Insights into the molecular architecture and histone H3-H4 deposition mechanism of yeast Chromatin assembly factor 1
- European Molecular Biology Laboratory, France
- CEA, DRF, SB2SM, Laboratoire de Biologie Structurale et Radiobiologie, France
- Université Paris-Sud, France
- Institut Curie, PSL Research University, CNRS, UMR3664, Equipe Labellisée Ligue contre le Cancer, France
- Sorbonne Universités, UPMC Univ Paris 06, CNRS, UMR3664, France
- Université Grenoble Alpes, Institut de Biologie Structurale (IBS), France
- Commissariat à l'Energie Atomique et aux Energies Alternatives (CEA), France
- Deutsches Krebsforschungszentrum, Germany
Figures
Figure 1 with 2 supplements
Domain architecture and purification of yCAF1.
(A) Domain architecture of Cac1, Cac2 and Cac3 with K/E/R domain containing a predicted coiled-coil segment; PIP, PCNA interacting peptide; E/D, acidic domain; WHD, winged helix domain; WD40-repeat …
Figure 1—figure supplement 1
Structural and biochemical characterization of yCAF1 complexes.
(A) Coiled-coil and disorder probability as determined by COILS and Disopred3, respectively. Domain arrangements of Cac1, Cac2 and Cac3 are shown below. (B) Limited proteolysis using chymotrypsin …
Figure 1—figure supplement 2
MS analysis of yCAF1-H3-H4 and H3-H4.
(A) Tandem MS spectrum of the 32+ ion of yCAF1-H3-H4. The 32+ ion population of yCAF1-H3-H4 was subjected to collision-induced dissociation (CID). This experiment broke the complex into subcomplexes …
Figure 2 with 1 supplement
yCAF1 binds a single H3-H4 heterodimer.
(A) Sedimentation velocity analytical ultracentrifugation of the yCAF1 complex. (B) yCAF1-H3-H4. Shown is the plot of the sedimentation coefficient distribution at different protein concentrations. …
Figure 2—figure supplement 1
Analytical ultracentrifugation of yCAF1 complexes.
(A) Sedimentation equilibrium analytical ultracentrifugation of yCAF1. Shown is the plot of the concentration of 3.2 μM yCAF1 as a function of the radial distance after reaching equilibrium at 7.000 …
Figure 3 with 1 supplement
yCAF1 binding to DNA.
(A) Left panel: Binding curves of yCAF1 variants to 147 bp DNA. Right panels: EMSA showing binding of yCAF1 variants to 147 bp DNA. Free DNA and yCAF1-bound (B) DNA are indicated. Wells (W) are …
Figure 3—figure supplement 1
Analysis of nucleosome binding by yCAF1.
(A) Anion exchange chromatography of yCAF1 (first peak) revealing a histone-DNA contaminant in the yCAF1 preparation from Trichoplusia ni insect cells (second peak). The identity of all four Trichopl…
Figure 4 with 2 supplements
yCAF1 deposition of H3-H4.
(A) EMSA showing tetrasome deposition on 84 bp DNA. Increasing amounts of yCAF1-H3-H4 (0.15, 0.3, 0.61, 1.25, 2.5, 5 or 10 μM) were mixed with 1 μM 84 bp DNA and the bands resolved by native PAGE. …
Figure 4—figure supplement 1
EMSA analysis of H3-H4 deposition.
(A) EMSA showing H3-H4 deposition by yCAF1T. (B) yCAF1U. (C) yCAF1X.
Figure 4—figure supplement 2
EMSA analysis of H3-H4 deposition.
(A) EMSA showing tetrasome and (B) disome assembly controls. The position of migration of the dimsome, tetrasome and free DNA are indicated. The gels were stained with SYBR Safe or Coomassie stain …
Figure 5 with 1 supplement
DNA-binding of yCAF1 is required for DNA synthesis-coupled nucleosome assembly.
(A) Nucleosome assembly reactions with either non-UV-treated plasmid (pBS0) or plasmid irradiated with UV (pBSuv) in presence of [α−32P]. After an incubation time of 5 or 180 min, DNA was extracted, …
Figure 5—figure supplement 1
Depletion of Xenopus p150 from HSE.
(A) p150- or mock-depleted HSEs were analyzed by Western blotting using the indicated antibodies. (B) Nucleosome assembly reactions with 300 ng of pBSuv plasmid and 50 or 100 ng of yCAF1 variants …
Figure 6
Competition of yCAF1 with yAsf1 or Mcm2 for H3-H4 binding.
SEC-MALLS analysis of complexes formed upon mixing of up to three histone chaperones with H3-H4. In all experiments, lines correspond to the UV280nm traces of the eluting complex. Dots correspond to …
Figure 7
Model for yCAF1 recruitment and H3-H4 deposition.
Free monomeric yCAF1 (step 1) is loaded with dimeric H3-H4 through association of yAsf1 with the Cac2 subunit. Alternatively, loading can occur through hand over of H3-H4 from Mcm2 (step 2). yCAF1 …
Author response image 1
Author response image 2
Author response image 3
Tables
Table 1
Overall biophysical parameters of yCAF1. Column labeling: SEC-MALLS (Size-exclusion chromatography - multi-angle laser light scattering); EQ-AUC (equilibrium analytical ultracentrifugation); SV-AUC …
| Sec-malls | Eq-auc | Sv-auc | SAXS | SAXS | SAXS | SAXS | SAXS | Native MS | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sample | MMSLS kDa (CSLS, µM) | MMAUC kDa | sth Svedberg | s020,w Svedberg | Rg nm (CSAXS mg·ml−1) | MMSAXS kDa | Dmax nm | Vp nm3 | Resolution Å | MMMS kDa (CMS µM) | MMth kDa |
| yCAF1 | 172.4 ± 1% (67) | 180 ± 10 | 6.2 | 6.41 ± 0.03 | 6.39 ± 0.22 (11.4) | 175 ± 3 | 26 ± 2 | 307 ± 5 | 57 ± 4 | 174.49 ± 0.30 (2.5) | 174.0 |
| yCAF1-H3-H4 | 198.9 ± 1.1% (50) | 200 ± 11 | 7.1 | 6.84 ± 0.06 | 6.02 ± 0.35 (10) | 203 ± 13 | 25 ± 2 | 355 ± 23 | 54 ± 4 | 201.00 ± 0.01 (7) | 200.7 |
| yCAF1T | 142 ± 1% (15) | N.D. | N.D. | N.D. | 5.66 ± 0.03 (30.0) | 127 ± 1 | 20 ± 1.2 | 222 ± 2 | 49 ± 4 | N.D. | 146.8 |
| yCAF1T-H3-H4 | 153 ± 1% (15) | N.D. | N.D. | N.D. | 5.10 ± 0.03 (13.2) | 163 ± 1 | 17.3 ± 1.3 | 285 ± 2 | 52 ± 4 | N.D. | 173.6 |
Table 2
Summary of SEC-MALLS data for yCAF1 variants. Column labeling: SEC-MALLS (Size-exclusion chromatography - multi-angle laser light scattering); MMSLS (Molar masses determined by SEC-MALLS); MMth …
| Sample | MMSLS kDa (CSLS, µM) | MMth kDa |
|---|---|---|
| yCAF1U | 166 ± 1.1% (20) | 161.4 |
| yCAF1U-H3-H4 | 184 ± 1% (20) | 188.2 |
| yCAF1V | 133 ± 1.2% (20) | 134.4 |
| yCAF1V-H3-H4 | 156 ± 1.1% (20) | 161.2 |
| yCAF1X | 143 ± 1% (15) | 147.2 |
| yCAF1X-H3-H4 | 160 ± 1% (15) | 174.0 |
Table 3
Summary of native mass spectrometry.
| Protein sample | Concentration (μM) | Oligomerization state | Measured mass ± error (Da)* | Calculated mass (Da) |
|---|---|---|---|---|
| yCAF1 | 2.5 | Cac1:Cac2:Cac3 | 174 492 ± 3 | 173965.1 |
| yCAF1 | 2.5 | Cac1:Cac3 | 123 927 ± 5 | 120735 |
| yCAF1 | 2.5 | Cac2:Cac3 | 103 840 ± 4 | 103755.1 |
| yCAF1 | 2.5 | Cac2 | 53 273 ± 6 | 53230.1 |
| yCAF1 | 2.5 | Cac3 | 50 568 ± 7 | 50525 |
| yCAF1-H3-H4 | 7 | Cac1:Cac2:Cac3:H3:H4 | 201 002 ± 5 | 200 720.3 |
| yCAF1-H3-H4 | 7 | Cac2:Cac3:H3:H4 | 130 343 ± 7 | 130510.4 |
| H3-H4 | 10† | (H3-H4)2 | 53 015 ± 4 | 53510.6 |
| H3-H4 | 10† | H3-H4 | 26 508 ± 2 | 26755.3 |
| H3-H4 | 10† | H3 | 15 271 ± 2 | 15388 |
| H3-H4 | 10† | H4 | 11236 ± 3 | 11367.3 |
-
*Values reported represent the mean value ± standard deviation according to (McKay et al., 2006). Combinations of neighboring m/z values were used to determine distinct M values of a macromolecule. Using these values, a mean value of M and its standard deviation were calculated.
-
†Values reported assume that H3-H4 are tetrameric in solution.
Table 4
DNA binding by yCAF1.
| Protein sample | DNA substrate | KD [μM] * | Hill coefficient |
|---|---|---|---|
| yCAF1 | 147 bp | 2.1 ± 0.1 | 2.0 ± 0.4 |
| 84 bp | 2.3 ± 0.3 | 2.2 ± 0.3 | |
| 42 bp | 2.5 ± 0.5 | 2.2 ± 0.4 | |
| 17 bp | 5.1 ± 1.0 | 1.3 ± 0.2 | |
| yCAF1U | 147 bp | 4.1 ± 1.9 | 4.3 ± 5.8 |
| yCAF1V | 147 bp | >10 | N.D. |
| yCAF1X | 147 bp | 5.7 ± 1. 7 | 2.9 ± 0.6 |
| yCAF1T | 147 bp | >10 | N.D. |
-
*Values determined from experiments using the 147, 84, 42 or 17 bp DNA fragment. Errors, where reported, correspond to the SEM value of three technical replicates.
Table 5
Sequence information on 10 bp DNA ladder (Promega). AT content (%) for all DNA fragments is 60%.
| Length (bp) | Sequence |
|---|---|
| 10 | GGACTATACT |
| 20 | GGACTATACTAGACATTGAC |
| 30 | GGACTATACTAGACATTGACGTGGTTGTAA |
| 40 | GGACTATACTAGACATTGACGTGGTTGTAAGATGATCATG |
| 50 | GGACTATACTAGACATTGACGTGGTTGTAAGATGATCATGTGTTAATGGC |
| 60 | GGACTATACTAGACATTGACGTGGTTGTAAGATGATCATGTGTTAATGGCAAGGTGAGTT |
| 70 | CATGATCATCTTACAACCACGTCAATGTCTAGTATAGTCCTACTCTGTGATATGGTTCTCTGTCGATGTA |
| 80 | GCCATTAACACATGATCATCTTACAACCACGTCAATGTCTAGTATAGTCCTACTCTGTGATATGGTTCTCTGTCGATGTA |
| 90 | AACTCACCTTGCCATTAACACATGATCATCTTACAACCACGTCAATGTCTAGTATAGTCCTACTCTGTGATATGGTTCTCTGTCGATGTA |
| 100 | ATGATCATCTAACTCACCTTGCCATTAACACATGATCATCTTACAACCACGTCAATGTCTAGTATAGTCCTACTCTGTGATATGGTTCTCTGTCGATGTA |
Table 6
Summary of SEC-MALLS data. Column labeling: Ve (elution Volume); MMSLS (Molar masses determined by SEC-MALLS); MMth (theoretical molar mass calculated). When there are more than two proteins in the …
| Peak 1 | Peak 2 | Peak 3 | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Sample | Ve (ml) | MMsls (kDa) | MMth (kDa) | Ve (ml) | MMsls (kDa) | MMth (kDa) | Ve (ml) | MMsls (kDa) | MMth (kDa) |
| yCAF1 | 9.96 | 172.1 ± 0.1 | 174.0 | – | – | – | – | – | – |
| yCAF1 + yAsf1 | 9.96 | 171.1 ± 0.6 | 174.0 | 12.91 | 38.6 ± 0.2 | 31.6 | – | – | – |
| yCAF1 + yAsf1 + H3 H4 | 10.00 | 185.3 ± 0.1 | 200.7 | 12.85 | 64.3 ± 0.2 | 58.3 | – | – | – |
| yCAF1 + yAsf1-H3-H4 1 :5 | 9.98 | 192.9 ± 0.2 | 200.7 | 12.88 | 60.1 ± 0.1 | 58.3 | – | – | – |
| yAsf1 | – | – | – | 12.96 | 36.3 ± 0.1 | 31.6 | – | – | – |
| yAsf1 + H3 H4 | – | – | – | 12.86 | 58.7 ± 0.2 | 58.3 | – | – | – |
| yCAF1 + MCM2 | 9.95 | 174.1 ± 0.7 | 174.0 | – | – | – | 14.32 | 19.1 ± 0.5 | 17.6 |
| yCAF1 + MCM2 + H3 H4 | 9.97 | 185.9 ± 0.1 | 200.7 | – | – | – | – | – | – |
| yCAF1 + MCM2-H3-H4 1 :5 | 9.98 | 190.5 ± 0.7 | 200.7 | 12.09 | 90.8 ± 0.4 | 71.0 | – | – | – |
| MCM2 | – | – | – | – | – | – | 14.32 | 18.8 ± 0.1 | 17.6 |
| MCM2 + H3 H4 | – | – | – | 12.16 | 82.6 ± 0.4 | 71.0 | – | - | – |
| yCAF1 + H3 H4 | 9.97 | 191.3 ± 0.4 | 200.7 | – | – | – | – | – | – |
| yCAF1 + yAsf1+Mmc2 + H3 H4 | 10.05 | 188.8 ± 0.9 | 200.7 | 12.79 | 67.5 ± 0.1 | 75.9 | 14.38 | 27.4 ± 0.1 | 17.6 |
