Figures and data in Cell-wall remodeling drives engulfment during Bacillus subtilis sporulation

Figures
Videos
Tables
Additional files

4 figures, 6 videos, 4 tables and 2 additional files

Figures

Figure 1 with 3 supplements

Download asset Open asset

Peptidoglycan (PG) synthesis is essential for leading-edge (LE) migration.

(A) Morphological changes during spore formation. Peptidoglycan shown in grey, membrane in red. (1) Vegetative cell. (2) The first morphological step in sporulation is asymmetric cell division, producing a smaller forespore and a larger mother cell. (3) The septum curves and protrudes towards the mother cell. (4) The mother cell membrane migrates towards the forespore pole. The different modules contributing to membrane migration are shown in the inset (see Introduction for details). During engulfment, the septal PG is extended around the forespore (Tocheva et al., 2013). (5) Fully engulfed forespore surrounded by two membranes sandwiching a thin layer of PG. (B) Snapshots of engulfing sporangia from time-lapse movies in the absence of antibiotics, or in the presence of cephalexin or bacitracin. Cells were stained with fluorescent membrane dye FM 4–64 and imaged in medial focal plane. In the absence of antibiotics (top) the septum curves and grows towards the mother cell without significant forward movement of the engulfing membrane for ∼20 min. After that, the LE of the engulfing membrane starts migrating and reaches the forespore pole in ∼1 hr. When PG precursor delivery system is blocked with bacitracin (50 μg/ml): (I) LE migration is stopped or (II) engulfment proceeds asymmetrically. Similar results are obtained when cells are treated with cephalexin (50 μg/ml). However, in this case the asymmetric engulfment phenotype observed at later time points is due to rotation of the engulfment cup (C) rather than to asymmetric movement forward of the engulfing membrane (D). (E) FM 4–64 average kymograph of $n$ = 24 engulfing cells (see Materials and methods, Appendix 1). Average fluorescent intensity along forespore contour vs time in the mother-forespore reference frame as shown in top inset. All cells are aligned in time based on time 0’ (0 min). Time 0’ is assigned to the onset of curving septum (Figure 1—figure supplement 3). Bottom inset is average kymograph represented as heat map. (F–G) Average kymograph for cells treated with cephalexin ( $n$ = 18) (F) or bacitracin ( $n$ = 26). (G) When drug was added analyzed cells had (55 ± 5)% engulfment (red arrow). The percentage of engulfment is calculated as total angle of forespore covered with mother membrane divided by full angle. All cells had fully curved septum. Non-engulfed part of the forespore is represented as the black regions in kymographs. (H) In untreated sporangia, gap starts to close ∼20 min after onset of membrane curving. In antibiotic-treated cells gap does not close. Sample size as in (F–G). Red arrow points when drug is added. Average ± SEM. Scale bar 1 μm.

https://doi.org/10.7554/eLife.18657.003

Figure 1—figure supplement 1

Download asset Open asset

Sporulation minimal inhibitory concentration.

(A) Microscopy pictures of cells sporulating before antibiotic treatment (t2), or 2 hr later (t4) after treatment with antibiotics blocking different steps on the PG biosynthetic pathway: synthesis of cytoplasmic PG intermediates (D-cycloserine), recycling of undecaprenyl-P (bacitracin), cross-linking of the glycan strands (vancomycin), or PBP activity (amoxicillin, cephalexin, cloxacillin, oxacillin and penicillin V). Cells were stained with Mitotracker Green (green, membrane permeable) and FM 4–64 (red, membrane impermeable) to visualize membranes. When engulfment is completed, the forespore membranes are only stained by Mitotracker green, but not by FM 4–64 (Sharp and Pogliano, 1999). (B) Graphs showing the percentage of cells that have undergone polar septation (% sporangia) and the percentage of sporangia that have completed engulfment (% engulfed sporangia) at different time points after sporulation induction, in cultures treated with different antibiotics that block PG synthesis. Antibiotics were added 2 hr after sporulation induction (red arrows). Samples were taken every hour for 5 hr, stained with MTG and FM 4–64 and visualized under the microscope. More than 300 cells were quantified per time point and antibiotic concentration. (C) Table showing the Minimal Inhibitory Concentration (MIC) of antibiotics blocking PG synthesis during vegetative growth (Vegetative MIC), and the estimated MIC during sporulation (Sporulation MIC). The Sporulation MIC was defined as the concentration or concentration interval that block the formation of new polar septa, and was inferred from the graphs in B. Scale bar 1 μm.

https://doi.org/10.7554/eLife.18657.004

Figure 1—figure supplement 2

Download asset Open asset

Quantification of cell division events in timelapse movies.

Fraction of cell division events per cell observed during the first 90 min and 150 min of imaging in timelapse movies of sporulating cultures treated with bacitracin (50 μg/ml), cephalexin (50 μg/ml), or untreated. At least 296 vegetative cells were tracked over time for every condition. The total number of division events observed after 90 min or 150 min was divided by the number of cells tracked in each case.

https://doi.org/10.7554/eLife.18657.005

Figure 1—figure supplement 3

Download asset Open asset

Image analysis of non-treated cells.

(A) Time course of septum curvature. The horizontal dashed grey line corresponds to inverse cell-wall radius (FM 4–64) measured at the cell middle ( $1 / R = (2.3 \pm 0.4) μ m^{- 1}$ , $n =$ 14). (B) Time course of mother-cell area. (C–D) FM 4–64 kymographs of partially engulfed forespores ( $n$ = 6 with (55 ± 5)% of engulfment;= 7 with (70 ± 5)% of engulfment, respectively). This is a control analysis of non-treated cells for the experiment when partially engulfed cells treated with drugs stop engulfment (see Figure 1F–G). Average ± SEM.

https://doi.org/10.7554/eLife.18657.006

Figure 2 with 3 supplements

Download asset Open asset

PG synthesis at the LE of the engulfing membrane by forespore PBPs contribute to proper localization of the DMP complex.

(A) Sporulating cells stained with a green fluorescent derivative of penicillin V (BOCILLIN-FL). Bright foci are observed at the LE of the engulfing membrane. Membranes were stained with FM 4–64 (red). (B) Average BOCILLIN-FL (green) and FM 4–64 (red) fluorescence intensities along forespore contours plotted as a function of the degree of engulfment. Cells are binned according to percentage of engulfment. BOCILLIN-FL signal is enriched at the LE throughout engulfment ( $n$ = 125). (C) Cell-specific localization of the peptidoglycan biosynthetic machinery. GFP tagged versions of different *B. subtilis* PBPs and actin-like proteins (ALPs) were produced from mother cell- (MC) or forespore- (FS) specific promoters. (D) Six different localization patterns were observed upon cell-specific localization of PBPs and ALPs. For each pair of images, left panel shows overlay of membrane and GFP fluorescence, while the right panel only shows GFP fluorescence. Pictures of representative cells displaying the different patterns are shown (top, GFP fusion proteins transcribed from spoIIR promoter for forespore-specific expression, and from spoIID promoter for mother cell-specific expression). The six different patterns are depicted in the bottom cartoon and proteins assigned to each one are indicated. Membranes were stained with FM 4–64. See Figure 2—figure supplement 1 for cropped fields of all PBPs we assayed. Transglycosylase (TG), transpetidase (TP), carboxipetidase (CP), endopeptidase (EP), actin-like protein (ALP). (E) TIRF microscopy of forespore-produced GFP-MreB in four different forespores (i to iv). In every case, the leftmost picture is an overlay of the forespore membranes (shown in white) and the tracks followed by individual TIRF images of GFP-MreB (color encodes time, from blue to red). Sporangia are oriented with the forespores up. For the first sporangia (i), snapshots from TIRF timelapse experiments taken 8 s apart are shown. Arrows indicate GFP-MreB foci and are color coded to match the trace shown in the left panel. Rightmost panel for each forespore shows a kymograph representing the fluorescence intensity along the line joining the leading edges of the engulfing membrane over time (from top to bottom; total time 100 s). Average focus speed (n = 14) is indicated at the bottom. Timelapse movies of the examples presented here and additional sporangia are shown in Video 2. (F) Localizaiton of GFP-SpoIIP in untreated sporangia, or in sporangia treated with bacitracin (50 μg/ml) or cephalexin (50 μg/ml). (G) Fraction of GFP-SpoIIP fluorescence at LE of the engulfing membrane. Bars represent the average and standard error of 85 untreated sporangia, 38 sporangia treated with bacitracin (50 μg/ml), and 67 sporangia treated with cephalexin (50 μg/ml). (H) Model for PG synthesis and degradation at the LE of the engulfing membrane. New PG is synthesized ahead of the LE of the engulfing membrane by forespore-associated PG biosynthetic machinery, and is subsequently degraded but the mother-cell DMP complex. We propose that DMP has specificity for the peptide cross-links that join the newly synthesized PG with the lateral cell wall (orange), which leads to the extension of the septal PG around the forespore. Scale bars 1 μm.

https://doi.org/10.7554/eLife.18657.008

Figure 2—figure supplement 1

Download asset Open asset

Cell-specific localization of PBPs and actin-like proteins.

GFP was fused to the N-terminus of PBPs and actin-like proteins. The fusion proteins where produced in the forespore or in the mother cell after polar septation by placing the fusion genes under the control of either the forespore specific promoters (PspoIIQ or PspoIIR, for stronger or weaker expression, respectively) or the mother-cell specific promoter PspoIID. With the exception of GFP-PbpE, all the fusions localize to the membrane. GFP-MreB and GFP-Mbl associate to the membrane when produced in the forespore, while GFP-MreBH only shows a week membrane association. When produced in the mother cell, GFP-Mbl and GFP-MreBH remain mostly cytoplasmic, and GFP-MreBH forms some foci distributed around the membrane. Membranes were stained with FM 4–64. The different localization patterns are summarized in Figure 2D.

https://doi.org/10.7554/eLife.18657.009

Figure 2—figure supplement 2

Download asset Open asset

Localization of forespore GFP-PonA and GFP-PbpA in different mutant backgrounds.

GFP-PonA and GFP-PbpA were produced specifically in the forespore after polar septation by placing the fusion genes under the control of PspoIIR. The localization of both proteins was determined in wild-type background and in different mutants lacking specific sporulation proteins. GFP-PonA and GFP-PbpA still track the leading edge of the engulfing membrane or localize to the interception between the septal peptidoglycan and the lateral cell wall in all the mutant backgrounds tested. Membranes were stained with FM 4–64. Scale bar, 1 μm.

https://doi.org/10.7554/eLife.18657.010

Figure 2—figure supplement 3

Download asset Open asset

SpoIIDMP localization upon treatment with different antibiotics blocking PG synthesis.

(A) Localizaiton of GFP-SpoIIP in untreated sporangia, or in sporangia treated with bacitracin (50 μg/ml), amoxicillin (500 μg/ml), cephalexin (50 μg/ml), cloxacillin (500 μg/ml), oxacillin (50 μg/ml), or penicillin V (500 μg/ml). Membranes were stained with FM 4–64. (B) Fraction of GFP-SpoIIP fluorescence at LE of the engulfing membrane. Bars represent the average and standard error of 85 untreated sporangia, 38 sporangia treated with bacitracin (50 μg/ml), 37 treated with amoxicillin (500 μg/ml), 67 treated with cephalexin (50 μg/ml), 43 treated with cloxacillin (500 μg/ml), 36 treated with oxacillin (50 μg/ml), and 39 treated with penicillin V (500 μg/ml). (C,D) Localization of GFP-SpoIID (C) and GFP-SpoIIM (D) in untreated sporangia or in sporangia treated with bacitracin (μg/ml) or cephalexin (50 μg/ml). Membranes were stained with FM 4–64. (E,F) Fraction of GFP-SpoIID (E) or GFP-SpoIIM (F) at LE. Bars represent the average and standard error of 106 untreated sporangia, 110 bacitracin-treated sporangia and 126 cephalexin-treated sporangia for GFP-SpoIID (E), and 86 untreated, 79 bacitracin-treated and 63 cephalexin-treated sporangia for GFP-SpoIIM (F). Scale bars, 1 μm.

https://doi.org/10.7554/eLife.18657.011

Figure 3 with 1 supplement

Download asset Open asset

Template model for leading edge (LE) movement.

(A) Cell cross-section with glycan strands in the plane perpendicular to the long axis of the cell. One strand from old cell wall (blue) and one strand from newly synthesized germ-cell wall (green) are used as a template for new glycan insertion. Coordination between glycan insertion (orange arrow) and peptide cross-link degradation (black cross) drives LE forward. (B) 3D model of stochastic glycan insertion by insertion-degradation complex (IDC) with transpeptidase and transglycosylase activity. Probability of IDC to start inserting new glycan from old glycan end and repair end defect is $p_{rep}$ . (C) New inserted glycan shown in dark green. Probability of IDC to continue glycan insertion when it encounters gap in old cell wall is probability of processivity $p_{pro}$ . (Inset) Horizontal (between old and new glycan strands) and vertical (between new glycan strands) peptide links are shown in red. In our coarse-grained model glycans are simulated as semi-flexible filaments consisting of beads (green) connected with springs (green). Peptides are simulated as springs (red) connecting neighboring glycan beads.

https://doi.org/10.7554/eLife.18657.013

Figure 3—figure supplement 1

Download asset Open asset

Extended models that account for glycan-strand degradation.

Here we further explore possible mechanisms considering the fact that SpoIID protein of DMP complex shows transglycosylase activity (Morlot et al., 2010). (A) In the two-for-one mechanism two new glycan strands are added and the newly inserted glycan strand at the LE is degraded (Höltje, 1998). Similarly, the three-for-one mechanism would also work (Scheffers and Pinho, 2005). (B) One new glycan strand is added and the innermost cell-wall glycan of the thick old cell wall is degraded. Similar to images of electron microscopy (Tocheva et al., 2013). However, in these models cell-wall degradation without high level of coordination could affect cell-wall integrity and induce cell lysis. All these models share the ’make-before-break’ strategy promoting robustness of the remodeling process (Koch and Doyle, 1985).

https://doi.org/10.7554/eLife.18657.014

Figure 4 with 5 supplements

Download asset Open asset

Template model reproduces experimentally observed phenotypes.

(A) Effective spring constants in our model represent coarse-grained PG network. Here the angle between neighboring stem peptides that belong to a single glycan is assumed to be 90°. Therefore, every other stem peptide is in plane with glycan sheet (Nguyen et al., 2015, Huang et al., 2008). The role of effective glycan persistence length on engulfment is negligible (see Figure 4—figure supplement 3). (B) Simulations for different values of effective peptide $k_{pep}$ and glycan $k_{gly}$ spring constants are compared with experimentally measured forespore surface area, volume and engulfment using mutual $χ^{2}$ statistics (Equation 2). Arrows point to effective literature $k_{pep}$ and $k_{gly}$ (Nguyen et al., 2015). Dark blue region corresponds to simulation parameters that best fit experimental data (Figure 4—figure supplement 4, Video 3). For large enough $k_{gly}$ $>$ 200 pN/nm mutual $χ^{2}$ is almost independent of $k_{gly}$ . (C) Snapshots of WT simulations for parameters ( $k_{gly}$ = 200 pN/nm, $k_{pep}$ = 25 pN/nm, $N_{IDC}$ = 5) marked with ’ $\times$ ’ in panel (B) (Video 2). The thick septum is treated as outer cell wall, and is assumed degraded once IDCs move along. (D–E) Time traces of experimentally measured engulfment, forespore surface area and forespore volume (green) in comparison with results from a single simulation (orange). Parameters used in simulation are marked with ’ $\times$ ’ in panel (B). For all other parameters see Appendix 2, Appendix-table 1. (F) Snapshots of fully engulfed forespores for various peptidoglycan elastic constants. (G) For various values of independent parameters $p_{rep}$ and $p_{pro}$ roughness of the LE is calculated at the end of stochastic simulations (see Figure 4—figure supplement 1, and Video 4). Here 0 roughness correspond to perfectly symmetric LE; for high enough $p_{rep} = p_{pro}$ $>$ 0.8 LE forms symmetric profiles. (H) Simulation for asymmetric engulfment is obtained for same parameter as WT except $p_{rep} = p_{pro}$ = 0.7 (marked with ’ $\times$ ’ in panel (G)). Average ± SD. Scale bars 1 μm.

https://doi.org/10.7554/eLife.18657.015

Figure 4—figure supplement 1

Download asset Open asset

Simulation of the stochastic model of insertion at the leading edge (LE).

(A–D) Stochastic insertion at the LE of discretized cell circumference with 1570 segments. The details are explained in the Materials and Methodes SI section (2.1). Simulations are run until the LE reaches 500 glycans in height. For obtained LE profiles roughness and their widths are calculated. For each set of independent parameters $p_{rep}$ , $p_{pro}$ and $N_{IDC}$ we run 100 simulations and plot the average roughness and width. Parameters $p_{rep}$ and $p_{pro}$ are varied in steps of 0.1. (A,C) For $N_{IDC}$ = 10 smooth LEs are obtained for $p_{rep}$ and $p_{pro} >$ 0.80. For such parameters changing $N_{IDC}$ by an order of magnitude marginally affects LE width while keeping LE roughness within 10%.

https://doi.org/10.7554/eLife.18657.016

Figure 4—figure supplement 2

Download asset Open asset

In simulations majority of peptide extensions are in the linear elastic regime.

(A) Histogram of all peptide link lengths during one engulfment ( $k_{pep}$ = 25 pN/nm, $k_{gly}$ = 200 pN/nm, $Δ p$ = 86.31 kPa). Black arrow points to the linear extension regime (i.e. where each peptide is extended <1 nm or <50% of its equilibrium length of 2 nm) (Nguyen et al., 2015). (B) Percentage of peptide links in simulations that are extended in linear regime as a function of time during the process of engulfment. Dashed vertical line is same as in Figure 4D,E.

https://doi.org/10.7554/eLife.18657.017

Figure 4—figure supplement 3

Download asset Open asset

Engulfment is unaffected by glycan persistence length.

(A) $χ^{2}$ (defined in Materials and methods) is used to quantify the impact of effective glycan persistence length ( $l_{p}$ ) on engulfment dynamics. In weakly crosslinked bundles $l_{p} = n l_{p0}$ , where $n$ is the number of glycans in the bundle and $l_{p0}$ is the persistence length of a single glycan; in strongly cross-linked bundles $l_{p} = n^{2} l_{p0}$ (Claessens et al., 2006; Piechocka et al., 2010). Since our simulated filaments represent bundles of seven glycans (Figure 4B), the effective persistence length can reach ∼2 μm ( $l_{p0}$ = 40 nm). (B–C) Engulfment, forespore surface area and forespore volume are not affected even for high values of effective glycan persistence length ( $l_{p} = 4 μ$ m).

https://doi.org/10.7554/eLife.18657.018

Figure 4—figure supplement 4

Download asset Open asset

Simulations with different peptidoglycan (PG) elastic constants.

(A–C) Simulation snapshots for three different sets of PG elastic constants marked with ’ $\times$ ’ in panel B (A: $k_{pep}$ = $k_{gly}$ = 50 pN/nm; B: $k_{pep}$ = 25 pN/nm, $k_{gly}$ = 200 pN/nm C; $k_{pep}$ = 25 pN/nm, $k_{gly}$ = 5 570 pN/nm ). Elastic constants in C are obtained from molecular dynamic simulations (Nguyen et al., 2015). $Δ T$ = 0.28 hr; scale bar 1 μm. (D) Same as Figure 4B, repeated here for clarity. (E) Relative forespore curvature at the end of engulfment where $κ_{0}$ is the curvature of spherical cap. At the end of engulfment curvature was experimentally measured with $σ (κ) / κ \sim 0.15$ , where $σ (κ)$ is the standard deviation (see Figure 1—figure supplement 3A). Therefore, curvatures in , B, and C are within the experimentally measured standard deviation. (F) Snapshots of fully engulfed forespores for various PG elastic constants.

https://doi.org/10.7554/eLife.18657.019

Figure 4—figure supplement 5

Download asset Open asset

Simulations with decoupled synthesis and degradation.

(A) Simulation snapshots for different values of time delay $τ_{delay}$ . Newly inserted glycans are separated from the old cell wall by cutting connecting peptides with typical $τ_{delay}$ . Double arrow shows distance between synthesis and membrane leading edge. (B) Euclidian distance between insertion and degradation (ID separation) vs time for different values of $τ_{delay}$ . Average over five insertion complexes is plotted vs time. (C) Exploration of delay model when degradation erroneously cuts vertical peptide bonds with probability $p_{pcut}$ . (D) For relatively small $p_{pcut} =$ 0.1, an irregular peptidoglycan meshwork is formed. (E–F) Exploration of role of random peptide degradation when synthesis is stopped. (E) Simulation snapshots for various random peptide degradation rates $p_{rpep}$ = 2.2, 22, and 33 min⁻¹. (F) Forespore volume vs time for different peptide degradation rates after synthesis is stopped. Scale bars 1 μm.

https://doi.org/10.7554/eLife.18657.020

Videos

Video 1

Download asset

posterframe for video — Timelapse microscopy of sporulating *B. subtilis* stained with the membrane dye FM 4–64.

The left panel shows untreated cells, the middle panel cephalexin-treated cells (50 μg/ml), and the right panel bacitracin-treated cells (50 μg/ml). Cells were imaged in agarose pads supplemented with the appropriate antibiotics (see Materials and methods for details). Pictures were taken every 5 min. Total time 2.5 hr.

https://doi.org/10.7554/eLife.18657.007

Video 2

Download asset

Video 3

Download asset

Video 4

Download asset

Video 5

Download asset

Video 6

Download asset

Tables

Appendix 2—table 1

Model parameters.

https://doi.org/10.7554/eLife.18657.027

Symbol	Physical quantity	Values used in simulation	Sources / References	Notes
$T_{0}$	Room temperature	300 K
$k_{pep}$	Peptide effective spring constant; $k_{pep}$ = $k_{pep}^{0}$ / 2	25 pN/nm	Figure 4—figure supplement 4, (Nguyen et al., 2015)	$k_{pep}^{0}$ for a single peptide
$k_{gly}$	Glycan effective spring constant; $k_{gly}$ = $k_{gly}^{0}$	5570 pN/nm	Figure 4—figure supplement 4, (Nguyen et al., 2015)	$k_{gly}^{0}$ for a single glycan
$l_{p0}$	Glycan persistance length	40 nm	Figure 4—figure supplement 2,(Nguyen et al., 2015)
$Δ p$	Pressure difference	86.31 kPa	Apendix (2.2)
$η_{wat}$	Water viscosity	0.001 Pa s
$η_{med}$	Medium viscosity	1 Pa s	(Spitzer et al., 2006)
$l_{0} = l_{0 p}$	Mesh size	0.014 $μ$ m		Our simulations
$Δ t$	Time step	2 $\cdot$ 10 $^{- 8}$ s		Our simulations

Appendix 3—table 1

Strains used in this study.

https://doi.org/10.7554/eLife.18657.028

Strain	Genotype or description	Reference, source or construction*
PY79	Wild type	(Youngman et al., 1984)
ABS49	$Δ$ spoIIP::Tet $Ω$ PspoIIP-GFP-spoIIP $Ω$ erm	(Chastanet and Losick, 2007)
ABS98	$Δ$ spoIIM::spc $Ω$ PspoIIM-GFP-spoIID $Ω$ erm	(Chastanet and Losick, 2007)
ABS325	$Δ$ spoIID::kan $Ω$ PspoIID-GFP-spoIID $Ω$ erm	(Chastanet and Losick, 2007)
JLG626	$Δ$ spoIIQ::erm	pJLG78 $\to$ PY79 (Em $^{R}$ )
JLG1420	amyE::PspoIIQ-sfGFP-pbpF $Ω$ cat	pJLG213 $\to$ PY79 (Cm $^{R}$ )
JLG1421	amyE::PspoIIR-sfGFP-pbpF $Ω$ cat	pJLG214 $\to$ PY79 (Cm $^{R}$ )
JLG1422	thrC::PspoIID-sfGFP-pbpF $Ω$ spc	pJLG215 $\to$ PY79 (Sp $^{R}$ )
JLG1425	amyE::PspoIIQ-sfGFP-pbpG $Ω$ cat	pJLG218 $\to$ PY79 (Cm $^{R}$ )
JLG1427	amyE::PspoIIR-sfGFP-pbpG $Ω$ cat	pJLG219 $\to$ PY79 (Cm $^{R}$ )
JLG1428	thrC::PspoIID-sfGFP-pbpG $Ω$ spc	pJLG220 $\to$ PY79 (Sp $^{R}$ )
JLG1555	amyE::PspoIIQ-sfGFP-ponA $Ω$ cat	pJLG222 $\to$ PY79 (Cm $^{R}$ )
JLG1556	amyE::PspoIIR-sfGFP-ponA $Ω$ cat	pJLG223 $\to$ PY79 (Cm $^{R}$ )
JLG1557	thrC::PspoIID-sfGFP-ponA $Ω$ spc	pJLG230 $\to$ PY79 (Sp $^{R}$ )
JLG1558	amyE::PspoIIQ-sfGFP-pbpD $Ω$ cat	pJLG224 $\to$ PY79 (Cm $^{R}$ )
JLG1559	amyE::PspoIIR-sfGFP-pbpD $Ω$ cat	pJLG225 $\to$ PY79 (Cm $^{R}$ )
JLG1560	thrC::PspoIID-sfGFP-pbpD $Ω$ spc	pJLG226 $\to$ PY79 (Sp $^{R}$ )
JLG1824	amyE::PspoIIQ-sfGFP-pbpB $Ω$ cat	pJLG263 $\to$ PY79 (Cm $^{R}$ )
JLG1825	amyE::PspoIIR-sfGFP-pbpB $Ω$ cat	pJLG264 $\to$ PY79 (Cm $^{R}$ )
JLG1826	thrC::PspoIID-sfGFP-pbpB $Ω$ spc	pJLG265 $\to$ PY79 (Sp $^{R}$ )
JLG1827	amyE::PspoIIQ-sfGFP-pbpH $Ω$ cat	pJLG266 $\to$ PY79 (Cm $^{R}$ )
JLG1828	amyE::PspoIIR-sfGFP-pbpH $Ω$ cat	pJLG267 $\to$ PY79 (Cm $^{R}$ )
JLG1829	thrC::PspoIID-sfGFP-pbpH $Ω$ spc	pJLG268 $\to$ PY79 (Sp $^{R}$ )
JLG1830	amyE::PspoIIR-sfGFP-pbpI $Ω$ cat	pJLG270 $\to$ PY79 (Cm $^{R}$ )
JLG1831	thrC::PspoIID-sfGFP-pbpI $Ω$ spc	pJLG271 $\to$ PY79 (Sp $^{R}$ )
JLG1832	amyE::PspoIIQ-sfGFP-pbpA $Ω$ cat	pJLG272 $\to$ PY79 (Cm $^{R}$ )
JLG1833	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat	pJLG273 $\to$ PY79 (Cm $^{R}$ )
JLG1834	thrC::PspoIID-sfGFP-pbpA $Ω$ spc	pJLG274 $\to$ PY79 (Sp $^{R}$ )
JLG1835	amyE::PspoIIQ-sfGFP-pbpX $Ω$ cat	pJLG275 $\to$ PY79 (Cm $^{R}$ )
JLG1836	amyE::PspoIIR-sfGFP-pbpX $Ω$ cat	pJLG276 $\to$ PY79 (Cm $^{R}$ )
JLG1837	thrC::PspoIID-sfGFP-pbpX $Ω$ spc	pJLG277 $\to$ PY79 (Sp $^{R}$ )
JLG1838	amyE::PspoIIQ-sfGFP-dacA $Ω$ cat	pJLG278 $\to$ PY79 (Cm $^{R}$ )
JLG1839	amyE::PspoIIR-sfGFP-dacA $Ω$ cat	pJLG279 $\to$ PY79 (Cm $^{R}$ )
JLG1840	thrC::PspoIID-sfGFP-dacA $Ω$ spc	pJLG280 $\to$ PY79 (Sp $^{R}$ )
JLG1851	amyE::PspoIIQ-sfGFP-dacB $Ω$ cat	pJLG281 $\to$ PY79 (Cm $^{R}$ )
JLG1852	amyE::PspoIIR-sfGFP-dacB $Ω$ cat	pJLG282 $\to$ PY79 (Cm $^{R}$ )
JLG1853	thrC::PspoIID-sfGFP-dacB $Ω$ spc	pJLG283 $\to$ PY79 (Sp $^{R}$ )
JLG1854	amyE::PspoIIQ-sfGFP-dacC $Ω$ cat	pJLG284 $\to$ PY79 (Cm $^{R}$ )
JLG1855	amyE::PspoIIR-sfGFP-dacC $Ω$ cat	pJLG285 $\to$ PY79 (Cm $^{R}$ )
JLG1856	thrC::PspoIID-sfGFP-dacC $Ω$ spc	pJLG286 $\to$ PY79 (Sp $^{R}$ )
JLG1857	amyE::PspoIIQ-sfGFP-dacF $Ω$ cat	pJLG287 $\to$ PY79 (Cm $^{R}$ )
JLG1858	thrC::PspoIID-sfGFP-dacF $Ω$ spc	pJLG289 $\to$ PY79 (Sp $^{R}$ )
JLG1859	amyE::PspoIIQ-sfGFP-pbpI $Ω$ cat	pJLG269 $\to$ PY79 (Cm $^{R}$ )
JLG1860	amyE::PspoIIR-sfGFP-dacF $Ω$ cat	pJLG288 $\to$ PY79 (Cm $^{R}$ )
JLG1861	amyE::PspoIIQ-sfGFP-pbpE $Ω$ cat	pJLG296 $\to$ PY79 (Cm $^{R}$ )
JLG1863	amyE::PspoIIR-sfGFP-pbpE $Ω$ cat	pJLG298 $\to$ PY79 (Cm $^{R}$ )
JLG1864	thrC::PspoIID-sfGFP-pbpE $Ω$ spc	pJLG299 $\to$ PY79 (Sp $^{R}$ )
JLG2248	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ spoIIQ::erm	JLG626 $\to$ JLG1556 (Em $^{R}$ )
JLG2356	$Δ$ gerM::kan	pJLG361 $\to$ PY79 (Km $^{R}$ )
JLG2359	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ spoIIQ::erm	JLG626 $\to$ JLG1833 (Em $^{R}$ )
JLG2360	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ spoIIB::erm	KP343 $\to$ JLG1833 (Em $^{R}$ )
JLG2366	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ spoIIB::erm	KP343 $\to$ JLG1556 (Em $^{R}$ )
JLG2367	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ gerM::kan	JLG2356 $\to$ JLG1556 (Km $^{R}$ )
JLG2368	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ spoIIIAG-AH::kan	KP896 $\to$ JLG1556 (Km $^{R}$ )
JLG2369	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ spoIVFAB::cat::tet	KP1013 $\to$ JLG1556 (Tet $^{R}$ )
JLG2370	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ sigE::erm	KP161 $\to$ JLG1556 (Em $^{R}$ )
JLG2371	amyE::PspoIIR-sfGFP-ponA $Ω$ cat spoIID::Tn917 $Ω$ erm	KP8 $\to$ JLG1556 (Em $^{R}$ )
JLG2372	amyE::PspoIIR-sfGFP-ponA $Ω$ cat $Δ$ spoIIP::tet	KP513 $\to$ JLG1556 (Tet $^{R}$ )
JLG2373	amyE::PspoIIR-sfGFP-ponA $Ω$ cat spoIIM::Tn917 $Ω$ erm	KP519 $\to$ JLG1556 (Em $^{R}$ )
JLG2374	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ gerM::kan	JLG2356 $\to$ JLG1833 (Km $^{R}$ )
JLG2375	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ spoIIIAG-AH::kan	KP896 $\to$ JLG1833 (Km $^{R}$ )
JLG2376	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ spoIVFAB::cat::tet	KP1013 $\to$ JLG1833 (Tet $^{R}$ )
JLG2377	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ sigE::erm	KP161 $\to$ JLG1833 (Em $^{R}$ )
JLG2378	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat spoIID::Tn917 $Ω$ erm	KP8 $\to$ JLG1833 (Em $^{R}$ )
JLG2379	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat $Δ$ spoIIP::tet	KP513 $\to$ JLG1833 (Tet $^{R}$ )
JLG2380	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat spoIIM::Tn917 $Ω$ erm	KP519 $\to$ JLG1833 (Em $^{R}$ )
JLG2411	amyE::PspoIIQ-sfGFP-mreB $Ω$ cat	pJLG363 $\to$ PY79 (Cm $^{R}$ )
JLG2412	amyE::PspoIIR-sfGFP-mreB $Ω$ cat	pJLG364 $\to$ PY79 (Cm $^{R}$ )
JLG2413	thrC::PspoIID-sfGFP-mreB $Ω$ spc	pJLG365 $\to$ PY79 (Sp $^{R}$ )
JLG2414	amyE::PspoIIQ-sfGFP-mbl $Ω$ cat	pJLG371 $\to$ PY79 (Cm $^{R}$ )
JLG2415	amyE::PspoIIR-sfGFP-mbl $Ω$ cat	pJLG366 $\to$ PY79 (Cm $^{R}$ )
JLG2416	thrC::PspoIID-sfGFP-mbl $Ω$ spc	pJLG367 $\to$ PY79 (Sp $^{R}$ )
JLG2417	amyE::PspoIIQ-sfGFP-mreBH $Ω$ cat	pJLG368 $\to$ PY79 (Cm $^{R}$ )
JLG2418	amyE::PspoIIR-sfGFP-mreBH $Ω$ cat	pJLG369 $\to$ PY79 (Cm $^{R}$ )
JLG2419	thrC::PspoIID-sfGFP-mreBH $Ω$ spc	pJLG370 $\to$ PY79 (Sp $^{R}$ )
KP8	spoIID::Tn917 $Ω$ erm	(Sandman et al., 1987)
KP161	$Δ$ sigE::erm	(Kenney and Moran, 1987)
KP343	$Δ$ spoIIB::erm	(Margolis et al., 1993)
KP513	$Δ$ spoIIP::tet	(Frandsen and Stragier, 1995)
KP519	spoIIM::Tn917 $Ω$ erm	(Sandman et al., 1987)
KP896	$Δ$ spoIIIAG-AH::kan	(Blaylock et al., 2004)
KP1013	$Δ$ spoIVFAB::cat::tet	(Aung et al., 2007)

*Plasmid or genomic DNA employed (right side the arrow) to transform an existing strain (left side the arrow) into a new strain are listed. The drug resistance is noted in parentheses.

Appendix 3—table 2

Plasmids used in this study.

https://doi.org/10.7554/eLife.18657.029

Plasmid	Description
pJLG78	$Δ$ spoIIQ::erm
pJLG88	amyE::PspoIIQ-pbpF $Ω$ cat
pJLG89	amyE::PspoIIR-pbpF $Ω$ cat
pJLG90	thrC::PspoIID-pbpF $Ω$ spc
pJLG91	amyE::PspoIIQ-pbpG $Ω$ cat
pJLG92	amyE::PspoIIR-pbpG $Ω$ cat
pJLG93	thrC::PspoIID-pbpG $Ω$ spc
pJLG213	amyE::PspoIIQ-sfGFP-pbpF $Ω$ cat
pJLG214	amyE::PspoIIR-sfGFP-pbpF $Ω$ cat
pJLG215	thrC::PspoIID-sfGFP-pbpF $Ω$ spc
pJLG218	amyE::PspoIIQ-sfGFP-pbpG $Ω$ cat
pJLG219	amyE::PspoIIR-sfGFP-pbpG $Ω$ cat
pJLG220	thrC::PspoIID-sfGFP-pbpG $Ω$ spc
pJLG222	amyE::PspoIIQ-sfGFP-ponA $Ω$ cat
pJLG223	amyE::PspoIIR-sfGFP-ponA $Ω$ cat
pJLG224	amyE::PspoIIQ-sfGFP-pbpD $Ω$ cat
pJLG225	amyE::PspoIIR-sfGFP-pbpD $Ω$ cat
pJLG226	thrC::PspoIID-sfGFP-pbpD $Ω$ spc
pJLG230	amyE::PspoIIR-sfGFP-ponA $Ω$ cat
pJLG263	amyE::PspoIIQ-sfGFP-pbpB $Ω$ cat
pJLG264	amyE::PspoIIR-sfGFP-pbpB $Ω$ cat
pJLG265	thrC::PspoIID-sfGFP-pbpB $Ω$ spc
pJLG266	amyE::PspoIIQ-sfGFP-pbpH $Ω$ cat
pJLG267	amyE::PspoIIR-sfGFP-pbpH $Ω$ cat
pJLG268	thrC::PspoIID-sfGFP-pbpH $Ω$ spc
pJLG269	amyE::PspoIIQ-sfGFP-pbpI $Ω$ cat
pJLG270	amyE::PspoIIR-sfGFP-pbpI $Ω$ cat
pJLG271	thrC::PspoIID-sfGFP-pbpI $Ω$ spc
pJLG272	amyE::PspoIIQ-sfGFP-pbpA $Ω$ cat
pJLG273	amyE::PspoIIR-sfGFP-pbpA $Ω$ cat
pJLG274	thrC::PspoIID-sfGFP-pbpA $Ω$ spc
pJLG275	amyE::PspoIIQ-sfGFP-pbpX $Ω$ cat
pJLG276	amyE::PspoIIR-sfGFP-pbpX $Ω$ cat
pJLG277	thrC::PspoIID-sfGFP-pbpX $Ω$ spc
pJLG278	amyE::PspoIIQ-sfGFP-dacA $Ω$ cat
pJLG279	amyE::PspoIIR-sfGFP-dacA $Ω$ cat
pJLG280	thrC::PspoIID-sfGFP-dacA $Ω$ spc
pJLG281	amyE::PspoIIQ-sfGFP-dacB $Ω$ cat
pJLG282	amyE::PspoIIR-sfGFP-dacB $Ω$ cat
pJLG283	thrC::PspoIID-sfGFP-dacB $Ω$ spc
pJLG284	amyE::PspoIIQ-sfGFP-dacC $Ω$ cat
pJLG285	amyE::PspoIIR-sfGFP-dacC $Ω$ cat
pJLG286	thrC::PspoIID-sfGFP-dacC $Ω$ spc
pJLG287	amyE::PspoIIQ-sfGFP-dacF $Ω$ cat
pJLG288	amyE::PspoIIR-sfGFP-dacF $Ω$ cat
pJLG289	thrC::PspoIID-sfGFP-dacF $Ω$ spc
pJLG296	amyE::PspoIIQ-sfGFP-pbpE $Ω$ cat
pJLG298	amyE::PspoIIR-sfGFP-pbpE $Ω$ cat
pJLG299	thrC::PspoIID-sfGFP-pbpE $Ω$ spc
pJLG361	$Δ$ gerM::kan
pJLG363	amyE::PspoIIQ-sfGFP-mreB $Ω$ cat
pJLG364	amyE::PspoIIR-sfGFP-mreB $Ω$ cat
pJLG365	thrC::PspoIID-sfGFP-mreB $Ω$ spc
pJLG366	amyE::PspoIIR-sfGFP-mbl $Ω$ cat
pJLG367	thrC::PspoIID-sfGFP-mbl $Ω$ spc
pJLG368	amyE::PspoIIQ-sfGFP-mreBH $Ω$ cat
pJLG369	amyE::PspoIIR-sfGFP-mreBH $Ω$ cat
pJLG370	thrC::PspoIID-sfGFP-mreBH $Ω$ spc
pJLG371	amyE::PspoIIQ-sfGFP-mbl $Ω$ cat

Appendix 3—table 3

Oligonucleotides used in this sudy.

https://doi.org/10.7554/eLife.18657.030

Primer	Sequence^†
JLG-95	CATGGATTACGCGTTAACCC
JLG-96	GCACTTTTCGGGGAAATGTG
JLG-249	catacgccgagttatcacatGATGATTCAACTGACAAATCTGG
JLG-250	cacatttccccgaaaagtgcCCAAGTGACCATACGACAGG
JLG-251	gggttaacgcgtaatccatgGACAGAGTGACAAGCGATCC
JLG-252	gggttgccagagttaaaggaAAGTAAATTGCAGGGAACACC
JLG-253	TCCTTTAACTCTGGCAACCC
JLG-254	ATGTGATAACTCGGCGTATG
JLG-138	CGAAGGCAGCAGTTTTTTGG
JLG-139	ATAGAGATCCGATCAGACCAG
JLG-152	TGCGAATTGTTTCATATTCAG
JLG-153	GTTTTCTTCCTCTCTCATTGTTTC
JLG-297	TACTGTTTTTTTCATCGGTCC
JLG-299	gaaacaatgagagaggaagaaaac ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-300	ctggtctgatcggatctctat ACCTTGTTTTAGGCAAATGG
JLG-301	ggaccgatgaaaaaaacagta ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-302	ctgaatatgaaacaattcgca ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-303	ccaaaaaactgctgccttcg ACCTTGTTTTAGGCAAATGG
JLG-304	gaaacaatgagagaggaagaaaac GTGGATGCAATGACAAATAAAC
JLG-306	ctggtctgatcggatctctat GGAACCATACGAATAACCCG
JLG-306	ggaccgatgaaaaaaacagta GTGGATGCAATGACAAATAAAC
JLG-307	ctgaatatgaaacaattcgca GTGGATGCAATGACAAATAAAC
JLG-308	ccaaaaaactgctgccttcg GGAACCATACGAATAACCCG
JLG-453	TGCGCTTGCGCTTGCGCTG
JLG-889	gctagcagcgcaagcgcaagcgca ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-890	gctagcagcgcaagcgcaagcgca GTGGATGCAATGACAAATAAAC
JLG-891	gaaacaatgagagaggaagaaaac GCTAAAGGCGAAGAACTGTTTAC
JLG-892	ggaccgatgaaaaaaacagta GCTAAAGGCGAAGAACTGTTTAC
JLG-893	ctgaatatgaaacaattcgca GCTAAAGGCGAAGAACTGTTTAC
JLG-894	tgcgcttgcgcttgcgctgctagc TTTATACAGTTCATCCATGCC
JLG-977	cagcgcaagcgcaagcgca ATGTCAGATCAATTTAACAGCC
JLG-978	ctggtctgatcggatctctat TACCAAAAAAGCCATCACCC
JLG-979	ccaaaaaactgctgccttcg TACCAAAAAAGCCATCACCC
JLG-980	cagcgcaagcgcaagcgca GTGACCATGTTACGAAAAATAATC
JLG-981	ctggtctgatcggatctctat TCTGAAGTCACTCCATATCCC
JLG-982	ccaaaaaactgctgccttcg TCTGAAGTCACTCCATATCCC
JLG-1021	cagcgcaagcgcaagcgca ATGATTCAAATGCCAAAAAAG
JLG-1022	ctggtctgatcggatctctat TTTGGACAGGTAGAACGATG
JLG-1023	ccaaaaaactgctgccttcg TTTGGACAGGTAGAACGATG
JLG-1024	cagcgcaagcgcaagcgca ATGAAGCAGAATAAAAGAAAGCATC
JLG-1025	ctggtctgatcggatctctat CATTCCTTTCTACTTCGTACGG
JLG-1026	ccaaaaaactgctgccttcg CATTCCTTTCTACTTCGTACGG
JLG-1027	cagcgcaagcgcaagcgca ATGAACCTTTTTTTCCTAGCTG
JLG-1028	ctggtctgatcggatctctat CGCTAGAAAATGAGTATTCTCCTTC
JLG-1029	ccaaaaaactgctgccttcg CGCTAGAAAATGAGTATTCTCCTTC
JLG-1030	cagcgcaagcgcaagcgca ATGAAGATATCGAAACGAATGAAG
JLG-1031	ctggtctgatcggatctctat TCTGCACTCCTTTATCCCTC
JLG-1032	ccaaaaaactgctgccttcg TCTGCACTCCTTTATCCCTC
JLG-1033	cagcgcaagcgcaagcgca ATGACAAGCCCAACCCGCAG
JLG-1034	ctggtctgatcggatctctat CCATCTTAACGTTTGCAGGC
JLG-1035	ccaaaaaactgctgccttcg CCATCTTAACGTTTGCAGGC
JLG-1036	cagcgcaagcgcaagcgca ATGAGGAGAAATAAACCAAAAAAG
JLG-1037	ctggtctgatcggatctctat AAGGTTTTGTAAATCAGTGCG
JLG-1038	ccaaaaaactgctgccttcg AAGGTTTTGTAAATCAGTGCG
JLG-1039	cagcgcaagcgcaagcgca TTGAACATCAAGAAATGTAAACAG
JLG-1040	ctggtctgatcggatctctat TGGGTTTTTTCAGTATATTACGC
JLG-1041	ccaaaaaactgctgccttcg TGGGTTTTTTCAGTATATTACGC
JLG-1042	cagcgcaagcgcaagcgca ATGCGCATTTTCAAAAAAGCAG
JLG-1043	ctggtctgatcggatctctat GATCACGGTTAAACTGACCC
JLG-1044	ccaaaaaactgctgccttcg GATCACGGTTAAACTGACCC
JLG-1045	cagcgcaagcgcaagcgca ATGAAAAAAAGCATAAAGCTTTATG
JLG-1046	ctggtctgatcggatctctat CTAATTGTTGGAAGGTTCGAC
JLG-1047	ccaaaaaactgctgccttcg CTAATTGTTGGAAGGTTCGAC
JLG-1048	cagcgcaagcgcaagcgca ATGAAACGTCTTTTATCCACTTTG
JLG-1049	ctggtctgatcggatctctat ATGAATTCCTTCACCGTGAC
JLG-1050	ccaaaaaactgctgccttcg ATGAATTCCTTCACCGTGAC
JLG-1312	gggttaacgcgtaatccatgACGGATAATCAGCATATCGG
JLG-1313	gcctgagcgagggagcagaaGCAGAGGTGAGACAAGTGG
JLG-1314	gcgttgaccagtgctccctgcTCTCCAGACCATCTCAAGTG
JLG-1315	cacatttccccgaaaagtgcTCAATTCCAACAGAGATTGC
JLG-1330	cagcgcaagcgcaagcgcaATGTTTGGAATTGGTGCTAG
JLG-1331	ctggtctgatcggatctctatCACCTCTTCTATTGAACTCCC
JLG-1332	ccaaaaaactgctgccttcgCACCTCTTCTATTGAACTCCC
JLG-1333	cagcgcaagcgcaagcgcaATGTTTGCAAGGGATATTGG
JLG-1334	ctggtctgatcggatctctatCCAGTTGTCATATAGGAACGTTC
JLG-1335	ccaaaaaactgctgccttcgCCAGTTGTCATATAGGAACGTTC
JLG-1336	cagcgcaagcgcaagcgcaATGTTTCAATCAACTGAAATCG
JLG-1337	ctggtctgatcggatctctatCTCTTAGCATCTGTTTCCTCC
JLG-1338	ccaaaaaactgctgccttcgCTCTTAGCATCTGTTTCCTCC
oER421	ttctgctccctcgctcaggcggccgcATGAGAGAGGAAGAAAACGG
oER422	cagggagcactggtcaacgctagcAATTGGGACAACTCCAGTG

^†In capital letters are shown the regions of the primer that anneal to the template. Homology regions for Gibson assembly are shown in italics.

Additional files

Supplementary file 1 Plasmid construction.: https://doi.org/10.7554/eLife.18657.025
Download elife-18657-supp1-v2.docx
Supplementary file 2 Image analysis example with code.: https://doi.org/10.7554/eLife.18657.026
Download elife-18657-supp2-v2.zip

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Nikola Ojkic
Javier López-Garrido
Kit Pogliano
Robert G Endres

(2016)

Cell-wall remodeling drives engulfment during Bacillus subtilis sporulation

eLife 5:e18657.

https://doi.org/10.7554/eLife.18657

Figures

Peptidoglycan (PG) synthesis is essential for leading-edge (LE) migration.

Sporulation minimal inhibitory concentration.

Quantification of cell division events in timelapse movies.

Image analysis of non-treated cells.

PG synthesis at the LE of the engulfing membrane by forespore PBPs contribute to proper localization of the DMP complex.

Cell-specific localization of PBPs and actin-like proteins.

Localization of forespore GFP-PonA and GFP-PbpA in different mutant backgrounds.

SpoIIDMP localization upon treatment with different antibiotics blocking PG synthesis.

Template model for leading edge (LE) movement.

Extended models that account for glycan-strand degradation.

Template model reproduces experimentally observed phenotypes.

Simulation of the stochastic model of insertion at the leading edge (LE).

In simulations majority of peptide extensions are in the linear elastic regime.

Engulfment is unaffected by glycan persistence length.

Simulations with different peptidoglycan (PG) elastic constants.

Simulations with decoupled synthesis and degradation.

Videos

Timelapse microscopy of sporulating B. subtilis stained with the membrane dye FM 4–64.

Circumferential movement of forespore GFP-MreB.

Simulations of WT (left) and asymmetric engulfment (right).

Simulations for different values of elastic peptidoglycan (PG) parameters $k_{pep}$ and $k_{gly}$ .

Simulations for different values of stochastic parameters $p_{rep}$ and $p_{pro}$ .

Simulations with decoupled synthesis and degradation.

Tables

Additional files

Supplementary file 1

Supplementary file 2

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

Peptidoglycan (PG) synthesis is essential for leading-edge (LE) migration.

Sporulation minimal inhibitory concentration.

Quantification of cell division events in timelapse movies.

Image analysis of non-treated cells.

PG synthesis at the LE of the engulfing membrane by forespore PBPs contribute to proper localization of the DMP complex.

Cell-specific localization of PBPs and actin-like proteins.

Localization of forespore GFP-PonA and GFP-PbpA in different mutant backgrounds.

SpoIIDMP localization upon treatment with different antibiotics blocking PG synthesis.

Template model for leading edge (LE) movement.

Extended models that account for glycan-strand degradation.

Template model reproduces experimentally observed phenotypes.

Simulation of the stochastic model of insertion at the leading edge (LE).

In simulations majority of peptide extensions are in the linear elastic regime.

Engulfment is unaffected by glycan persistence length.

Simulations with different peptidoglycan (PG) elastic constants.

Simulations with decoupled synthesis and degradation.

Timelapse microscopy of sporulating B. subtilis stained with the membrane dye FM 4–64.

Circumferential movement of forespore GFP-MreB.

Simulations of WT (left) and asymmetric engulfment (right).

Simulations for different values of elastic peptidoglycan (PG) parameters kpep and kgly.

Simulations for different values of stochastic parameters prep and ppro.

Simulations with decoupled synthesis and degradation.

Supplementary file 1

Supplementary file 2

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Simulations for different values of elastic peptidoglycan (PG) parameters $k_{pep}$ and $k_{gly}$ .

Simulations for different values of stochastic parameters $p_{rep}$ and $p_{pro}$ .