1. Computational and Systems Biology
  2. Microbiology and Infectious Disease
Download icon

Cell-wall remodeling drives engulfment during Bacillus subtilis sporulation

  1. Nikola Ojkic
  2. Javier López-Garrido
  3. Kit Pogliano  Is a corresponding author
  4. Robert G Endres  Is a corresponding author
  1. Imperial College London, United Kingdom
  2. University of California, San Diego, United States
Research Article
  • Cited 11
  • Views 1,488
  • Annotations
Cite this article as: eLife 2016;5:e18657 doi: 10.7554/eLife.18657

Abstract

When starved, the Gram-positive bacterium Bacillus subtilis forms durable spores for survival. Sporulation initiates with an asymmetric cell division, creating a large mother cell and a small forespore. Subsequently, the mother cell membrane engulfs the forespore in a phagocytosis-like process. However, the force generation mechanism for forward membrane movement remains unknown. Here, we show that membrane migration is driven by cell wall remodeling at the leading edge of the engulfing membrane, with peptidoglycan synthesis and degradation mediated by penicillin binding proteins in the forespore and a cell wall degradation protein complex in the mother cell. We propose a simple model for engulfment in which the junction between the septum and the lateral cell wall moves around the forespore by a mechanism resembling the ‘template model’. Hence, we establish a biophysical mechanism for the creation of a force for engulfment based on the coordination between cell wall synthesis and degradation.

https://doi.org/10.7554/eLife.18657.001

eLife digest

Some bacteria, such as Bacillus subtilis, form spores when starved of food, which enables them to lie dormant for years and wait for conditions to improve. To make a spore, the bacterial cell divides to make a larger mother cell and a smaller forespore cell. Then the membrane that surrounds the mother cell moves to surround the forespore and engulf it. For this process to take place, a rigid mesh-like layer called the cell wall, which lies outside the cell membrane, needs to be remodelled. This happens once a partition in the cell wall, called a septum, has formed, separating mother and daughter cells. However, it is not clear how the mother cell can generate the physical force required to engulf the forespore under the cramped conditions imposed by the cell wall.

To address this question, Ojkic, López-Garrido et al. used microscopy to investigate how B. subtilis makes spores. The experiments show that, in order to engulf the forespore, the mother cell must produce new cell wall and destroy cell wall that is no longer needed. Running a simple biophysical model on a computer showed that coordinating these two processes could generate enough force for a mother cell to engulf a forespore.

Ojkic, López-Garrido et al. propose that the junction between the septum and the cell wall moves around the forespore to make room for the mother cell’s membrane for expansion. Other spore-forming bacteria that threaten human health – such as Clostridium difficile, which causes bowel infections, and Bacillus anthracis, which causes anthrax – might form their spores in the same way, but this remains to be tested. More work will also be needed to understand exactly how bacterial cells coordinate the cell wall synthesis and cell wall degradation.

https://doi.org/10.7554/eLife.18657.002

Introduction

To survive starvation, the Gram-positive bacterium Bacillus subtilis forms durable endospores (Tan and Ramamurthi, 2014). The initial step of sporulation is the formation of an asymmetrically positioned septum (polar septation), which produces a larger mother cell and a smaller forespore (Figure 1A). After division, the mother cell engulfs the forespore in a phagocytosis-like manner. Engulfment entails a dramatic reorganization of the sporangium, from two cells that lie side by side to a forespore contained within the cytoplasm of the mother cell. The internalized forespore matures and is ultimately released to the environment upon mother cell lysis. After engulfment, the forespore is surrounded by two membranes within the mother cell cytoplasm, sandwiching a thin layer of peptidoglycan (PG) (Tocheva et al., 2013). While a number of molecular players for engulfment have been identified, the mechanism of force generation to push or pull the mother cell membrane around the forespore remains unknown (Higgins and Dworkin, 2012).

Figure 1 with 3 supplements see all
Peptidoglycan (PG) synthesis is essential for leading-edge (LE) migration.

(A) Morphological changes during spore formation. Peptidoglycan shown in grey, membrane in red. (1) Vegetative cell. (2) The first morphological step in sporulation is asymmetric cell division, producing a smaller forespore and a larger mother cell. (3) The septum curves and protrudes towards the mother cell. (4) The mother cell membrane migrates towards the forespore pole. The different modules contributing to membrane migration are shown in the inset (see Introduction for details). During engulfment, the septal PG is extended around the forespore (Tocheva et al., 2013). (5) Fully engulfed forespore surrounded by two membranes sandwiching a thin layer of PG. (B) Snapshots of engulfing sporangia from time-lapse movies in the absence of antibiotics, or in the presence of cephalexin or bacitracin. Cells were stained with fluorescent membrane dye FM 4–64 and imaged in medial focal plane. In the absence of antibiotics (top) the septum curves and grows towards the mother cell without significant forward movement of the engulfing membrane for ∼20 min. After that, the LE of the engulfing membrane starts migrating and reaches the forespore pole in ∼1 hr. When PG precursor delivery system is blocked with bacitracin (50 μg/ml): (I) LE migration is stopped or (II) engulfment proceeds asymmetrically. Similar results are obtained when cells are treated with cephalexin (50 μg/ml). However, in this case the asymmetric engulfment phenotype observed at later time points is due to rotation of the engulfment cup (C) rather than to asymmetric movement forward of the engulfing membrane (D). (E) FM 4–64 average kymograph of n = 24 engulfing cells (see Materials and methods, Appendix 1). Average fluorescent intensity along forespore contour vs time in the mother-forespore reference frame as shown in top inset. All cells are aligned in time based on time 0’ (0 min). Time 0’ is assigned to the onset of curving septum (Figure 1—figure supplement 3). Bottom inset is average kymograph represented as heat map. (FG) Average kymograph for cells treated with cephalexin (n = 18) (F) or bacitracin (n = 26). (G) When drug was added analyzed cells had (55 ± 5)% engulfment (red arrow). The percentage of engulfment is calculated as total angle of forespore covered with mother membrane divided by full angle. All cells had fully curved septum. Non-engulfed part of the forespore is represented as the black regions in kymographs. (H) In untreated sporangia, gap starts to close ∼20 min after onset of membrane curving. In antibiotic-treated cells gap does not close. Sample size as in (FG). Red arrow points when drug is added. Average ± SEM. Scale bar 1 μm.

https://doi.org/10.7554/eLife.18657.003

The cellular machinery for engulfment is complex, presumably to add robustness for survival (Figure 1A, inset). First, the forespore protein SpoIIQ and the mother cell protein SpoIIIAH interact in a zipper-like manner across the septum (Blaylock et al., 2004), and mediate the fast engulfment observed in the absence of cell wall (Broder and Pogliano, 2006; Ojkic et al., 2014). This complex is static and is proposed to act as a Brownian ratchet to prevent backwards movement of the engulfing membrane, contributing to the robustness of engulfment in intact cells (Sun et al., 2000; Broder and Pogliano, 2006). Second, the SpoIID, SpoIIM and SpoIIP complex (DMP) localizes at the leading edge (LE) of the mother cell engulfing membrane and is essential and rate limiting for membrane migration (Abanes-De Mello et al., 2002; Gutierrez et al., 2010). The complex contains two enzymes that degrade PG in a processive manner: SpoIIP removes stem peptides, and SpoIID degrades the resulting denuded glycan strands (Abanes-De Mello et al., 2002; Chastanet and Losick, 2007; Morlot et al., 2010; Gutierrez et al., 2010). Mutants with reduced SpoIID or SpoIIP activity or protein levels engulf asymmetrically, with the engulfing membrane migrating faster on one side of the forespore (Abanes-De Mello et al., 2002; Gutierrez et al., 2010). Third, blocking PG precursor synthesis with antibiotics impairs membrane migration in mutants lacking the Q-AH zipper, suggesting that PG synthesis at the LE of the engulfing membrane contributes to engulfment (Meyer et al., 2010; Tocheva et al., 2013). However, the mechanistic details of membrane migration and for the coordination between PG synthesis and degradation remain unclear.

The biophysical principles of cell wall remodeling in Gram-positive bacteria are not well understood. In Bacillus subtilis, the cell wall is about 20–40 nm thick, and is likely organized into multiple (20–30) PG layers (Morlot et al., 2010; Reith and Mayer, 2011; Lee and Huang, 2013; Misra et al., 2013; Dover et al., 2015). In contrast, cryo-electron tomography has demonstrated that a thin PG layer is present between the septal membranes throughout engulfment, appearing to form continuous attachments with the old cell wall (Tocheva et al., 2011, 2013). The outer cell wall of Gram-positive bacteria also contains a significant amount of teichoic acids, important for cell morphology, phosphates, and antibiotic resistance (Grant, 1979; Brown et al., 2013) but largely absent in spores (Chin et al., 1968; Johnstone et al., 1982). Engulfment entails extensive cell wall remodeling, with peptidoglycan precursors, newly synthesized PG and the sporulation specific PG degradation machinery localizing at the LE of the engulfing membrane (Meyer et al., 2010; Tocheva et al., 2013; Abanes-De Mello et al., 2002). However, since engulfment occurs at high turgor pressure within the cramped confines of the thick outer cell wall, we expect that membrane movement is severely reduced by steric hindrance (Lizunov and Zimmerberg, 2006). Hence, we anticipate that peptidoglycan remodeling is a critical step in engulfment, which may either act as a force generator or simply create room for engulfment by the mother cell membrane.

Here, we provide a biophysical mechanism for engulfment in which PG synthesis and degradation move the junction between the septal PG and the lateral cell wall around the forespore, making room for the engulfing membrane to move by entropic forces. Using antibiotics that block different steps in PG synthesis, we demonstrate that PG synthesis is essential for membrane migration in all conditions and contributes to the localization of SpoIIDMP at the LE. We also show that components of the PG biosynthetic machinery, including several penicillin binding proteins (PBPs) and the actin-like proteins MreB, Mbl and MreBH track the LE of the engulfing membrane when produced in the forespore, but not when produced in the mother cell. We implement a biophysical model for PG remodeling at the LE of the engulfing membrane, based on the ‘template mechanism’ of vegetative cell growth and implemented by stochastic Langevin simulations. These simulations reproduce experimentally observed engulfment dynamics, forespore morphological changes, and asymmetric engulfment when PG synthesis or degradation is perturbed. Taken together, our results suggest that engulfment entails coordination of PG synthesis and degradation between the two compartments of the sporangium, with forespore-associated PBPs synthesizing PG ahead of the LE and the mother-cell DMP complex degrading this PG to drive membrane migration.

Results

PG synthesis is essential for membrane migration

In contrast to previous studies (Meyer et al., 2010), we attempted to find conditions that completely blocked PG synthesis in sporulating cultures (Figure 1—figure supplement 1). To estimate the sporulation minimal inhibitory concentration (sMIC) of antibiotics, we monitored the percentage of cells that had undergone polar septation over time in batch cultures. Polar septation depends on PG synthesis and is easy to track visually (Pogliano et al., 1999), which makes it a good indicator for efficient inhibition. We assayed nine antibiotics inhibiting different steps in the PG biosynthesis pathway, and found concentrations that blocked the formation of new polar septa for seven of them (Figure 1—figure supplement 1B,C). In most cases, the antibiotic concentration that blocked polar septation also inhibited completion of engulfment (Figure 1—figure supplement 1B). Only two drugs, fosfomycin and D-cycloserine, failed to completely block polar cell division. These drugs inhibit production of PG precursors that, during starvation conditions, might be obtained by recycling rather than de novo synthesis (Reith and Mayer, 2011), potentially from cells that lyse during sporulation, as has been observed in studies of B. subtilis cannibalism (González-Pastor et al., 2003; Straight and Kolter, 2009; Lamsa et al., 2012), or from cells that lyse due to antibiotic treatment (Lamsa et al., 2016). These results demonstrate that the later stages in PG synthesis are essential for engulfment in wild type sporangia.

To investigate the role played by PG synthesis, we selected two antibiotics for further characterization: cephalexin, which inhibits PBP activity, and bacitracin, which blocks cell-wall precursor delivery (recycling of undecaprenyl phosphate). Using time-lapse microscopy (see Materials and methods for details), we monitored membrane dynamics during engulfment in the medial focal plane using the fluorescent membrane dye FM 4–64 (Figure 1B, Video 1). In these 2–5 hour-long movies we observed occasional cell division events occurred with bacitracin (0.08 division events/cell after 90 min, compared to 0.28 division events/cell in untreated cultures, Figure 1—figure supplement 2), indicating that PG synthesis was not completely blocked under these conditions. However, negligible cell divisions occurred with cephalexin, indicating that PG synthesis was indeed completely blocked (Figure 1—figure supplement 2).

Video 1
Timelapse microscopy of sporulating B. subtilis stained with the membrane dye FM 4–64.

The left panel shows untreated cells, the middle panel cephalexin-treated cells (50 μg/ml), and the right panel bacitracin-treated cells (50 μg/ml). Cells were imaged in agarose pads supplemented with the appropriate antibiotics (see Materials and methods for details). Pictures were taken every 5 min. Total time 2.5 hr.

https://doi.org/10.7554/eLife.18657.007

To better monitor LE dynamics we used two image analysis approaches (see Materials and methods for details). First, we created kymographs along forespore membranes (Figure 1E–G). The angular position of forespore pixels was calculated relative to the mother-forespore frame of reference (Figure 1E, inset). All cells were aligned in time based on the onset of septum curving (Figure 1—figure supplement 3), and for a given angle, the average fluorescence of different cells was calculated and plotted over time. Second, we measured the decrease in the distance between the two LEs of the engulfing membrane in the focal plane (the gap arc length), in order to directly assess movement of the LE around the forespore (Figure 1H).

These analyses demonstrated that in untreated sporangia (Figure 1B, top row), the septum curves and the forespore grows into the mother cell without significant forward movement of the LE for ∼20 min after polar septation (at 30°C, Figure 1H). Subsequently, the LE of the engulfing membrane moves towards the forespore pole and engulfment completes within ∼60 min (Figure 1E,H). In sporangia treated with cephalexin (Figure 1B, middle row I), the septum curves and extends towards the mother cell, but there is no forward membrane migration (Figure 1F,H). Sometimes the LE retracted on one side while advancing slightly on the other (typically occurred after 90 min of imaging; Figure 1B, middle row II), which appears to be the rotation of the ‘cup’ formed by the engulfing membranes relative to the lateral cell wall (Figure 1C).

Similar to cephalexin, in most sporangia treated with bacitracin (Figure 1B, bottom row I), the forespore extended into the mother cell without significant membrane migration (Figure 1G,H). However, in ∼20% of the sporangia, the engulfing membrane migrated asymmetrically, with one side moving faster than the other, although usually it failed to completely surround the forespore (Figure 1B, bottom row II; Figure 1D). The continued engulfment under bacitracin treatment might be related to the fact that PG synthesis is not completely blocked in bacitracin-treated cells under time-lapse conditions (Figure 1—figure supplement 2). Taken together, these results suggest that PG synthesis is not only essential for the final stage of engulfment (membrane fission) in wild type cells (Meyer et al., 2010), but also for migration of the LE of the engulfing membrane around the forespore.

PBPs accumulate at the leading edge of the engulfing membrane

It has been previously shown that there is an accumulation of membrane-bound PG precursors at the LE of the engulfing membrane (Meyer et al., 2010). Furthermore, staining with fluorescent D-amino acids has demonstrated that new PG is synthesized at or close to the LE (Tocheva et al., 2013). To investigate if there is a concomitant accumulation of PBPs at the LE, we stained sporangia with BOCILLIN-FL, a commercially available derivative of penicillin V that has a broad affinity for multiple PBPs in B. subtilis (Lakaye et al., 1994; Zhao et al., 1999; Kocaoglu et al., 2012). We observed continuous fluorescent signal around the mother cell membrane that was enriched at the LE (Figure 2A). To better monitor localization of PBPs during engulfment, we plotted fluorescence intensities along the forespores for the membrane and BOCILLIN-FL fluorescent signals as a function of the engulfment stage (Figure 2B). Clearly, the LE is always enriched with PBPs throughout membrane migration.

Figure 2 with 3 supplements see all
PG synthesis at the LE of the engulfing membrane by forespore PBPs contribute to proper localization of the DMP complex.

(A) Sporulating cells stained with a green fluorescent derivative of penicillin V (BOCILLIN-FL). Bright foci are observed at the LE of the engulfing membrane. Membranes were stained with FM 4–64 (red). (B) Average BOCILLIN-FL (green) and FM 4–64 (red) fluorescence intensities along forespore contours plotted as a function of the degree of engulfment. Cells are binned according to percentage of engulfment. BOCILLIN-FL signal is enriched at the LE throughout engulfment (n = 125). (C) Cell-specific localization of the peptidoglycan biosynthetic machinery. GFP tagged versions of different B. subtilis PBPs and actin-like proteins (ALPs) were produced from mother cell- (MC) or forespore- (FS) specific promoters. (D) Six different localization patterns were observed upon cell-specific localization of PBPs and ALPs. For each pair of images, left panel shows overlay of membrane and GFP fluorescence, while the right panel only shows GFP fluorescence. Pictures of representative cells displaying the different patterns are shown (top, GFP fusion proteins transcribed from spoIIR promoter for forespore-specific expression, and from spoIID promoter for mother cell-specific expression). The six different patterns are depicted in the bottom cartoon and proteins assigned to each one are indicated. Membranes were stained with FM 4–64. See Figure 2—figure supplement 1 for cropped fields of all PBPs we assayed. Transglycosylase (TG), transpetidase (TP), carboxipetidase (CP), endopeptidase (EP), actin-like protein (ALP). (E) TIRF microscopy of forespore-produced GFP-MreB in four different forespores (i to iv). In every case, the leftmost picture is an overlay of the forespore membranes (shown in white) and the tracks followed by individual TIRF images of GFP-MreB (color encodes time, from blue to red). Sporangia are oriented with the forespores up. For the first sporangia (i), snapshots from TIRF timelapse experiments taken 8 s apart are shown. Arrows indicate GFP-MreB foci and are color coded to match the trace shown in the left panel. Rightmost panel for each forespore shows a kymograph representing the fluorescence intensity along the line joining the leading edges of the engulfing membrane over time (from top to bottom; total time 100 s). Average focus speed (n = 14) is indicated at the bottom. Timelapse movies of the examples presented here and additional sporangia are shown in Video 2. (F) Localizaiton of GFP-SpoIIP in untreated sporangia, or in sporangia treated with bacitracin (50 μg/ml) or cephalexin (50 μg/ml). (G) Fraction of GFP-SpoIIP fluorescence at LE of the engulfing membrane. Bars represent the average and standard error of 85 untreated sporangia, 38 sporangia treated with bacitracin (50 μg/ml), and 67 sporangia treated with cephalexin (50 μg/ml). (H) Model for PG synthesis and degradation at the LE of the engulfing membrane. New PG is synthesized ahead of the LE of the engulfing membrane by forespore-associated PG biosynthetic machinery, and is subsequently degraded but the mother-cell DMP complex. We propose that DMP has specificity for the peptide cross-links that join the newly synthesized PG with the lateral cell wall (orange), which leads to the extension of the septal PG around the forespore. Scale bars 1 μm.

https://doi.org/10.7554/eLife.18657.008

PG biosynthetic machinery tracks the leading edge of the engulfing membrane from the forespore

One possible explanation for the requirement of PG synthesis for engulfment is that PG polymerization by PBPs associated with the LE of the engulfing membrane creates force to pull the engulfing membrane around the forespore. If so, we would expect the PBPs to be located in the mother cell membrane as they polymerize PG. To test this possibility, we assessed the localization of components of the PG biosynthetic machinery in the mother cell or forespore by producing GFP-tagged fusion proteins from promoters that are only active in the mother cell (PspoIID) or in the forespore (the stronger PspoIIQ and the weaker PspoIIR) after polar septation (Figure 2C,D, Figure 2—figure supplement 1). One prior study tested the localisation of several PBPs during sporulation (Scheffers, 2005), but most of them were produced before polar separation and it was not possible to determine which cell compartment they were in. We successfully determined the cell-specific localization of 16 proteins involved in PG synthesis (Figure 2—figure supplement 1), including all class A and four class B high-molecular-weight (HMW) PBPs, five low-molecular-weight (LMW) PBPs (four endopeptidases and one carboxipeptidase), and all three MreB paralogues (actin-like proteins, ALPs). Surprisingly, only PonA (PBP1a/b) showed a weak enrichment at the LE of the engulfing membrane when produced in the mother cell (Figure 2D). However, ten PBPs, including PonA and all the class B HMW PBPs and LMW PBPs tested, and all the MreB paralogues were able to track the LE only when produced in the forespore (Figure 2D, Figure 2—figure supplement 1). To follow the dynamics of the forespore PG biosynthetic machinery at the LE, we monitored the movement of GFP-MreB using TIRF microscopy (Garner et al., 2011; Domínguez-Escobar et al., 2011). Forespore GFP-MreB foci rotate around the forespore, coincident with the leading edge of the engulfing membrane, with speeds consistent with those previously reported (Figure 2E, Video 2).

Video 2
Circumferential movement of forespore GFP-MreB.

The movie shows the movement forespore GFP-MreB in eight different sporangia, determined by TIRF microscopy. A static membrane picture is shown to the left, and the TIRF microscopy of the corresponding GFP-MreB is shown immediately to the right. TIRF pictures were taken every 4 s, and the total duration of the movie is 100 s. The first four sporangia correspond to the examples (i) to (iv) shown in Figure 2.

https://doi.org/10.7554/eLife.18657.012

It is unclear how the PBPs recognize the LE, as localization of forespore produced GFP-PonA and GFP-PbpA did not depend on candidate proteins SpoIIB, SpoIID, SpoIIM, SpoIIP, SpoIIQ, SpoIIIAH, SpoIVFAB, or GerM (Aung et al., 2007; Abanes-De Mello et al., 2002; Chastanet and Losick, 2007; Blaylock et al., 2004; Rodrigues et al., 2016) (Figure 2—figure supplement 2). However, these results indicate that the forespore plays a critical role in PG synthesis, and point to an engulfment mechanism that does not depend on pulling the engulfing membrane by mother cell-directed peptidoglycan synthesis.

PG synthesis is required for SpoIIDMP localization at the leading edge of the engulfing membrane

The observation that multiple PBPs can track the LE of the engulfing membrane from the forespore opens the possibility that PG synthesis happens ahead of the LE, preceding PG degradation by the mother cell DMP complex. In this context, PG synthesis might be required for proper activity and/or localization of the DMP complex, which is the only other essential engulfment module described so far. The DMP complex localizes at the LE throughout engulfment (Gutierrez et al., 2010). To determine if PG synthesis is required for proper localization of DMP, we studied the localization of a GFP-SpoIIP fusion protein when PG synthesis was inhibited by different antibiotics (Figure 2F,G). GFP-SpoIIP shows a well-defined localization at the LE, with ∼70% of the total GFP fluorescence at LE in native conditions (Figure 2F,G). However, when PG biosynthesis is inhibited, there is a delocalization of GFP-SpoIIP, which is almost total in cells treated with bacitracin and partial when antibiotics targeting later stages of PG synthesis are used (Figure 2F,G; Figure 2—figure supplement 3). Equivalent results were obtained with GFP-SpoIID and GFP-SpoIIM fusions (Figure 2—figure supplement 3). These results are consistent with a model in which PG is synthesized ahead of the LE by forespore-associated PBPs specify the site of PG degradation by the DMP complex (Figure 2H).

A biophysical model to describe leading edge migration

Our data indicate that engulfment proceeds through coordinated PG synthesis and degradation at the LE. To explain how this coordination leads to engulfment, we propose a minimal biophysical mechanism based on the ‘template mechanism’ of vegetative cell growth assuming that glycans are oriented perpendicular to the long axis of the cell (Figure 3A) (Koch and Doyle, 1985; Höltje, 1998; Domínguez-Escobar et al., 2011; Garner et al., 2011; Beeby et al., 2013; Dover et al., 2015), without requiring any further assumptions about the outer cell wall structure of Gram-positive bacteria, which is still unclear (Hayhurst et al., 2008; Beeby et al., 2013; Dover et al., 2015). In this mechanism, a new glycan strand is inserted using both the septal glycan and leading forespore-proximal glycan strand of the lateral wall as template strands to which the new PG strand is cross linked. Subsequently, peptide cross-links between the two template strands are removed from the mother-cell proximal side by the DMP complex. Specifically, in this complex SpoIIP has well documented endopeptidase activity (Morlot et al., 2010). Note, similar ‘make-before-break’ mechanisms were proposed to allow vegetative cell wall growth without reducing cell wall integrity (Koch and Doyle, 1985; Höltje, 1998). A more detailed mechanism that requires the insertion of multiple new glycan strands to account for glycan removal by SpoIID is shown in Figure 3—figure supplement 1. In either model, synthesis of new PG at the LE likely occurs before degradation, thereby naturally preventing cell lysis during engulfment.

Figure 3 with 1 supplement see all
Template model for leading edge (LE) movement.

(A) Cell cross-section with glycan strands in the plane perpendicular to the long axis of the cell. One strand from old cell wall (blue) and one strand from newly synthesized germ-cell wall (green) are used as a template for new glycan insertion. Coordination between glycan insertion (orange arrow) and peptide cross-link degradation (black cross) drives LE forward. (B) 3D model of stochastic glycan insertion by insertion-degradation complex (IDC) with transpeptidase and transglycosylase activity. Probability of IDC to start inserting new glycan from old glycan end and repair end defect is prep. (C) New inserted glycan shown in dark green. Probability of IDC to continue glycan insertion when it encounters gap in old cell wall is probability of processivity ppro. (Inset) Horizontal (between old and new glycan strands) and vertical (between new glycan strands) peptide links are shown in red. In our coarse-grained model glycans are simulated as semi-flexible filaments consisting of beads (green) connected with springs (green). Peptides are simulated as springs (red) connecting neighboring glycan beads.

https://doi.org/10.7554/eLife.18657.013

The coordination between PG insertion from the forespore and removal by DMP in the mother cell could lead to movement of the junction between the septal peptidoglycan and the lateral peptidoglycan around the forespore to mediate successful engulfment. Based on this proposed mechanism, we created a model whereby insertion and degradation happens, for simplicity, simultaneously by an insertion-degradation complex (IDC), also reflecting the high degree of coordination suggested by the template mechanism. In this model IDC recognizes the leading edge and inserts glycan polymers perpendicular to the long axis of the cell (Figure 3B). Additionally, the model proposes that IDC can recognize glycan ends and initiate glycan polymerization from the end defect with probability of repair prep. During glycan insertion, when an IDC encounters a gap in the outer cell wall strands, it continues polymerization with probability of processivity ppro (Figure 3C). A systematic exploration of the above model parameters showed that intact spores form for prep and ppro>> 0.8 with a marginal dependence on the number of IDCs (Figure 4G, Figure 4—figure supplement 1). However, to compare the model with microscopy data we require a 3D dynamic implementation of this model that reflects the stochasticity of underlying molecular events.

Figure 4 with 5 supplements see all
Template model reproduces experimentally observed phenotypes.

(A) Effective spring constants in our model represent coarse-grained PG network. Here the angle between neighboring stem peptides that belong to a single glycan is assumed to be 90°. Therefore, every other stem peptide is in plane with glycan sheet (Nguyen et al., 2015, Huang et al., 2008). The role of effective glycan persistence length on engulfment is negligible (see Figure 4—figure supplement 3). (B) Simulations for different values of effective peptide kpep and glycan kgly spring constants are compared with experimentally measured forespore surface area, volume and engulfment using mutual χ2 statistics (Equation 2). Arrows point to effective literature kpep and kgly (Nguyen et al., 2015). Dark blue region corresponds to simulation parameters that best fit experimental data (Figure 4—figure supplement 4, Video 3). For large enough kgly > 200 pN/nm mutual χ2 is almost independent of kgly. (C) Snapshots of WT simulations for parameters (kgly = 200 pN/nm, kpep = 25 pN/nm, NIDC = 5) marked with ’×’ in panel (B) (Video 2). The thick septum is treated as outer cell wall, and is assumed degraded once IDCs move along. (DE) Time traces of experimentally measured engulfment, forespore surface area and forespore volume (green) in comparison with results from a single simulation (orange). Parameters used in simulation are marked with ’×’ in panel (B). For all other parameters see Appendix 2, Appendix-table 1. (F) Snapshots of fully engulfed forespores for various peptidoglycan elastic constants. (G) For various values of independent parameters prep and ppro roughness of the LE is calculated at the end of stochastic simulations (see Figure 4—figure supplement 1, and Video 4). Here 0 roughness correspond to perfectly symmetric LE; for high enough prep=ppro > 0.8 LE forms symmetric profiles. (H) Simulation for asymmetric engulfment is obtained for same parameter as WT except prep=ppro = 0.7 (marked with ’×’ in panel (G)). Average ± SD. Scale bars 1 μm.

https://doi.org/10.7554/eLife.18657.015
Video 3
Simulations of WT (left) and asymmetric engulfment (right).

Parameters are the same (kpep = 25 pN/nm, kgly = 200 pN/nm, NIDC = 5) except for WT engulfment prep =ppro = 1 and for asymmetric engulfment prep=ppro = 0.7. For full exploration of stochastic insertion parameters see Video 4 and Figure 4—figure supplement 1. Front opening of the forespore is not shown for clarity.

https://doi.org/10.7554/eLife.18657.021
Video 4
Simulations for different values of elastic peptidoglycan (PG) parameters kpep and kgly.

PG spring constants drastically affect forespore morphologies. By decreasing kpep forespores elongate, while by increasing kpep forespores shrink, as measured along the long axis of the cell. Changing kgly has only minor effects on volume and surface area. The main effect is on forespore curvature (see Figure 4—figure supplement 4): high kgly increases the curvature of forespore ends (making them more pointy), while low kgly decreases the curvature of the forespore ends. Septum is not shown for clarity.

https://doi.org/10.7554/eLife.18657.022

Langevin simulations reproduce observed phenotypes

To simulate stochastic insertion at the leading edge we used Langevin dynamics of a coarse-grained PG meshwork (see Materials and methods). Briefly, glycan strands are modeled as semi-flexible filaments consisting of beads connected with springs, while peptide bridges are modeled as springs connecting glycan beads (Figure 3C) (Laporte et al., 2012; Tang et al., 2014; Huang et al., 2008). Typical length of inserted glycan polymer is ∼1 μm (∼1/3 cell circumference) (Hayhurst et al., 2008) and in our model the peptide bridges between newly inserted glycan strands are in a relaxed state. Glycan beads experience forces due to glycan elastic springs (kgly), glycan persistence length (lp), elastic peptide links (kpep), stochastic thermal fluctuations, and pressure difference (Δp) between forespore and mother cell (see Equation 1 and Appendix 2). Glycan strands in the PG layer are connected with neighboring glycans by stem peptides (Figure 4A). In our model, the angle between neighboring stem peptides that belong to the same glycan strand is assumed to be 90°(Nguyen et al., 2015; Huang et al., 2008). Therefore, every other stem peptide is in plane with the glycan sheet. In our model Δp originates from the packing of the B. subtilis chromosome (∼4.2 Mbp) in the small forespore compartment (Errington, 1993; Perez et al., 2000; Bath et al., 2000; Yen Shin et al., 2015).

To systematically explore the peptidoglycan parameters, we compared our simulations with actual changes in forespore volume, forespore surface area, and percentage of engulfment extracted from time-lapse movies, using χ2 fitting (Figure 4B, Equation 2, Materials and methods). Parameters that best fit experimental measurements belong to dark blue region in agreement with molecular dynamic simulations (Nguyen et al., 2015). For a single peptide bond, the linear elasticity regime is valid for extensions that are less than 1 nm (Nguyen et al., 2015) and this elastic regime is maintained in the regions with low χ2 (Figure 4—figure supplement 2). For large enough glycan stiffness (kgly>> 300 pN/nm) χ2 becomes independent of kgly (Figure 4B). A typical simulation shown in Figure 4C matches experimental measurements of time-dependent engulfment, volume, and surface area (Figure 4D,E). PG spring constants drastically affect forespore morphologies. By decreasing kpep forespores elongate, while by increasing kpep forespores shrink, as measured along the long axis of the cell. Changing kgly has only minor effects on volume and surface area. However, the main effect is on forespore curvature (see Figure 4—figure supplement 4): high kgly increases the curvature of forespore ends (making them more pointy), while low kgly decreases the curvature of the forespore ends. Our simulations successfully reproduce asymmetric engulfment (Figure 4F,G; Video 5). For prep and ppro0.8 we obtained asymmetric engulfment that reproduces the phenotypes observed when PG synthesis or degradation is partially blocked. When defects in the peptidoglycan meshwork are not repaired, different parts of the leading edge extend in an uncoordinated manner, producing asymmetric engulfment.

Video 5
Simulations for different values of stochastic parameters prep and ppro.

Decreasing prep and ppro below 0.8 results in asymmetric engulfment. For full exploration of stochastic insertion parameter see Figure 4—figure supplement 1.

https://doi.org/10.7554/eLife.18657.023

Since our simulations correctly reproduced engulfment dynamics we used simulation parameters to estimate glycan insertion velocities VIDC of IDC (see Appendix 2). Using this method we estimated a lower bound on product NIDCVIDC ∼ 110 nm/s, where NIDC is the number of insertion complexes. Similarly, by estimating the total amount of newly inserted material in the forespore within ∼0.8 hr without any pausing we obtain NIDCVIDC ∼ 117 nm/s. For circumferentially processive PBPs (PbpA and PbpH), the absolute velocity measured using TIRF microscopy is ∼20–40 nm/s during vegetative cell growth (Domínguez-Escobar et al., 2011; Garner et al., 2011), which is in agreement with the speed of forespore GFP-MreB determined from our TIRF experiments ((28 ± 8) nm/s, n = 14; Figure 2E). Using this estimate for VIDC, we obtain a lower bound 3–6 on the number of active, highly processive PBP molecules. However, the actual number of proteins could be higher for other nonprocessive PBPs (Domínguez-Escobar et al., 2011; Garner et al., 2011).

Discussion

The results presented here suggest that engulfment involves coordinated PG synthesis and degradation processes that are segregated between different cell types: first, PG is synthesized in front of the LE of the engulfing membrane by a forespore-associated PG biosynthetic machinery that rotates following the LE of the engulfing membrane. Then this new PG is targeted for degradation by the mother cell-associated PG degradation machinery comprised of the DMP complex (Figure 2H). The delocalization of DMP when PG synthesis is inhibited with antibiotics (Figure 2, Figure 2—figure supplement 3) indicates that the DMP either forms an actual complex with the PG biosynthetic machinery across the septal PG (to form a single insertion degradation complex (IDC), as shown in Figure 3) or that DMP targets the new PG synthesized at the LE of the engulfing membrane. In the latter, DMP might specifically target the cross-links that attach the old lateral cell wall to the new PG synthesized at the LE of the engulfing membrane (Figure 2H, orange). Since those cross-links join old, modified PG from the lateral cell wall to newly synthesized PG at the LE, those peptide bridges might have a unique chemical composition or structural arrangement that could be specifically recognized by DMP. Hence, either approach provides a safety mechanism during engulfment, since it would prevent DMP from degrading the old PG of the lateral cell wall, which could lead to cell lysis.

We have conceptualized these results in a biophysical model in which a PG insertion-degradation complex (IDC), representing PBPs for PG synthesis and DMP proteins for PG degradation, catalyzes PG remodeling at the LE of the engulfing membrane. Specifically, we propose that new glycan strands are inserted ahead of the LE of the engulfing membrane and PG is degraded on the mother cell proximal side to create space for forward movement of the LE (Figure 3). This is similar to the ‘make-before-break’ model of vegetative cell-wall growth, which postulates that the vegetative cell wall is elongated by inserting new PG strands prior to degrading old strands (Koch and Doyle, 1985) (although bacteria can also make a de novo cell wall (Ranjit and Young, 2013, Kawai et al., 2014). The make-before-break mechanism also accounts for the directional movement of the LE towards the forespore pole, since the substrate for DMP is new PG synthesized by forespore PBPs, which is always ahead of the LE of the engulfing membrane.

Using Langevin simulations we successfully reproduced the dynamics of engulfment, forespore volume, and surface area. Additionally, our model correctly reproduced asymmetric engulfment observed with reduced IDC activity, and we estimated that with only a handful of highly processive PBP molecules are necessary to reproduce the observed LE dynamics. A more general model without strong coupling between the PG biosynthetic and PG degradation machineries also leads to successful engulfment (Appendix 2, Figure 4—figure supplement 5, Video 6). However, DMP has to be guided to degrade only the peptide cross-links between old and new glycan strands, and should also prevent detachment of the septal peptidoglycan from the old cell wall.

Video 6
Simulations with decoupled synthesis and degradation.

New glycans are released from the old cell wall with typical delay time τdelay. Simulations for four different values of τdelay= 0, 0.9, 9, and 18 min (from left to right). For longer τdelay the larger is separation between synthesis and membrane leading edge that is shown as red cylinder.

https://doi.org/10.7554/eLife.18657.024

Since our simple mechanism in Figure 3A entails hydrolysis of certain peptide bonds but no glycan degradation, we explored additional mechanisms since the SpoIID protein of the DMP complex shows transglycosylase activity (Morlot et al., 2010). First, it is possible that engulfment entails a two-for-one mechanism, with two new glycan strands are added and the newly inserted glycan strand at the LE is degraded (Höltje, 1998) (Figure 3—figure supplement 1A). Similarly, the three-for-one mechanism would also work (Scheffers and Pinho, 2005). Second, one new glycan strand might be added and the inner most cell-wall glycan of the thick, lateral cell wall degraded (Figure 3—figure supplement 1B). This would make the lateral cell wall thinner as the engulfing membrane moves forward (Tocheva et al., 2013). Finally, it is possible that insertion and degradation are not intimately coupled, and that there is simply a broad region in which PG is inserted ahead of the engulfing membrane, to create multiple links between the septal PG and the lateral cell wall (as shown in Figure 2H), and that the DMP complex has a preference for newly synthesized PG. All of these models require the spatial coordination between cell wall degradation and synthesis to avoid compromising cell wall integrity and inducing cell lysis, and all share a common ‘make-before-break’ strategy to promote robustness of the otherwise risky PG remodeling process (Koch and Doyle, 1985). In order to waste as little energy as possible, a more stringent ‘make-just-before-break’ strategy may even apply, motivating more intimate coupling between the PG biosynthetic and degradation machineries.

Our simple biophysical mechanism postulates that engulfment does not rely on pulling or pushing forces for membrane migration. Instead, cell wall remodeling makes room for the mother cell membrane to expand around the forespore by entropic forces. During engulfment the mother-cell surface area increases by ∼2 μm2 (∼25%, see Figure 1—figure supplement 3), and this excess of membrane could simply be accommodated around the forespore by remodeling the PG at the LE. However, our model does not include all potential contributors to engulfment. For instance, the SpoIIQ-AH zipper, which is dispensable for engulfment in native conditions (Broder and Pogliano, 2006), might prevent membrane backward movement, and might also help localize the IDC components toward the LE. Interestingly, SpoIIQ-AH interaction is essential for engulfment in Clostridium difficile where the SpoIIQ ortholog posseses endopeptidase activity (Crawshaw et al., 2014; Serrano et al., 2016; Fimlaid et al., 2015). The model also does not consider the impact of the tethering of the LE of the engulfing membrane to the forespore via interactions between the mother cell membrane anchored DMP complex at the LE and forespore synthesized PG. Future experiments and modeling should address the role of these and other potential contributors to LE migration, which will allow us to refine our biophysical model and obtain a comprehensive view of membrane dynamics during engulfment. Furthermore, understanding the cooperation between PBPs and DMP will provide valuable clues about the structure of the cell wall in Gram-positive bacteria.

Materials and methods

Strains and culture conditions

All the strains used in this study are derivatives of B. subtilis PY79. Complete lists of strains, plasmids, and oligonucleotides see Appendix 3. Detailed descriptions of plasmid construction are provided in Supplementary file 1. For each experiment we had at least two biological replicas, and each one contains at least three technical replicas. Averages of individual cells, but not the averages of different replicas are reported. Sporulation was induced by resuspension (Sterlini and Mandelstam, 1969), except that the bacteria were grown in 25% LB prior to resuspension, rather than CH medium. Cultures were grown at 37°C for batch culture experiments, and at 30°C for timelapse experiments.

Fluorescence microscopy

Cells were visualized on an Applied Precision DV Elite optical sectioning microscope equipped with a Photometrics CoolSNAP-HQ2 camera and deconvolved using SoftWoRx v5.5.1 (Applied Precision). When appropriate, membranes were stained with 0.5 μg/ml FM 4–64 (Life Technologies, Waltham, Massachusetts) or 1 μg/ml Mitotracker green (Life Technologies). Cells were transferred to 1.2% agarose pads for imaging. The median focal plane is shown.

Timelapse fluorescent microscopy

Sporulation was induced at 30°C. 1.5 hr after sporulation induction, 0.5 μg/ml FM 4–64 was added to the culture and incubation continued for another 1.5 hr. Seven μl samples were taken 3 hr after resuspension and transferred to agarose pads prepared as follows: 2/3 vol of supernatant from the sporulation culture; 1/3 vol 3.6% agarose in fresh A+B sporulation medium; 0.17 μg/ml FM 4–64. When appropriated, cephalexin (50 μg/ml) or bacitracin (50 μg/ml) was added to the pad. Pads were partially dried, covered with a glass slide and sealed with petroleum jelly to avoid dehydration during timelapse imaging. Petroleum jelly is not toxic and cannot be metabolized by B. subtilis, which poses an advantage over other commonly used sealing compounds, such as glycerol, which can be used as a carbon source and inhibit the initiation of sporulation. Pictures were taken in an environmental chamber at 30°C every 5 min for 5 hr. Excitation/emission filters were TRITC/CY5. Excitation light transmission was set to 5% to minimize phototoxicity. Exposure time was 0.1 s.

Forespore GFP-MreB tracking experiments

MreB tracking experiments were performed using the strain JLG2411, which produced GFP-MreB in the forespore after polar septation from spoIIQ promoter. Sporulation and agarose pads were done as described in Timelapse fluorescent microscopy, except that FM 4–64 was only added to the agarose pads and not to the sporulating cultures. A static membrane picture was taken at the beginning of the experiment, and was used as a reference to determine the position of the GFP-MreB foci. GFP-MreB motion at the cell surface was determined by TIRF microscopy (Garner et al., 2011; Domínguez-Escobar et al., 2011), taking pictures every 4 s for 100 s. Imaging was performed at 30°C. We used two different microscopes to perform TIRF microscopy: (i) An Applied Precision Spectris optical sectioning microscope system equipped with an Olympus IX70 microscope, a Photometrics CoolSNAP HQ digital camera and a 488 nm argon laser. To perform TIRF in this microscope, we used an Olympus 1003 1.65 Apo objective, immersion oil n = 1.78 (Cargille Laboratories), and sapphire coverslips (Olympus). Laser power was set to 15%, and exposure time was 200 ms. (ii) An Applied Precision OMX Structured Illumination microscopy equipped with a Ring-TIRF system and a UApoN 1.49NA objective, immersion oil n = 1.518. Exposure time was 150 ms.

Images were analyzed using the ImageJ-based FIJI package. Sporangia were aligned vertically using the rotation function in FIJI. GFP-MreB foci were tracked using the TrackMate pluging (Tinevez et al., 2016), using the LoG detector, estimated blob diameter of 300 nm, simple LAP tracked and linking max distance of 300 nm. Only tracks that contained more than four points were used to determine the MreB foci speed.

Image analysis

We used the semi-automated active contour software JFilament available as ImageJ plugin to extract fluorescently labeled membrane position over time (Smith et al., 2010). Membrane position obtained from the medial focal plane is used in custom built Mathematica software to calculate 3D volume and surface area by assuming rotational symmetry around the axis connecting the center of masses of mother cell and forespore. For available code and example see Supplementary file 2 . Kymographs as in Figure 1E were created by collecting intensities along the forespore contours. Subsequently, pixel angles were determined using pixel position relative to the mother-forespore frame as defined in inset of Figure 1E. Forespore fluorescent intensities along angles are normalized and interpolated using third-order polynomials. For a given angle the population intensity average of different cells is calculated and plotted over time. Time 0’ is the onset of septum curving.

Quantification of GFP-SpoIID, GFP-SpoIIM and GFP-SpoIIP fraction at LE

Antibiotics were added 2 hr after resuspension, and samples were taken one hour later for imaging. Exposure times and image adjustments were kept constant throughout the experiment. To determine the fraction of GFP signal at the LE, GFP pixel intensities of seven optical sections covering a total thickness of 0.9 μm were summed. GFP intensities at the LE (ILE) and in the rest of the mother cell (IMC) were determined separately by drawing polygons encompassing the LE or the MC. After subtraction of the average background intensity, the fraction of GFP fluorescence at LE (ILEILE+IMC) was determined for each sporangium.

Langevin dynamics

The Langevin dynamic equation of the ith bead at position 𝐫i is given by:

(1) ζid𝐫idt=𝐅ispr+𝐅ibend+𝐅ipep+𝐅istoch+𝐅iΔp+𝐅iwall,

where the left-hand side depends on the drag coefficient ζi4πηmedl0 (Howard, 2001), with ηmed is the medium viscosity and l0 equilibrium distance between neighbouring beads (see Appendix 1). On the right-hand side of Equation 5 we have contributions of glycan elastic spring, glycan bending, peptide elastic links, stochastic thermal fluctuations, pressure difference Δp between forespore and mother, and excluded volume from the old cell wall, respectively.

χ2 fitting of parameters

To compare simulations with experiments we measured forespore volume (Vi), forespore surface area (Si) and engulfment (Ei) and constructed a quality-of-fit function as:

(2) χ2=i[(Viexp-Visim)2σ2(Viexp)+(Siexp-Sisim)2σ2(Siexp)+(Eiexp-Eisim)2σ2(Eiexp)],

where index i corresponds to ith time point, and σ is the standard deviation (Spitzer et al., 2006).

Appendix 1

Image analysis

Forespore volume and surface area

Forespore volume and surface area are estimated from tracked fluorescent membranes in the medial focal plane using ImageJ plugin JFilament (Smith et al., 2010). JFilament is a semi-automated active contour software that is used for tracking fluorescently labelled membrane over time. The output of the software is a string of discrete membrane dots 𝐫i = (xi,yi). A typical distance between neighbouring dots is li∼1 pixel. From the positions of the membrane dots, a costume-built Mathematica program was used to calculate the 3D volume (V) and surface area (S) by assuming rotational symmetry around the axis connecting the center of mass of the forespore and mother cell. The volume is given by:

(3) V=12i=1Nπdi2li|t^ie^fm|,

where N is the total number of dots, di is the shortest distance between ith dot and rotational axis, li=(xi+1-xi)2+(yi+1-yi)2 is the distance between neighbouring dots, and t^i(ri+1ri)/|ri+1ri| is the unit tangent vector, and e^fm is the unit vector of the rotational axis. Since the sum extends over all the dots we used prefactor 12 in order to correct for double counting. Similarly, the surface area is:

(4) S=12i=1N2πdili.

Calculating gap arc length

Forespore membrane contours are extracted as described in Forespore volume and surface area. Using a simple thresholding method (0.55 ± 0.05, relative to bright engulfing cup) the part of forespores that is not covered with mother membrane is selected. The total arc length is subsequently calculated for segments not covered with the mother membrane. Analysis of cells with symmetric and asymmetric cups are included in the analysis of the main text (Figure 1H).

Appendix 2

Model and simulations

Stochastic leading-edge insertion

In our model insertion-degradation complexes (IDC) drive leading-edge (LE) advancement. Glycan-strand insertion occurs exclusively at the leading edge (Figure 3). A single IDC binds to a previously created glycan defect with probability prep (probability to repair) or anywhere along the LE with probability (1-prep). Once bound, the IDC inserts a glycan strand of a typical length 1 μm (Hayhurst et al., 2008). In the model IDC uses two glycan strands for guiding the insertion as suggested by the proposed template model of vegetative cell growth (Höltje, 1998). One template strand belongs to the elongating septal PG and other strand to the old cell wall. During the insertion process, if IDC encounters a gap in the old cell wall, IDC continues insertion with probability ppro (processivity probability) or terminates insertion with probability (1-ppro). When the IDC reaches the end of the germ cell wall template, insertion is terminated.

To explore general properties of above simple stochastic model we discretized glycan strands in segments of 2 nm, which corresponds to a distance between two neighboring antiparallel peptide bonds (Figure 4A, Figure 4—figure supplement 1). We simulated this simple model assuming that the total number NIDC of IDCs is constant. Also, IDC inserts one glycan segment per time step. Simulations are run until the LE reaches the height of 1 μm (500 glycans). For simulated LE profiles we measured their width (2hi2-hi2) and roughness (1 - C/C0), where is the average over LE segments, hi the height of the ith LE segment, C the LE circumference, and C0 the cell circumference.

Langevin dynamics

Inserted glycans are equilibriated using Langevin dynamics in 3D (Laporte et al., 2012; Tang et al., 2014; Ojkic et al., 2014). The Langevin dynamic equation of the ith glycan bead at position 𝐫i is given by:

(5) ζid𝐫idt=𝐅ispr+𝐅ibend+𝐅ipep+𝐅istoch+𝐅iΔp+𝐅iwall,

where the left-hand side depends on the drag coefficient ζi4πηmedl0 (Howard, 2001), with ηmed is the medium viscosity and l0 equilibrium distance between neighboring beads. On the right-hand side of Equation 5 we have contributions from glycan elasticity, glycan bending, peptide elasticity, thermal fluctuations, pressure difference Δp between forespore and mother cell, and excluded volume from the old cell wall, respectively. Simulation parameters are in Appendix 2—table 1. Below we describe each force contribution.

Glycan elastic force

The elastic force on the ith bead due to neighboring linear springs is given by:

(6) 𝐅ispr=-Espr𝐫i=-kgly2j=1N-1(|𝐫j+1-𝐫j|-l0)2𝐫i,

where N is the total number of beads in the glycan.

Glycan bending

The bending force is given by

(7) Fibend=Ebendri=κbl0j=2N1(t^jt^j1)ri,

with t^i(ri+1ri)/|ri+1ri| is the unit tangent vector, and κb is the glycan flexural rigidity. We further simplified Equation 7 using identity (Pasquali and Morse, 2002)

(8) t^irj=1l0(δi+1,jδi,j)(I^t^it^iT),

where δi,j the Kroneker symbol, I^ the unit matrix, and

(9) t^it^iT(ti,x2ti,xti,yti,xti,zti,xti,yti,y2ti,yti,zti,xti,zti,yti,zti,z2),
Peptide elastic force

The force on the ith glycan bead due to peptide connections is:

(10) 𝐅ipep=-Epep𝐫i=-kpep2j(|𝐫j-𝐫i|-l0p)2𝐫i,

where the sum is over beads of neighboring glycans that have peptide connections with the ith bead. Here l0p is the equilibrium peptide length, and kpep is the peptide spring constant.

Stochastic force

The stochastic force due to thermal noise is given by (Pasquali and Morse, 2002)

(11) FistochFistochT=2kBTζiΔtI^,

with kBT the thermal energy and Δt the simulation time step.

Pressure force

In our model pressure difference (Δp) is due to translocated DNA

(12) FiΔp=ΔSiΔpn^i

with ΔSi the surface segment corresponding to the ith bead, and n^i is the unit normal vector. Parameter Δp is estimated using the contact-value theorem of confined polymers in a thermal equilibrium (Li et al., 2008). The osmotic pressure in the forespore compartment due to translocated DNA is pf=(Rf-σ/2Rf)2ckBT, where Rf is the forespore radius, σ is the DNA cross-section diameter, and c is the number density of DNA at the forespore inner surface. For simplicity, we assumed that DNA density is constant throughout the forespore. Since σRf we neglected the numerical prefactor in the expression for osmotic pressure. Using the same expression for the osmotic pressure in mother-cell compartment and Vm/Vf5 at the end of engulfment (Figure 4, Figure 1—figure supplement 3) we estimated a lower bound for the osmotic pressure difference Δp86.31 kPa.

Excluded volume

Excluded volume force from the lateral old cell wall was added to each glycan bead when the bead is within l0 of the lateral cell wall. The magnitude of excluded volume force was 70 pN in the normal and inward direction of the lateral wall.

Simulations with decoupled synthesis and degradation

To explore the possibility that synthesis and degradation are not tightly coupled as in our IDC model, we simulated delayed degradation of peptide bonds connecting lateral cell wall and newly synthesized glycan strands. For this purpose, we introduced a typical delay time τdelay of peptide degradation in our simulation (Figure 4—figure supplement 5, Video 6). As expected, the spatial insertion-degradation separation increases with τdelay (Figure 4—figure supplement 5A,B). As long as no errors are made, this mechanism also leads to successful forespore engulfment.

To investigate the role of errors in cutting peptide bonds we simulated the possibility that PG degradation also cuts neighbouring peptide bond (peptide connection in different planes) of newly synthesized germ cell wall with probability ppcut (Figure 4—figure supplement 5C–D). For relatively small ppcut= 0.1, an irregular peptidoglycan meshwork is formed. As long as ppcut is small, intact forespores are formed.

We also simulated dislocalized DMP degradation upon antibiotic treatment when synthesis is stalled (Figure 2E–F, Figure 2—figure supplement 3). We explored the possibility that dislocated DMP randomly cuts old germ cell wall peptides with constant degradation rate prpep. In this scenario, irregular peptidoglycan networks protrude towards the mother cell with apparent volume increase while the leading edge remains still (Figure 4—figure supplement 5E–F). Similar phenotypes are experimentally observed about 2 hr after antibiotic treatment (see Video 1; Figure 1—figure supplement 1A)

Numerical integration

After stochastic glycan insertion, Equation 5 was numerically integrated with time step Δt=210-8 s. The peptidoglycan (PG) network was equilibrated with 15,000 integration time steps. Simulations were also tested with 30,000 time steps to make sure that forespore volume, surface area, and engulfment remained unchanged. Obtained time traces of volume, surface area, and engulfment are subsequently rescaled in time to match experimental measurements (Figure 4D–E). A typical rescaling factor was Δt~=1.8105. Since rescaling was done on fully equilibrated PG meshworks obtained relaxation dynamics were not affected by our rescaling method. From the mass conservation of inserted glycans we estimated NIDCVIDCNinl0w/Δt~, where NIDC is the number of IDC, VIDC is the IDC insertion velocity, Nin is the number of inserted segments, w=7 is the number of glycans per coarse-grained glycan (Figure 4A).

Simulation parameters

Appendix 2—table 1

Model parameters.

https://doi.org/10.7554/eLife.18657.027
SymbolPhysical quantityValues used in simulationSources / ReferencesNotes
T0Room temperature300 K
kpepPeptide effective spring constant; kpep = kpep0 / 225 pN/nmFigure 4—figure supplement 4, (Nguyen et al., 2015)kpep0 for a single peptide
kglyGlycan effective spring constant; kgly = kgly05570 pN/nmFigure 4—figure supplement 4, (Nguyen et al., 2015)kgly0 for a single glycan
lp0Glycan persistance length40 nmFigure 4—figure supplement 2,(Nguyen et al., 2015)
ΔpPressure difference86.31 kPaApendix (2.2)
ηwatWater viscosity0.001 Pa s
ηmedMedium viscosity1 Pa s(Spitzer et al., 2006)
l0=l0pMesh size0.014 μmOur simulations
ΔtTime step2 10-8sOur simulations

Appendix 3

Strains, plasmids and oligonucleotides

Appendix 3—table 1

Strains used in this study.

https://doi.org/10.7554/eLife.18657.028
StrainGenotype or descriptionReference, source or construction*
PY79Wild type(Youngman et al., 1984)
ABS49ΔspoIIP::TetΩPspoIIP-GFP-spoIIPΩerm(Chastanet and Losick, 2007)
ABS98ΔspoIIM::spcΩPspoIIM-GFP-spoIIDΩerm(Chastanet and Losick, 2007)
ABS325ΔspoIID::kanΩPspoIID-GFP-spoIIDΩerm(Chastanet and Losick, 2007)
JLG626ΔspoIIQ::ermpJLG78 PY79 (Em R)
JLG1420amyE::PspoIIQ-sfGFP-pbpFΩcatpJLG213 PY79 (Cm R)
JLG1421amyE::PspoIIR-sfGFP-pbpFΩcatpJLG214 PY79 (Cm R)
JLG1422thrC::PspoIID-sfGFP-pbpFΩspcpJLG215 PY79 (Sp R)
JLG1425amyE::PspoIIQ-sfGFP-pbpGΩcatpJLG218 PY79 (Cm R)
JLG1427amyE::PspoIIR-sfGFP-pbpGΩcatpJLG219 PY79 (Cm R)
JLG1428thrC::PspoIID-sfGFP-pbpGΩspcpJLG220 PY79 (Sp R)
JLG1555amyE::PspoIIQ-sfGFP-ponAΩcatpJLG222 PY79 (Cm R)
JLG1556amyE::PspoIIR-sfGFP-ponAΩcatpJLG223 PY79 (Cm R)
JLG1557thrC::PspoIID-sfGFP-ponAΩspcpJLG230 PY79 (Sp R)
JLG1558amyE::PspoIIQ-sfGFP-pbpDΩcatpJLG224 PY79 (Cm R)
JLG1559amyE::PspoIIR-sfGFP-pbpDΩcatpJLG225 PY79 (Cm R)
JLG1560thrC::PspoIID-sfGFP-pbpDΩspcpJLG226 PY79 (Sp R)
JLG1824amyE::PspoIIQ-sfGFP-pbpBΩcatpJLG263 PY79 (Cm R)
JLG1825amyE::PspoIIR-sfGFP-pbpBΩcatpJLG264 PY79 (Cm R)
JLG1826thrC::PspoIID-sfGFP-pbpBΩspcpJLG265 PY79 (Sp R)
JLG1827amyE::PspoIIQ-sfGFP-pbpHΩcatpJLG266 PY79 (Cm R)
JLG1828amyE::PspoIIR-sfGFP-pbpHΩcatpJLG267 PY79 (Cm R)
JLG1829thrC::PspoIID-sfGFP-pbpHΩspcpJLG268 PY79 (Sp R)
JLG1830amyE::PspoIIR-sfGFP-pbpIΩcatpJLG270 PY79 (Cm R)
JLG1831thrC::PspoIID-sfGFP-pbpIΩspcpJLG271 PY79 (Sp R)
JLG1832amyE::PspoIIQ-sfGFP-pbpAΩcatpJLG272 PY79 (Cm R)
JLG1833amyE::PspoIIR-sfGFP-pbpAΩcatpJLG273 PY79 (Cm R)
JLG1834thrC::PspoIID-sfGFP-pbpAΩspcpJLG274 PY79 (Sp R)
JLG1835amyE::PspoIIQ-sfGFP-pbpXΩcatpJLG275 PY79 (Cm R)
JLG1836amyE::PspoIIR-sfGFP-pbpXΩcatpJLG276 PY79 (Cm R)
JLG1837thrC::PspoIID-sfGFP-pbpXΩspcpJLG277 PY79 (Sp R)
JLG1838amyE::PspoIIQ-sfGFP-dacAΩcatpJLG278 PY79 (Cm R)
JLG1839amyE::PspoIIR-sfGFP-dacAΩcatpJLG279 PY79 (Cm R)
JLG1840thrC::PspoIID-sfGFP-dacAΩspcpJLG280 PY79 (Sp R)
JLG1851amyE::PspoIIQ-sfGFP-dacBΩcatpJLG281 PY79 (Cm R)
JLG1852amyE::PspoIIR-sfGFP-dacBΩcatpJLG282 PY79 (Cm R)
JLG1853thrC::PspoIID-sfGFP-dacBΩspcpJLG283 PY79 (Sp R)
JLG1854amyE::PspoIIQ-sfGFP-dacCΩcatpJLG284 PY79 (Cm R)
JLG1855amyE::PspoIIR-sfGFP-dacCΩcatpJLG285 PY79 (Cm R)
JLG1856thrC::PspoIID-sfGFP-dacCΩspcpJLG286 PY79 (Sp R)
JLG1857amyE::PspoIIQ-sfGFP-dacFΩcatpJLG287 PY79 (Cm R)
JLG1858thrC::PspoIID-sfGFP-dacFΩspcpJLG289 PY79 (Sp R)
JLG1859amyE::PspoIIQ-sfGFP-pbpIΩcatpJLG269 PY79 (Cm R)
JLG1860amyE::PspoIIR-sfGFP-dacFΩcatpJLG288 PY79 (Cm R)
JLG1861amyE::PspoIIQ-sfGFP-pbpEΩcatpJLG296 PY79 (Cm R)
JLG1863amyE::PspoIIR-sfGFP-pbpEΩcatpJLG298 PY79 (Cm R)
JLG1864thrC::PspoIID-sfGFP-pbpEΩspcpJLG299 PY79 (Sp R)
JLG2248amyE::PspoIIR-sfGFP-ponAΩcat ΔspoIIQ::ermJLG626 JLG1556 (Em R)
JLG2356ΔgerM::kanpJLG361 PY79 (Km R)
JLG2359amyE::PspoIIR-sfGFP-pbpAΩcat ΔspoIIQ::ermJLG626 JLG1833 (Em R)
JLG2360amyE::PspoIIR-sfGFP-pbpAΩcat ΔspoIIB::ermKP343 JLG1833 (Em R)
JLG2366amyE::PspoIIR-sfGFP-ponAΩcat ΔspoIIB::ermKP343 JLG1556 (Em R)
JLG2367amyE::PspoIIR-sfGFP-ponAΩcat ΔgerM::kanJLG2356 JLG1556 (Km R)
JLG2368amyE::PspoIIR-sfGFP-ponAΩcat ΔspoIIIAG-AH::kanKP896 JLG1556 (Km R)
JLG2369amyE::PspoIIR-sfGFP-ponAΩcat ΔspoIVFAB::cat::tetKP1013 JLG1556 (Tet R)
JLG2370amyE::PspoIIR-sfGFP-ponAΩcat ΔsigE::ermKP161 JLG1556 (Em R)
JLG2371amyE::PspoIIR-sfGFP-ponAΩcat spoIID::Tn917ΩermKP8 JLG1556 (Em R)
JLG2372amyE::PspoIIR-sfGFP-ponAΩcat ΔspoIIP::tetKP513 JLG1556 (Tet R)
JLG2373amyE::PspoIIR-sfGFP-ponAΩcat spoIIM::Tn917ΩermKP519 JLG1556 (Em R)
JLG2374amyE::PspoIIR-sfGFP-pbpAΩcat ΔgerM::kanJLG2356 JLG1833 (Km R)
JLG2375amyE::PspoIIR-sfGFP-pbpAΩcat ΔspoIIIAG-AH::kanKP896 JLG1833 (Km R)
JLG2376amyE::PspoIIR-sfGFP-pbpAΩcat ΔspoIVFAB::cat::tetKP1013 JLG1833 (Tet R)
JLG2377amyE::PspoIIR-sfGFP-pbpAΩcat ΔsigE::ermKP161 JLG1833 (Em R)
JLG2378amyE::PspoIIR-sfGFP-pbpAΩcat spoIID::Tn917ΩermKP8 JLG1833 (Em R)
JLG2379amyE::PspoIIR-sfGFP-pbpAΩcat ΔspoIIP::tetKP513 JLG1833 (Tet R)
JLG2380amyE::PspoIIR-sfGFP-pbpAΩcat spoIIM::Tn917ΩermKP519 JLG1833 (Em R)
JLG2411amyE::PspoIIQ-sfGFP-mreBΩcatpJLG363 PY79 (Cm R)
JLG2412amyE::PspoIIR-sfGFP-mreBΩcatpJLG364 PY79 (Cm R)
JLG2413thrC::PspoIID-sfGFP-mreBΩspcpJLG365 PY79 (Sp R)
JLG2414amyE::PspoIIQ-sfGFP-mblΩcatpJLG371 PY79 (Cm R)
JLG2415amyE::PspoIIR-sfGFP-mblΩcatpJLG366 PY79 (Cm R)
JLG2416thrC::PspoIID-sfGFP-mblΩspcpJLG367 PY79 (Sp R)
JLG2417amyE::PspoIIQ-sfGFP-mreBHΩcatpJLG368 PY79 (Cm R)
JLG2418amyE::PspoIIR-sfGFP-mreBHΩcatpJLG369 PY79 (Cm R)
JLG2419thrC::PspoIID-sfGFP-mreBHΩspcpJLG370 PY79 (Sp R)
KP8spoIID::Tn917Ωerm(Sandman et al., 1987)
KP161ΔsigE::erm(Kenney and Moran, 1987)
KP343ΔspoIIB::erm(Margolis et al., 1993)
KP513ΔspoIIP::tet(Frandsen and Stragier, 1995)
KP519spoIIM::Tn917Ωerm(Sandman et al., 1987)
KP896ΔspoIIIAG-AH::kan(Blaylock et al., 2004)
KP1013ΔspoIVFAB::cat::tet(Aung et al., 2007)
  1. *Plasmid or genomic DNA employed (right side the arrow) to transform an existing strain (left side the arrow) into a new strain are listed. The drug resistance is noted in parentheses.

Appendix 3—table 2

Plasmids used in this study.

https://doi.org/10.7554/eLife.18657.029
PlasmidDescription
pJLG78ΔspoIIQ::erm
pJLG88amyE::PspoIIQ-pbpFΩcat
pJLG89amyE::PspoIIR-pbpFΩcat
pJLG90thrC::PspoIID-pbpFΩspc
pJLG91amyE::PspoIIQ-pbpGΩcat
pJLG92amyE::PspoIIR-pbpGΩcat
pJLG93thrC::PspoIID-pbpGΩspc
pJLG213amyE::PspoIIQ-sfGFP-pbpFΩcat
pJLG214amyE::PspoIIR-sfGFP-pbpFΩcat
pJLG215thrC::PspoIID-sfGFP-pbpFΩspc
pJLG218amyE::PspoIIQ-sfGFP-pbpGΩcat
pJLG219amyE::PspoIIR-sfGFP-pbpGΩcat
pJLG220thrC::PspoIID-sfGFP-pbpGΩspc
pJLG222amyE::PspoIIQ-sfGFP-ponAΩcat
pJLG223amyE::PspoIIR-sfGFP-ponAΩcat
pJLG224amyE::PspoIIQ-sfGFP-pbpDΩcat
pJLG225amyE::PspoIIR-sfGFP-pbpDΩcat
pJLG226thrC::PspoIID-sfGFP-pbpDΩspc
pJLG230amyE::PspoIIR-sfGFP-ponAΩcat
pJLG263amyE::PspoIIQ-sfGFP-pbpBΩcat
pJLG264amyE::PspoIIR-sfGFP-pbpBΩcat
pJLG265thrC::PspoIID-sfGFP-pbpBΩspc
pJLG266amyE::PspoIIQ-sfGFP-pbpHΩcat
pJLG267amyE::PspoIIR-sfGFP-pbpHΩcat
pJLG268thrC::PspoIID-sfGFP-pbpHΩspc
pJLG269amyE::PspoIIQ-sfGFP-pbpIΩcat
pJLG270amyE::PspoIIR-sfGFP-pbpIΩcat
pJLG271thrC::PspoIID-sfGFP-pbpIΩspc
pJLG272amyE::PspoIIQ-sfGFP-pbpAΩcat
pJLG273amyE::PspoIIR-sfGFP-pbpAΩcat
pJLG274thrC::PspoIID-sfGFP-pbpAΩspc
pJLG275amyE::PspoIIQ-sfGFP-pbpXΩcat
pJLG276amyE::PspoIIR-sfGFP-pbpXΩcat
pJLG277thrC::PspoIID-sfGFP-pbpXΩspc
pJLG278amyE::PspoIIQ-sfGFP-dacAΩcat
pJLG279amyE::PspoIIR-sfGFP-dacAΩcat
pJLG280thrC::PspoIID-sfGFP-dacAΩspc
pJLG281amyE::PspoIIQ-sfGFP-dacBΩcat
pJLG282amyE::PspoIIR-sfGFP-dacBΩcat
pJLG283thrC::PspoIID-sfGFP-dacBΩspc
pJLG284amyE::PspoIIQ-sfGFP-dacCΩcat
pJLG285amyE::PspoIIR-sfGFP-dacCΩcat
pJLG286thrC::PspoIID-sfGFP-dacCΩspc
pJLG287amyE::PspoIIQ-sfGFP-dacFΩcat
pJLG288amyE::PspoIIR-sfGFP-dacFΩcat
pJLG289thrC::PspoIID-sfGFP-dacFΩspc
pJLG296amyE::PspoIIQ-sfGFP-pbpEΩcat
pJLG298amyE::PspoIIR-sfGFP-pbpEΩcat
pJLG299thrC::PspoIID-sfGFP-pbpEΩspc
pJLG361ΔgerM::kan
pJLG363amyE::PspoIIQ-sfGFP-mreBΩcat
pJLG364amyE::PspoIIR-sfGFP-mreBΩcat
pJLG365thrC::PspoIID-sfGFP-mreBΩspc
pJLG366amyE::PspoIIR-sfGFP-mblΩcat
pJLG367thrC::PspoIID-sfGFP-mblΩspc
pJLG368amyE::PspoIIQ-sfGFP-mreBHΩcat
pJLG369amyE::PspoIIR-sfGFP-mreBHΩcat
pJLG370thrC::PspoIID-sfGFP-mreBHΩspc
pJLG371amyE::PspoIIQ-sfGFP-mblΩcat
Appendix 3—table 3

Oligonucleotides used in this sudy.

https://doi.org/10.7554/eLife.18657.030
PrimerSequence
JLG-95CATGGATTACGCGTTAACCC
JLG-96GCACTTTTCGGGGAAATGTG
JLG-249catacgccgagttatcacatGATGATTCAACTGACAAATCTGG
JLG-250cacatttccccgaaaagtgcCCAAGTGACCATACGACAGG
JLG-251gggttaacgcgtaatccatgGACAGAGTGACAAGCGATCC
JLG-252gggttgccagagttaaaggaAAGTAAATTGCAGGGAACACC
JLG-253TCCTTTAACTCTGGCAACCC
JLG-254ATGTGATAACTCGGCGTATG
JLG-138CGAAGGCAGCAGTTTTTTGG
JLG-139ATAGAGATCCGATCAGACCAG
JLG-152TGCGAATTGTTTCATATTCAG
JLG-153GTTTTCTTCCTCTCTCATTGTTTC
JLG-297TACTGTTTTTTTCATCGGTCC
JLG-299gaaacaatgagagaggaagaaaac ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-300ctggtctgatcggatctctat ACCTTGTTTTAGGCAAATGG
JLG-301ggaccgatgaaaaaaacagta ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-302ctgaatatgaaacaattcgca ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-303ccaaaaaactgctgccttcg ACCTTGTTTTAGGCAAATGG
JLG-304gaaacaatgagagaggaagaaaac GTGGATGCAATGACAAATAAAC
JLG-306ctggtctgatcggatctctat GGAACCATACGAATAACCCG
JLG-306ggaccgatgaaaaaaacagta GTGGATGCAATGACAAATAAAC
JLG-307ctgaatatgaaacaattcgca GTGGATGCAATGACAAATAAAC
JLG-308ccaaaaaactgctgccttcg GGAACCATACGAATAACCCG
JLG-453TGCGCTTGCGCTTGCGCTG
JLG-889gctagcagcgcaagcgcaagcgca ATGTTTAAGATAAAGAAAAAGAAACTTTTTATAC
JLG-890gctagcagcgcaagcgcaagcgca GTGGATGCAATGACAAATAAAC
JLG-891gaaacaatgagagaggaagaaaac GCTAAAGGCGAAGAACTGTTTAC
JLG-892ggaccgatgaaaaaaacagta GCTAAAGGCGAAGAACTGTTTAC
JLG-893ctgaatatgaaacaattcgca GCTAAAGGCGAAGAACTGTTTAC
JLG-894tgcgcttgcgcttgcgctgctagc TTTATACAGTTCATCCATGCC
JLG-977cagcgcaagcgcaagcgca ATGTCAGATCAATTTAACAGCC
JLG-978ctggtctgatcggatctctat TACCAAAAAAGCCATCACCC
JLG-979ccaaaaaactgctgccttcg TACCAAAAAAGCCATCACCC
JLG-980cagcgcaagcgcaagcgca GTGACCATGTTACGAAAAATAATC
JLG-981ctggtctgatcggatctctat TCTGAAGTCACTCCATATCCC
JLG-982ccaaaaaactgctgccttcg TCTGAAGTCACTCCATATCCC
JLG-1021cagcgcaagcgcaagcgca ATGATTCAAATGCCAAAAAAG
JLG-1022ctggtctgatcggatctctat TTTGGACAGGTAGAACGATG
JLG-1023ccaaaaaactgctgccttcg TTTGGACAGGTAGAACGATG
JLG-1024cagcgcaagcgcaagcgca ATGAAGCAGAATAAAAGAAAGCATC
JLG-1025ctggtctgatcggatctctat CATTCCTTTCTACTTCGTACGG
JLG-1026ccaaaaaactgctgccttcg CATTCCTTTCTACTTCGTACGG
JLG-1027cagcgcaagcgcaagcgca ATGAACCTTTTTTTCCTAGCTG
JLG-1028ctggtctgatcggatctctat CGCTAGAAAATGAGTATTCTCCTTC
JLG-1029ccaaaaaactgctgccttcg CGCTAGAAAATGAGTATTCTCCTTC
JLG-1030cagcgcaagcgcaagcgca ATGAAGATATCGAAACGAATGAAG
JLG-1031ctggtctgatcggatctctat TCTGCACTCCTTTATCCCTC
JLG-1032ccaaaaaactgctgccttcg TCTGCACTCCTTTATCCCTC
JLG-1033cagcgcaagcgcaagcgca ATGACAAGCCCAACCCGCAG
JLG-1034ctggtctgatcggatctctat CCATCTTAACGTTTGCAGGC
JLG-1035ccaaaaaactgctgccttcg CCATCTTAACGTTTGCAGGC
JLG-1036cagcgcaagcgcaagcgca ATGAGGAGAAATAAACCAAAAAAG
JLG-1037ctggtctgatcggatctctat AAGGTTTTGTAAATCAGTGCG
JLG-1038ccaaaaaactgctgccttcg AAGGTTTTGTAAATCAGTGCG
JLG-1039cagcgcaagcgcaagcgca TTGAACATCAAGAAATGTAAACAG
JLG-1040ctggtctgatcggatctctat TGGGTTTTTTCAGTATATTACGC
JLG-1041ccaaaaaactgctgccttcg TGGGTTTTTTCAGTATATTACGC
JLG-1042cagcgcaagcgcaagcgca ATGCGCATTTTCAAAAAAGCAG
JLG-1043ctggtctgatcggatctctat GATCACGGTTAAACTGACCC
JLG-1044ccaaaaaactgctgccttcg GATCACGGTTAAACTGACCC
JLG-1045cagcgcaagcgcaagcgca ATGAAAAAAAGCATAAAGCTTTATG
JLG-1046ctggtctgatcggatctctat CTAATTGTTGGAAGGTTCGAC
JLG-1047ccaaaaaactgctgccttcg CTAATTGTTGGAAGGTTCGAC
JLG-1048cagcgcaagcgcaagcgca ATGAAACGTCTTTTATCCACTTTG
JLG-1049ctggtctgatcggatctctat ATGAATTCCTTCACCGTGAC
JLG-1050ccaaaaaactgctgccttcg ATGAATTCCTTCACCGTGAC
JLG-1312gggttaacgcgtaatccatgACGGATAATCAGCATATCGG
JLG-1313gcctgagcgagggagcagaaGCAGAGGTGAGACAAGTGG
JLG-1314gcgttgaccagtgctccctgcTCTCCAGACCATCTCAAGTG
JLG-1315cacatttccccgaaaagtgcTCAATTCCAACAGAGATTGC
JLG-1330cagcgcaagcgcaagcgcaATGTTTGGAATTGGTGCTAG
JLG-1331ctggtctgatcggatctctatCACCTCTTCTATTGAACTCCC
JLG-1332ccaaaaaactgctgccttcgCACCTCTTCTATTGAACTCCC
JLG-1333cagcgcaagcgcaagcgcaATGTTTGCAAGGGATATTGG
JLG-1334ctggtctgatcggatctctatCCAGTTGTCATATAGGAACGTTC
JLG-1335ccaaaaaactgctgccttcgCCAGTTGTCATATAGGAACGTTC
JLG-1336cagcgcaagcgcaagcgcaATGTTTCAATCAACTGAAATCG
JLG-1337ctggtctgatcggatctctatCTCTTAGCATCTGTTTCCTCC
JLG-1338ccaaaaaactgctgccttcgCTCTTAGCATCTGTTTCCTCC
oER421ttctgctccctcgctcaggcggccgcATGAGAGAGGAAGAAAACGG
oER422cagggagcactggtcaacgctagcAATTGGGACAACTCCAGTG
  1. In capital letters are shown the regions of the primer that anneal to the template. Homology regions for Gibson assembly are shown in italics.

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
    Mechanics of the Cell
    1. D Boal
    (2002)
    Cambridge University Press.
  7. 7
  8. 8
    Wall teichoic acids of gram-positive bacteria
    1. S Brown
    2. JP Santa Maria
    3. S Walker
    (2013)
    Annual Review of Microbiology, 67, 10.1146/annurev-micro-092412-155620, 24024634.
  9. 9
  10. 10
    Synthesis of teichoic acids during spore germination
    1. T Chin
    2. J Younger
    3. L Glaser
    (1968)
    Journal of Bacteriology 95:2044–2050.
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
    Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis
    1. J Errington
    (1993)
    Microbiological Reviews 57:1–33.
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
    Cell wall teichoic acid as a reserve phosphate source in Bacillus subtilis
    1. WD Grant
    (1979)
    Journal of Bacteriology 137:35–43.
  21. 21
  22. 22
  23. 23
  24. 24
    Mechanics of Motor Proteins and the Cytoskeleton
    1. J Howard
    (2001)
    Sinauer Associates.
  25. 25
  26. 26
    Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli
    1. JV Höltje
    (1998)
    Microbiology and Molecular Biology Reviews 62:181–203.
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
    GerM is required to assemble the basal platform of the SpoIIIA-SpoIIQ transenvelope complex during sporulation in Bacillus subtilis
    1. CD Rodrigues
    2. FH Ramírez-Guadiana
    3. AJ Meeske
    4. X Wang
    5. DZ Rudner
    (2016)
    Molecular Microbiology, 102, 10.1111/mmi.13457, 27381174.
  52. 52
    Genetic analysis of Bacillus subtilis spo mutations generated by Tn917-mediated insertional mutagenesis
    1. K Sandman
    2. R Losick
    3. P Youngman
    (1987)
    Genetics 117:603–617.
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
    TrackMate: An open and extensible platform for single-particle tracking
    1. JY Tinevez
    2. N Perry
    3. J Schindelin
    4. GM Hoopes
    5. GD Reynolds
    6. E Laplantine
    7. SY Bednarek
    8. SL Shorte
    9. KW Eliceiri
    (2016)
    Methods, 10.1016/j.ymeth.2016.09.016, 27713081.
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
    BOCILLIN FL, a sensitive and commercially available reagent for detection of penicillin-binding proteins
    1. G Zhao
    2. TI Meier
    3. SD Kahl
    4. KR Gee
    5. LC Blaszczak
    (1999)
    Antimicrobial Agents and Chemotheraphy 43:1124–1128.

Decision letter

  1. Avigdor Eldar
    Reviewing Editor; Tel Aviv University, Israel

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Cell wall remodeling drives engulfment during Bacillus subtilis sporulation" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a guest Reviewing Editor and Naama Barkai as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

We find the manuscript interesting, insightful and well written. The experimental data provide a wealth of novel insights and the synthesis provided by the modeling scheme nicely fit engulfment dynamics of the wild-type and mutant phenotypes. Nevertheless, there are multiple points which need further clarifications both on the experimental and theoretical sides. We therefore recommend acceptance with major revisions that will answer the concerns of the reviewers and the Reviewing Editor.

Overview of the manuscript:

Previous works showed that peptidoglycan (PG) production occur at the leading edge of the engulfing membrane and that this leading edge of the mother-cell (MC) membrane seem to invade below the old cell wall made prior to asymmetric septation (Tocheva et al., 2013). In addition, reduced PG synthesis was also shown to affect engulfment (Meyer et al., 2010). The current work goes beyond the previous works and show that: 1) A block of PG synthesis halts engulfment completely. 2) PG synthesis at the leading edge (LE) is primary guided by PBPs localized to the leading edge at the forespore side. 3) SpoIIP localization to the LE is dependent on PG synthesis.

The authors present a biophysical model of PG synthesis which recapitulates the observed membrane dynamics of wild-type and mutant phenotypes by assuming that PG synthesis from the forespore (FS) is followed by degradation of the links between the old (pre-septation) and new (forespore dependent) PG layers, allowing the MC membrane to fill this gap.

Essential revisions:

The comments are both on the experimental and modeling parts of the manuscript.

Experimental work:

The major requests of the reviewers and the Reviewing Editor are the following:

1) PBP localization. Reviewer #1 expressed concerns regarding the mechanism of localization of PBPs. One of the options is that this localization is guided by other forespore specific proteins which interact with the leading edge. Specifically, as was raised during the discussion, we ask that the localization of PBPs will be studied in mutants of the FS-MC channel composed of spoIIQ, spoIIIAH and GerM.

2) Reviewer #2 suggests that real time monitoring of PBPs processive activity as was done for MreB (Domínguez-Escobar et al., 2011; Garner et al., 2011) would enable direct comparison with the model predictions.

Modeling:

The mathematical model has multiple underlying assumptions. We ask that you will further discuss these assumptions and extend the modeling scheme to further understand which of those is necessary. The major specific concerns raised are:

1) How does the model fit to the Gram positive envelope with its multiple layers, the presence of techioic acid and the unclear arrangement of PG strands (Reviewer #1)? Specifically, the model is very different than the one presented in Nguyen et al., 2015. Can the authors discuss these differences?

2) Discuss and simulate the validity of the assumption that the forespore-dependent synthesis of PG results in a difference between the new and old PG structure that enable specific breakage of the connecting peptide bond (Reviewer #1 and Reviewing Editor).

3) The presence of a tight insertion-degradation complex (IDC) is speculative. Compare simulation results of tight IDC activity (shown now) with simulations where synthesis and degradation are not coupled into a complex but are more weakly associated (as in Figure 2G).

4) Further illuminate the functional importance of the 'make before break' model for this process (see further elaboration of this point below in the section "Comments on modeling raised during discussion").

Comments on modeling raised during discussion:

1) 'Make before break' and cell wall integrity. It is not clear to me whether the make before break process in the model is really needed for maintaining cell-wall integrity, as the model anyway assumes that the DMP complex is not effective in breaking the old cell wall and therefore does not jeopardize its integrity. It seems to me that the 'make' part is only necessary to ensure the specificity of the 'break' part. That is, to ensure that a forespore specific layer will be produced that allows the specific degradation of its connections with the old pre-forespore layer above it.

2) "Make just before break" vs. "make before break". Is localization to the LE critical or just more economic? It is not clear to me that the process would not have worked if the new layer would have been produced everywhere and then hydrolyzed specifically at the LE. It would be illuminating to see a simulation where it is assumed that there is no localization and the difference between cases discussed.

3) The role of the DMP complex in the simulations. The simulations seem only to show the making of the forespore inner layer of PG, but does not say anything about the interaction between this layer and the old layer and the corresponding mechanism of degradation of links between the two layers by the DMP complex. In effect, it seems that the DMP complex has no role in the IDC in the simulation. This might be OK, if one assumes that there is an IDC, but the authors claim in the Discussion that similar behavior would be observed if the two are not tightly linked. Can the authors present a more general model where spatial association is not tight (as shown in Figure 2G and discussed in the Discussion section)?

Reviewer #1:

The manuscript by Ojkic et al. presents a wealth of data on the mechanisms of endosporulation in Bacillus subtilis. In particular, they used fluorescence microscopy to observe the process of engulfment in the presence and absence of drugs inhibiting peptidoglycan synthesis. The data confirm previous studies concluding that both, peptidoglycan synthesis and hydrolysis are needed for membrane migration during engulfment. Multiple PBPs localized to the leading edge of engulfment. They present a model of how a biosynthetic complex and hydrolytic enzymes together facilitate engulfment by remodelling the peptidoglycan layer. Although a lot of data are presented in this impressive work I do have problems with the modelling. In my view the modelling goes too far and is quite speculative. Key aspects of the model are not supported by experimental data.

My specific points are as follows:

1) Introduction, statement about the "Gram-negative like PG layers in Bacillus subtilis" and modelling of the peptidoglycan. The architecture of PG is still a matter of debate, most data are available for E. coli and these support a single disordered layer made of relatively short glycan chains connected by peptide cross-links. However, although the Jensen lab hypothesized based on cryo-EM imaging that Gram-positive species stack multiple of such layers, there is not really good evidence that this model is correct. Other models have been proposed for example the one presented in Nguyen et al., 2015, which is quoted only for the glycan chain length but not for the Bacillus peptidoglycan model. The model presented in Nguyen et al., 2015 presents a more complicated arrangement of glycan chain bundles and was based on AFM images (Foster lab). The peptidoglycan from B. subtilis has significantly longer glycan chains than that from E. coli, and in B. subtilis the peptidoglycan is loaded with a significant amount of wall teichoic acid. Hence, we currently do not know the precise architecture of the peptidoglycan-wall teichoic acid in B. subtilis. The model presented here for the peptidoglycan architecture at the site of engulfment cannot be tested with any current technology and has therefore limited value.

2) Subsection “PG synthesis is essential for membrane migration”, first paragraph. Because fosfomycin and D-cycloserine failed to completely block polar division, they concluded that peptidoglycan might be obtained by recycling during starvation conditions. However, this is a quite speculative assumption which does not seem to be logical, because recycling requires peptidoglycan turnover, which occurs to significant extent only in growing bacteria. Does the mother cell grow during asymmetric septation, or where would the recycling material come from?

3) Discussion, first paragraph. It is not clear what is meant by the 'unique chemical composition of the peptide bridges' that are recognized by DMP. This would imply that the same PBPs, which were found at the leading edge of engulfment and which synthesize the peptidoglycan of the lateral wall or septum during vegetative growth, produce peptide bridges with different composition when they are active during engulfment. This is a highly speculative assumption.

4) Discussion, second paragraph. The PG-insertion-degradation complex (IDC). This is another speculation that is not based on evidence, as they do not present any interaction data between the different peptidoglycan enzymes (PBPs and hydrolases) and other engulfment proteins.

Reviewer #2:

The manuscript describes several experimental findings that advance understanding of engulfment during Bacillus sporulation. The new insights are used to formulate a mathematical model that reproduces experimentally observed engulfment phenotypes. Together, the experimental and modeling results are an important contribution since engulfment is crucial for endospore formation but a mechanistic understanding has been lacking.

The main experimental findings are 1) peptidoglycan synthesis appears to be essential for migration of the leading edge (LE) of the engulfing mother cell membrane and for localization of SpoIIP (a protein in a peptidoglycan degradation complex) to the LE, based on results obtained with inhibitors of peptidoglycan synthesis, and 2) peptidoglycan-binding proteins (PBPs), which synthesize peptidoglycan, localize to the LE, in most cases only if the PBP is expressed in the forespore. Based on these findings, the authors propose that peptidoglycan synthesis and degradation by forespore PBPs and the mother cell SpoIIP-containing complex, respectively, causes the junction between septal peptidoglycan and the lateral cell wall to move, creating space into which the LE of the mother cell membrane moves by entropic forces.

The authors formulate a model based on the "template mechanism" of vegetative cell growth, in which existing glycan strands serve as a "template" for synthesis and peptide cross-linking of a new glycan strand prior to degradation of "old" peptide cross-links and perhaps some of the "old" glycan strands. Dynamic simulations with the model produce engulfment with timing, and with forespore area and volume, that match the experimental observations. Simulations in which the probability of the modeled "insertion-degradation complex" initiating and continuing polymerization at glycan ends is too low result in asymmetric engulfment, as observed experimentally when inhibitors of peptidoglycan synthesis are added.

I support publication in eLife based on the fundamental biological insight provided, the convincing data, and the excellent presentation which is suitable for a broad audience.

That said, the manuscript could be strengthened as follows:

1) Provide direct evidence for peptidoglycan synthesis at the LE (e.g., using fluorescent D-amino acids). The data do not completely rule out a mechanism involving only degradative remodeling of the lateral cell wall to create the germ cell wall, if the peptidoglycan synthesis inhibitors used unexpectedly inhibit degradation.

2) Track forespore-expressed GFP-PBP fusions (as for GFP fusions to MreB isoforms in Domínguez-Escobar et al., 2011and Garner et al., 2011). If the predicted circumferential motions were observed, and, if it were possible to measure their number and speed, predictions of the modeling made in the last paragraph of Results could be tested.

3) For completeness, do parallel experiments on localization of SpoIID and SpoIIM, to those reported on SpoIIP, since the three proteins are expected to form a complex.

4) Clarify whether the probability of initiating glycan polymerization from an end defect (pdef in subsection “A biophysical model to describe leading edge migration”) is different from the probability of inserting new glycan from an old glycan end and repairing the end defect (prep in Figure 3B legend).

https://doi.org/10.7554/eLife.18657.031

Author response

Essential revisions:

The comments are both on the experimental and modeling parts of the manuscript.

Experimental work:

The major requests of the reviewers and the Reviewing Editor are the following:

1) PBP localization. Reviewer #1 expressed concerns regarding the mechanism of localization of PBPs. One of the options is that this localization is guided by other forespore specific proteins which interact with the leading edge. Specifically, as was raised during the discussion, we ask that the localization of PBPs will be studied in mutants of the FS-MC channel composed of spoIIQ, spoIIIAH and GerM.

We have determined the localization of GFP-PonA and GFP-PbpA produced in the forespore from the spoIIR promoter, in mutants lacking SpoIIQ, SpoIIIAH or GerM. Bright foci coincident with the leading edge of the engulfing membrane are still observed in the three mutant backgrounds, suggesting that the Q-AH transenvelope complex is not required for forespore PBP localization.

To further investigate the localization mechanism, we have examined forespore PBP localization in additional mutant backgrounds. We have used strains lacking SpoIIB or SpoIVFAB, which are required for septal localization of the DMP complex (Aung et al., 2007). GFP-PonA and GFP-PbpA still track the leading edge of the engulfing membrane in both backgrounds. We have also tested PBP localization in mutants lacking SpoIID, SpoIIM and SpoIIP. In these backgrounds, engulfment membrane migration is blocked and the septal membrane bulges towards the mother cell cytoplasm through the middle of the septum. Interestingly, GFP-PonA and GFP-PbpA form bright foci at the intersection between the septum and the lateral cell wall. A similar localization pattern is observed σE- mutants, which lack mother cell-specific gene expression. These results leave two possibilities to explain for the localization of forespore PBPs. First, it is possible that PBPs directly recognize the junction between the septal peptidoglycan and the lateral cell wall, and track it as it moves around the forespore. Second, forespore PBP localization might rely on hitherto unknown forespore-specific factors.

These results are now presented in Figure 2—figure supplement 2 and mentioned in the last paragraph of the subsection “PG biosynthetic machinery tracks the leading edge of the engulfing membrane from the forespore”.

2) Reviewer #2 suggests that real time monitoring of PBPs processive activity as was done for MreB (Domínguez-Escobar et al., 2011; Garner et al., 2011) would enable direct comparison with the model predictions.

We thank the reviewer for suggesting this experiment. To address this point we have constructed new GFP fusions to the three MreB isoforms in Bacillus subtilis (MreB, Mbl and MreBH), since our GFP-PBP fusions photobleached quickly and were not bright enough to perform tracking experiments. MreB, Mbl and MreBH displayed the same localization pattern that most PBPs, localizing to the LE of the engulfing membrane when produced in the forespore, but not when produced in the mother cell. This data has been incorporated to Figure 2D and Figure 2—figure supplement 1. We have monitored the movement of GFP-MreB specifically produced in the forespore from spoIIQ promoter by TIRF microscopy. Forespore GFP-MreB foci rotate around the forespore, coincident with the leading edge of the engulfing membrane, with speeds equivalent to those determined in vegetative cells (Garner et al., 2011). This data has been incorporated to Figure 2 (Figure 2E), and included in a new video (Video 2). The results are explained in the first paragraph of the subsection “PG biosynthetic machinery tracks the leading edge of the engulfing membrane from the forespore”, and we made reference to them in the last paragraph of the Results section, and in the Discussion section.

Modeling:

The mathematical model has multiple underlying assumptions. We ask that you will further discuss these assumptions and extend the modeling scheme to further understand which of those is necessary. The major specific concerns raised are:

1) How does the model fit to the Gram positive envelope with its multiple layers, the presence of techioic acid and the unclear arrangement of PG strands (reviewer #2)? Specifically, the model is very different than the one presented in Nguyen et al., 2015. Can the authors discuss these differences?

Our model deals with the formation of the cell wall that surrounds the spore and the cell wall remodeling at the leading edge, and does not require modeling the precise structure of the outer cell wall. This is now mentioned in the first paragraph of the subsection “A biophysical model to describe leading edge migration”, and allows us to simplify simulations, avoid uncertainties about the structure of the outer cell wall, and focus on the essential aspects of engulfment. Our template mechanism is easiest to envision if the glycan strands spiral in loops around the long axis of the cell similar to Gram-negative cell wall since enzymes have tracks to move on (similar to how MreB move; in fact, through the working of the cell-wall remodeling enzymes we essentially predict this cell-wall structure.) However, the model that the lateral cell wall is organized in bundles of PG strands (Hayhurst et al., (2008), Ref. 39) is also compatible with our model, since the cables could still provide tracks for the movement of the PG biosynthetic machinery. Thus, due to the ongoing uncertainty in the cell-wall structure of B. subtilis, we decided to remove the phrase “multiple layers of Gram-negative-like PG“. We also now point out that unlike the Gram-negative cell wall, the Gram-positive cell wall contains significant amounts of teichoic acids in the Introduction (third paragraph). However, because wall-teichoic acids are largely absent in spores [Chin et al.,1968; Johnstone et al., 1982] (Chin, Younger and Glaser, 1968; Johnstone, Simion and Ellar, 1982) and teichoic acids are not required for engulfment (JLG and KP unpublished data), we do not consider them in our model.

The model in Nguyen et al., 2015 represents a detailed molecular-level simulation (although coarse-grained) of cell-wall growth in vegetative Gram-negative bacteria (E. coli). The overlap is that as in model of Laporte et al., 2012 the local enzymatic coordination is enough to explain micro scale PG transformations. However, we only used the PG elastic parameter from their molecular dynamic simulations (kgly and kpep, see Figure 4). We added clarifying comments in the section on “Langevin simulations reproduce observed phenotypes”.

2) Discuss and simulate the validity of the assumption that the forespore-dependent synthesis of PG results in a difference between the new and old PG structure that enable specific breakage of the connecting peptide bond (Reviewer #1 and Reviewing Editor).

Our model already postulates that DMP specifically targets peptide cross links joining new and old PG. We now discuss the two main possible explanations for how the peptide crosslinks joining the newly synthesized septal peptidoglycan and the lateral cell walls could be specifically recognized based on architectural and chemical features (see Discussion section):

DMP might recognize the junction between the septal PG and the lateral PG based on some specific feature of the PG architecture at this site, such as having a peptide bond/glycan strand projecting into a different plane than the rest of the PG. We simulated the possibility that PG degradation also cuts penultimate peptide connections (peptide connections in different planes) with probability ppcut (Figure 4—figure supplement 5C-D). For relatively small ppcut = 0.1 an irregular peptidoglycan meshwork is formed. Even more, since antibiotic treatment dislocates DMP degradation machinery (Figure 2E-F, Figure 2—figure supplement 3) we explored the possibility that dislocated DMP randomly cuts old germ cell wall peptides with constant degradation rate prpep. In this scenario, the irregular peptidoglycan network protrudes towards the mother cell with apparent volume increase while the leading edge remains still (Figure 4—figure supplement 5E-F).

3) The presence of a tight insertion-degradation complex (IDC) is speculative. Compare simulation results of tight IDC activity (shown now) with simulations where synthesis and degradation are not coupled into a complex but are more weakly associated (as in Figure 2G).

Thank you for this suggestion. We implemented simulations without a tight IDCs, in which DMP degrades junctional peptide bonds between old outer cell wall and newly synthesized germ cell wall with a slight time delay after new PG is made (explained in supplementary information with results shown in Figure 4—figure supplement 5A, B, Video 6). As long as DMP does not make significant amounts of errors in terms of degrading accidentally either the outer cell wall or the septal peptidoglycan (Figure 4—figure supplement 5C, D), this mechanism supports engulfment as well as that synthesis and degradation are tightly coupled. We comment on these important new results in the Discussion section.

4) Further illuminate the functional importance of the 'make before break' model for this process (see further elaboration of this point below in the section "Comments on modeling raised during discussion").

We clarified this point in response to the next question and in the Discussion (fourth paragraph).

Comments on modeling raised during discussion:

1) 'Make before break' and cell wall integrity. It is not clear to me whether the make before break process in the model is really needed for maintaining cell-wall integrity, as the model anyway assumes that the DMP complex is not effective in breaking the old cell wall and therefore does not jeopardize its integrity. It seems to me that the 'make' part is only necessary to ensure the specificity of the 'break' part. That is, to ensure that a forespore specific layer will be produced that allows the specific degradation of its connections with the old pre-forespore layer above it.

This is a good point. As the reviewers point out, during engulfment, the primary contributions of the ‘make before break’ principle might well be to confer directionality to membrane migration by producing a forespore specific substrate for the mother cell enzymes that degrade PG (DMP) and by ensuring the robust attachment of the septal cell wall to the lateral cell wall. We have clarified this point in the Discussion section.

2) "Make just before break" vs. "make before break". Is localization to the LE critical or just more economic? It is not clear to me that the process would not have worked if the new layer would have been produced everywhere and then hydrolyzed specifically at the LE. It would be illuminating to see a simulation where it is assumed that there is no localization and the difference between cases discussed.

As described in response to item 3 of essential revisions, we conducted simulations where DMP degrades specific junctional peptide bonds with a delay. Indeed, as long as these bonds are clearly labeled as DMP substrate, such degradation could occur after the new cell wall fully encloses the forespore. However, bacterial cells recycle peptidoglycan fragments produced during growth and this might be particularly important during starvation – making a large amount of PG without recycling might constitute a major energetic burden. Hence, one could consider naming this a “make just before break” model, and we discuss this now in the Discussion section (fourth paragraph).

3) The role of the DMP complex in the simulations. The simulations seem only to show the making of the forespore inner layer of PG, but does not say anything about the interaction between this layer and the old layer and the corresponding mechanism of degradation of links between the two layers by the DMP complex. In effect, it seems that the DMP complex has no role in the IDC in the simulation. This might be OK, if one assumes that there is an IDC, but the authors claim in the Discussion that similar behavior would be observed if the two are not tightly linked. Can the authors present a more general model where spatial association is not tight (as shown in Figure 2G and discussed in the Discussion section)?

In our model, we assume only that the peptide cross-link between the old and new cell wall is removed according to our schematic Figure 3 by DMP. We discuss this point in the text, acknowledging more complicated versions (see Figure 3—figure supplement 1) in which the entire junctional strand is removed (peptide and glycan), and we have extended Figure 3B to show these cross-links. As discussed above, we also include a model that lacks tightly coupled IDCs to support this point.

Reviewer #1:

[…] Although a lot of data are presented in this impressive work I do have problems with the modelling. In my view the modelling goes too far and is quite speculative. Key aspects of the model are not supported by experimental data.

My specific points are as follows:

1) Introduction, statement about the "Gram-negative like PG layers in Bacillus subtilis" and modelling of the peptidoglycan. The architecture of PG is still a matter of debate, most data are available for E. coli and these support a single disordered layer made of relatively short glycan chains connected by peptide cross-links. However, although the Jensen lab hypothesized based on cryo-EM imaging that Gram-positive species stack multiple of such layers, there is not really good evidence that this model is correct. Other models have been proposed for example the one presented in Nguyen et al., 2015, which is quoted only for the glycan chain length but not for the Bacillus peptidoglycan model. The model presented in Nguyen et al., 2015 presents a more complicated arrangement of glycan chain bundles and was based on AFM images (Foster lab). The peptidoglycan from B. subtilis has significantly longer glycan chains than that from E. coli, and in B. subtilis the peptidoglycan is loaded with a significant amount of wall teichoic acid. Hence, we currently do not know the precise architecture of the peptidoglycan-wall teichoic acid in B. subtilis. The model presented here for the peptidoglycan architecture at the site of engulfment cannot be tested with any current technology and has therefore limited value.

We acknowledge the ongoing uncertainty about the organization of the B. subtilis lateral cell wall, and we have removed the “Gram-negative like PG layers” statement in the Introduction (see response to the first question of “Essential reviews of modelling” for more details). It is important to note that our model deals with the movement of the junction between the septal peptidoglycan and the lateral cell wall around the forespore and it does not depend on knowing the precise architecture of the lateral cell wall. We modeled the extended septal peptidoglycan as a single peptidoglycan layer since it is only 2 nm thick (Tocheva et al., 2013), and hence cannot accommodate 50 nm wide cables.

The model only depends on B. subtilis cells being able to produce septa at various places along the lateral cell wall in addition to midcell, as is supported by the variable locations of septa in the minCD and DivIVA mutants (Gregory and Pogliano, 2009; Edwads and Errington, 1997). Thus, as long as docking sites are available to make new connections between the septal PG and the lateral cell wall, the specific architecture of the lateral cell wall is irrelevant for our model. We did not include teichoic acids in the model since they are absent in spores (Chin et al., 1968; Johnstone et al.1982).

In our opinion, the model has intrinsic value because it easily conceptualizes how cells could move the engulfing membrane around the forespore, by simply moving the junction between the septum and the lateral wall using known enzymatic activities. As a result, the model has predictive value, even if it ultimately must be revised to accommodate new data concerning the architecture of PG. Emerging experimental techniques, such as FIB-CryoEM, subtomogram averaging, and single molecule tracking have the potential to provide new insight into the specific organization of the peptidoglycan at the leading edge of the engulfing membrane and constitute a powerful direction of future research. We added this to the future outlook at the end of the Discussion section.

2) Subsection “PG synthesis is essential for membrane migration”, first paragraph. Because fosfomycin and D-cycloserine failed to completely block polar division, they concluded that peptidoglycan might be obtained by recycling during starvation conditions. However, this is a quite speculative assumption which does not seem to be logical, because recycling requires peptidoglycan turnover, which occurs to significant extent only in growing bacteria. Does the mother cell grow during asymmetric septation, or where would the recycling material come from?

We thank this reviewer for raising this interesting point. It is important to note that during sporulation, some cells are still growing and dividing, which may release PG precursors into the culture that could be used by sporulating cells. In addition, the continued polar septation of antibiotic-treated cells might be supported by PG that is released by lysis of non-sporulating cells in the culture either via the SDP toxin [Gonzalez-Pastor JE et al., Science 301, 510 (2003); Straight PD, Kolter R, Annu Rev Microbiol 63, 99 (2009), Lamsa A et al. Mol Micobiol 84, 486 (2012)] or due to antibiotic treatment, since fosfomycin and D-cycloserine treated cells also lyse (Lamsa et al., 2016). Engulfment might require much less PG than cell division, in which case SpoIIDMP activity might provide enough material.

3) Discussion, first paragraph. It is not clear what is meant by the 'unique chemical composition of the peptide bridges' that are recognized by DMP. This would imply that the same PBPs, which were found at the leading edge of engulfment and which synthesize the peptidoglycan of the lateral wall or septum during vegetative growth, produce peptide bridges with different composition when they are active during engulfment. This is a highly speculative assumption.

We provide details about this in the second point of the “Essential revisions of modeling”, and have clarified the text.

4) Discussion, second paragraph. The PG-insertion-degradation complex (IDC). This is another speculation that is not based on evidence, as they do not present any interaction data between the different peptidoglycan enzymes (PBPs and hydrolases) and other engulfment proteins.

We have conducted new simulations in which PG synthesis and degradation are uncoupled. Additional details can be found in the third item of “Essential revision of modeling”, and we have clarified the text.

Reviewer #2:

[…] I support publication in eLife based on the fundamental biological insight provided, the convincing data, and the excellent presentation which is suitable for a broad audience.

That said, the manuscript could be strengthened as follows:

1) Provide direct evidence for peptidoglycan synthesis at the LE (e.g., using fluorescent D-amino acids). The data do not completely rule out a mechanism involving only degradative remodeling of the lateral cell wall to create the germ cell wall, if the peptidoglycan synthesis inhibitors used unexpectedly inhibit degradation.

Thank you for clarifying this issue in the discussion between editors and reviewers. Indeed, the Pogliano lab studied PG synthesis by fluorescent D-amino acids and fluorescently labeledantibiotics that reveal PG precursor localization, and we here extend this study to the localization of individual PBPs and to the penicillin V derivative bocillin-FL as explained in the subsection “PBPs accumulate at the leading edge of the engulfing membrane” (Tocheva et al., 2013; Reith and Meyer, 2011).

2) Track forespore-expressed GFP-PBP fusions (as for GFP fusions to MreB isoforms in Domínguez-Escobar et al., 2011and Garner et al., 2011). If the predicted circumferential motions were observed, and, if it were possible to measure their number and speed, predictions of the modeling made in the last paragraph of Results could be tested.

Thank you for suggesting this experiment. We have tracked GFP-MreB specifically produced in the forespore after polar septation. Please, see the response to the second “Essential revision of experimental work” for details.

3) For completeness, do parallel experiments on localization of SpoIID and SpoIIM, to those reported on SpoIIP, since the three proteins are expected to form a complex.

4) Clarify whether the probability of initiating glycan polymerization from an end defect (pdef in subsection “A biophysical model to describe leading edge migration”) is different from the probability of inserting new glycan from an old glycan end and repairing the end defect (prep in Figure 3B legend).

We have determined the localization of GFP-SpoIID and GFP-SpoIIM in sporangia treated with cephalexin and bacitracin. In both cases the fusion proteins delocalized upon antibiotic treatment, similar to GFP-SpoIIP, although neither protein localizes as well as SpoIIP. Those results have been included in Figure 2—figure supplement 3. We now consistently use ppro and prep (as defined in Figure 3). We thank reviewer for pointing to this.

https://doi.org/10.7554/eLife.18657.032

Article and author information

Author details

  1. Nikola Ojkic

    1. Department of Life Sciences, Imperial College London, London, United Kingdom
    2. Centre for Integrative Systems Biology and Bioinformatics, Imperial College London, London, United Kingdom
    Contribution
    NO, Modeling and simulations, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    Contributed equally with
    Javier López-Garrido
    Competing interests
    The authors declare that no competing interests exist.
  2. Javier López-Garrido

    Division of Biological Sciences, University of California, San Diego, La Jolla, United States
    Contribution
    JL-G, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Contributed equally with
    Nikola Ojkic
    Competing interests
    The authors declare that no competing interests exist.
  3. Kit Pogliano

    Division of Biological Sciences, University of California, San Diego, La Jolla, United States
    Contribution
    KP, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    kpogliano@ucsd.edu
    Competing interests
    The authors declare that no competing interests exist.
  4. Robert G Endres

    1. Department of Life Sciences, Imperial College London, London, United Kingdom
    2. Centre for Integrative Systems Biology and Bioinformatics, Imperial College London, London, United Kingdom
    Contribution
    RGE, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    r.endres@imperial.ac.uk
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1379-659X

Funding

European Research Council (280492-PPHPI)

  • Nikola Ojkic
  • Robert G Endres

European Molecular Biology Organization (ATLF1274-2011)

  • Javier López-Garrido

National Institutes of Health (R01-GM57045)

  • Kit Pogliano

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work is supported by European Research Council Starting Grant 280492-PPHPI to NO and RGE, EMBO Long Term Fellowship to JLG, National Institutes of Health R01-GM57045 to KP. We thank the Microscopy Core at UC San Diego (P30 NS047101) for help in using the Applied Precision OMX Structured Illumination microscopy used for TIRF experiments. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Reviewing Editor

  1. Avigdor Eldar, Tel Aviv University, Israel

Publication history

  1. Received: June 10, 2016
  2. Accepted: November 14, 2016
  3. Accepted Manuscript published: November 17, 2016 (version 1)
  4. Version of Record published: December 8, 2016 (version 2)

Copyright

© 2016, Ojkic et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,488
    Page views
  • 410
    Downloads
  • 11
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Computational and Systems Biology
    2. Developmental Biology
    Inna Averbukh et al.
    Research Article
    1. Computational and Systems Biology
    2. Neuroscience
    Dilawar Singh, Upinder Singh Bhalla
    Research Article Updated