three biological replicates ± standard error of the mean, quantified as in panel 1A, using primers to amplify the promoters of the indicated genes. *p<0.05, compared with the no salt condition (Student’s t-test).

https://doi.org/10.7554/eLife.16691.013
Models for transcriptional memory.

(A) Set1/COMPASS remodeling during INO1 transcriptional memory. Nucleosomes associated with repressed INO1 in the nucleoplasm are hypoacetylated and unmethylated. Active INO1 is targeted to the nuclear periphery, nucleosomes are acetylated (orange circles) and H3K4 is trimethylated (blue circles) by COMPASS. During memory, INO1 remains associated with the nuclear pore complex, acetylation is lost, H2A.Z is incorporated and H3K4 is dimethylated by a remodeled form of COMPASS lacking the Spp1 subunit (purple). H3K4me2 recruits Set3C, which promotes the persistence of H3K4me2 by feedback on COMPASS recruitment or remodeling. (B) Cdk8+ Mediator promotes transcriptional poising. Upon activation, Cdk8- Mediator and the PIC bind to the INO1 promoter. TFIIK (Kin28/Cdk7) phosphorylates Serine 5 on the carboxy terminal domain of RNAPII to initiate transcription. During memory, Kin28 is lost and Cdk8+ Mediator is recruited. Cdk8+ Mediator promotes PIC recruitment but initiation is blocked by the absence of Kin28, poising the promoter for future activation.

https://doi.org/10.7554/eLife.16691.014

Tables

Table 1

Yeast strains.

https://doi.org/10.7554/eLife.16691.015
NameGenotypeFiguresReferences
CRY1MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-11C-F 2A,B,D 4C-F, 7A and BBrickner & Walter, 2004
ADY06MATα ade2-1 can1-100 his3-11, 15, leu2-3,112 trp1-1 ura3-1 set3∆::KanMX4E and F
7C and D
Light et al., 2013
ADY20MATa ade2-1, can1-100, TFB1-GFP-FRB:HIS5+ leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP15G-IThis study
ADY21MATa ade2-1, can1-100, SPT15-GFP-FRB:HIS5+ leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP15A-CThis study
ADY22MATa ade2-1, can1-100, MED1-GFP-FRB:HIS5+ leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP15D-FThis study
ADY23MATa ade2-1, can1-100, SWD1-GFP-FRB:HIS5+ leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP12D-F, 3AThis study
ADY24MATa ade2-1, can1-100, SET3-GFP-FRB:HIS5+ HOS2-GFP-FRB: KanMX, leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP14A, G-IThis study
ADY31MATa ade2-1 can1-100, sfl1∆::HIS3, leu2-3,112 trp1-1 ura3-11C 1D 1E 1F 2AThis study
WLY154MATa ade2-1 can1-100, his3-11,15, leu2-3,112 trp1-1 ura3-1 INO1-mrsmut1A 2ALight et al., 2013
ADY32MATa ade2-1 can1-100 SFL1-FRB-GFP:HIS5+, leu2-3,112 trp1-1 ura3-1 1AThis study
ADY33MATa ade2-1 can1-100 SFL1-FRB-GFP:HIS5+ leu2-3,112 trp1-1 ura3-1 INO1-mrsmut1AThis study
JMY047MATa ade2-1 can1-100 his3-11,112 trp1-1 LacO:INO1:URA3 PHO88-mCherry:SpHis5, LEU2:LacI-GFP1BThis study
JMY049MATa ade2-1 can1-100 his3-11,112 trp1-1 LacO:INO1:URA3 PHO88-mCherry:SpHis5 LEU2:LacI-GFP sfl1∆:: KanMX1BThis study
CEY272ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 LEU2:pER05 HIS3:LacI-GFP URA3:LexA BS [pADH-LexA]1BRandise-Hinchliff et al., 2016
CEY277ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 LEU2:pER05 HIS3:LacI-GFP URA3:LexA BS [pADH-LexA-SFL1]1BThis study
WLY155MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 HIS3:pAFS144 TRP1:pRS304-Sec63-Myc INO1:p6LacO128-INO1 set1∆::His5+2BLight et al., 2013
ADY41MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1-hhf1::NatMX4 hht2-hhf2::[HHTS-HHFS]*-URA3 HHT-K4R2C and DDharmacon
J. Dai et al., 2008
PJD47MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1-hhf1::NatMX4 hht2-hhf2::[HHTS-HHFS]*-URA3 wildtype HHT2C and DDharmacon
J. Dai et al., 2008
ADY42MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1-hhf1::NatMX4 hht2-hhf2::[HHTS-HHFS]*-URA3 HHT-K4A2C and DDharmacon
J. Dai et al., 2008
ADY34MATa ade2-1, can1-100, SPP1-GFP-FRB:HIS5+ leu2-3,112 trp1-1 ura3-12E, 3A-CThis study
ADY35MATa ade2-1 can1-100, SET3-FRB-GFP:HIS5+ leu2-3,112 trp1-1 ura3-14BThis study
ADY36MATa ade2-1 can1-100, SET3W140A-FRB-GFP:HIS5+ leu2-3,112 trp1-1 ura3-1 4B-DThis study
ADY37MATa ade2-1 can1-100 SET3-FRB-GFP:HIS5+ leu2-3,112 trp1-1 ura3-1 slf1∆::KanMX 4BThis study
ADY38MATa ade2-1 can1-100 KIN28-FRB:His5+ leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP14J 4K 4LThis study
ADY39MATa ade2-1 can1-100 SSN3-GFP-FRB:His5+ leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP16B-EThis study
HHY168MATα ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 tor1-1 fpr1∆::NAT RPL13A-2xFKBP12::TRP12Sup.1EHaruki et al., 2008
Bre2-GFPMATa his3∆ leu2∆I met150∆I ura3∆0 BRE2-GFP:His5+3AOpen Biosystems
Ghaemmaghami et al.
Sdc1-GFPMATa his3∆ leu2∆I met150∆I ura3∆0 SDC1-GFP:His5+3AOpen Biosystems
Ghaemmaghami et al.
Med1-GFPMATa his3∆ leu2∆I met150∆I ura3∆0 MED1-GFP:His5+6AOpen Biosystems
Ghaemmaghami et al.
Med13-GFPMATa his3∆ leu2∆I met150∆I ura3∆0 MED13-GFP:His5+6AOpen Biosystems
Ghaemmaghami et al.
Ssn8-GFPMATa his3∆ leu2∆I met150∆I ura3∆0 SSN8-GFP:His5+6AOpen Biosystems
Ghaemmaghami et al.
Table 2

Oligonucleotides

https://doi.org/10.7554/eLife.16691.016
Primers NameSequence
INO1 Promoter FWTCATCCTTCTTTCCCAGAATATTG
INO1 Promoter RVCTCAAATTAACATTGCCGCC
INO1 CDS1 FWTAGTTACCGACAAGTGCACGTACAA
INO1 CDS1 RVTAGTCTTGAACAGTGGGCGTTACAT
INO1 CDS2 FWGCGGAGGGGAATGACGTTTATG
INO1 CDS2 RVCATATTCGAGAACTTGACTTCTCTGC
INO1 CDS3 FWACGCATCAGACGCGATATCCAG
INO1 CDS3 RVCTGCAAGAGGTTTTCCATGGTGTC
ACT1CDS FWGGTTATTGATAACGGTTCTGGTATG
ACT1CDS RVATGATACCTTGGTGTCTTGGTCTAC
PRM1 CDS FWTAACAAGATTTGTCATCCAGCCTGC
PRM1 CDS RVCCTCCTATACAAAATGGCCAATATG
GAL Promoter FWCCCCACAAACCTTCAAATTAACG
GAL Promoter RVCGCTTCGCTGATTAATTACCC
HSP31 promoter FW:GAATTAACGTTACTCATTCCTAGCC
HSP31 promoter RVTTTAAAGGGTAACGGAAACCGGAAG
HSP31 CDS FW:GTTGGGATGAGCATTCCTTAGCC
HSP31 CDS RV:ATAGTCAAATAAGGTACCGTGGCC
PGM2 promoter FW:GGAACTTACGTGAAAGGGGACG
PGM2 promoter RV:CCCACATTGTTCGGGCGGC
PGM2 CDS FW:TGCCACTCTTGTTGTCGGTGGTG
PGM2 CDS RV:GGTTCTCATGATGTGAGAAGCGGC
USV1 promoter FW:AGTCTTCCGTATATAACAATCTCAATCC
USV1 promoter RV:GTTAATGAAGCTGTTGCAAAATACTGC
USV1 CDS FW:CTAGAGCGGAACATCTTGCACGTC
USV1 CDS RV:GCTGGTGCGAGCTGGTAGAATGG
PMT5 promoter FW:TCGCTCAAATAAGTATGATCTGCAAG
PMT5 promoter RV:ACTACGCTTCTGTTCCTTTTCTATTG
PMT5 CDS FW:CTGCCATCGTAAGGCTACACAATATC
PMT5 CDS RVGAGGACACGGTTGCATATAGCATTG
GLC3 promoter FW:ATATTACGGCATCATCTTTCCCCG
GLC3 promoter RV:GGAAAATGGAAAGCCTTCCTTGC
GLC3 CDS FW:TCATGCTACGCCTGATGGTTCG
GLC3 CDS RV:CTCCCACTAGAAATGCACGTTCC
YGP1 promoter FW:CTCTATTGCATCTTCAAACTCCGAAG
YGP1 promoter RV:CAAGCTTTTTATATTTCAGAGATGATGG
YGP1 CDS FW:GCCTGGAATGGGTCTAACTCTAGC
YGP1 CDS RV:GGTGTAGTTTGTGTGGGTCAAAGAAC
HLA-DRA Pro ForGATTTGTTGTTGTTGTTGTCCTGTTTG
HLA-Dra Pro revGCAAATCAATTACTCTTTGGCCAATCAG
HLA-Dra CD ForGAAAGCAGTCATCTTCAGCGTT
HLA-DRA CD RevAGAGGCATTGGCATGGTGATAAT
CIITA Pro ForGTTCCCCCAACAGACTTTCTG
CIITA Pro RevAGGTGGCCCCAAGCGGTCAG
CITIA CD ForCACAGCCACAGCCCTACTTT
CIITA CD RevCCGACATAGAGTCCCGTGA
HLA-DPB1 Pro ForGGGCCAGCAGAATATTTGAGATCACC
HLA-DPB1 Pro RevGAGTCATTGCTCACTAGGCAGAAAGTTAG
HLA-DPB1 CD ForTCCAGCCTAGGGTGAATGTTTCCC
HLA-DPB1 CD RevTGGTGGACACGACCCCAGCTGTTTCCTCCTG
HLA-DQB1 Pro ForGGCACTGGATTCAGAACCTTCACAAA
HLA-DQB1 Pro RevCTGTGGATGTTTCCATGCGTGGTAGGATTGG
HLA-DQB1 CD ForCCCACAGTGACCATCTCCCCATCCAGGAC
HLA-DQB1 CD RevGGGGTGGACACAACGCCAGCTGTCTCCTCC
OAS2 Pro ForCAGTAAACCTTGCTGCAAGGGGCGGGGAAG
OAS2 Pro RevCCGGGACAGGGAAACAAAACTAACTTAAGC
OAS2 CD ForGGCTCCTATGGACGGAAAACAGTC
OAS2 CD RevCAACCACTTCGTGAACAGACAGAACTTC
URA3 FWGACTCACTATAGGGCGAATTGGAGC
URA3 RVGCCAAGCTCGGAATTAACCCTCAC
SUC2 Prom FWCCTAAGGGCTCTATAGTAAACCATTTG
SUC2 Prom RVGCACAAGAACAAGAGAATGTTTTGAAG

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Agustina D'Urso
  2. Yoh-hei Takahashi
  3. Bin Xiong
  4. Jessica Marone
  5. Robert Coukos
  6. Carlo Randise-Hinchliff
  7. Ji-Ping Wang
  8. Ali Shilatifard
  9. Jason H Brickner
(2016)
Set1/COMPASS and Mediator are repurposed to promote epigenetic transcriptional memory
eLife 5:e16691.
https://doi.org/10.7554/eLife.16691