Regulation of localization and function of the transcriptional co-activator YAP by angiomotin
- The Scripps Research Institute, United States
- Klinikum rechts der Isar, Technische Universität München, Germany
Figures
Figure 1
YAP associates with Merlin in the nucleus and cytoplasm.
Co-immunoprecipitation of YAP and Merlin. (A) HEK293 or (B) hSC2λ cells were co-transfected with expression plasmids for HA-Merlin or Flag-Merlin and V5-YAP. Total cell lysates (Input) and HA, Flag, …
Figure 2 with 2 supplements
YAP and Merlin association is dependent on Amot-p130.
(A) HEK293 cells stably infected with lentiviral vectors encoding a control shRNA (shCtr) or shRNA targeting Amot (shAmot) were co-transfected with expression plasmids for HA-Merlin and V5-YAP. …
Figure 2—figure supplement 1
YAP and Merlin association is dependent on Amot-p130.
HEK293 cells were co-transfected with siRNA targeting Amot (siAMOT) or non-targeting control (siCtrl) and expression plasmids for HA-Merlin and V5-YAP. (A) Merlin was IP’ed with anti-HA antibody and …
Figure 2—figure supplement 2
YAP/Merlin complex require Amot-p130 PPxY and LPxY motifs.
HEK293-shAmot cells were co-transfected with YAP, Flag-Merlin and (A–C) single PY motif mutant Amot-p130 (PY1*, PY2*, or PY3*), (D–E) double PY motif mutant Amot-p130 (PY1 +3* or PY2 +3*), or (F) …
Figure 3 with 3 supplements
Phosphorylation status of Amot-p130S176 does not impact formation of the Amot/YAP/Merlin complex.
HEK293-shAmot cells were co-transfected with expression plasmids for Flag-Merlin, V5-YAP, and (A) HA-Amot-WT (B) HA-Amot-p130S176A or (C) HA-Amot-p130S176E. Total lysates (input) and Flag or V5 IPs …
Figure 3—figure supplement 1
Analysis of exogenous Amot expression levels and distribution.
(A) HEK293-shAmot cells were transfected with expression plasmids for Amot-WT, Amot-p130S176A or Amot-p130S176E. Relative levels of Amot expression were assessed by western blotting with anti-Amot …
Figure 3—figure supplement 2
Phosphorylation of Amot does not impact formation of YAP/Amot-p130 or Merlin/Amot-p130 complexes.
(A–C) HEK293-shAmot cells were co-transfected with V5-YAP and (A) HA-Amot-WT or (B) HA-Amot-p130S176A or (C) HA-Amot-p130S176E. Total lysates (input) and V5 or HA IPs were subjected to immunoblot …
Figure 3—figure supplement 3
Phosphorylation of YapS127 does not impact the formation of the Amot/YAP/Merlin complex.
(A) HEK293 cells were co-transfected with expression plasmids for HA-Merlin and His-tagged constitutively active mutant of YAP (His-YapS127A). Total lysates (input) and His or HA IPs were subjected …
Figure 4 with 2 supplements
Amot-p130S176 shifts localization of the YAP/Merlin complex.
(A) Phosphorylation of Amot-p130 shifts its localization at the plasma membrane. HEK293-shAmot cells were transfected with Amot-WT, Amot-p130S176A or Amot-p130S176E expression plasmids and …
Figure 4—figure supplement 1
Amot phosphorylation regulates the localization of the Amot/YAP complex in human Schwann cells.
(A) Phosphorylation at Serine 176 shifts Amot-p130 localization. hSC2λ cells were transfected with Amot-WT, Amot-p130S176A or Amot-p130S176E expression plasmids and fractionated into cytoplasm (C), …
Figure 4—figure supplement 2
Amot phosphorylation regulates the localization of the Amot/YAP complex in human hepatocellular carcinoma cells.
(A) Phosphorylation at Serine 176 shifts Amot-p130 localization. HepG2 cells were transfected with Amot-WT, Amot-p130S176A or Amot-p130S176E expression plasmids and fractionated into cytoplasm (C), …
Figure 5
AmotS176 status impacts binding to the junctional proteins PATJ, Pals1 and E-cadherin.
HEK293-shAmot cells were co-transfected with Flag-PATJ and (A) HA-Amot-WT or (B) HA-Amot-p130S176A or (C) HA-Amot-p130S176E. Total lysates (Input) and Flag or HA IPs were subjected to immunoblot …
Figure 6 with 3 supplements
AmotS176A promotes the proliferative and transcriptional activities of YAP.
(A) AmotS176 regulates cellular proliferation. HEK293-shAmot cells were transiently transfected with indicated expression plasmids and total cell numbers were counted over 4 days. Means of each data …
-
Figure 6—source data 1
Cell counts for HEK293 cells, treated as described Figure 6A.
- https://doi.org/10.7554/eLife.23966.016
Figure 6—figure supplement 1
AmotS176A promotes proliferation of human Schwann and hepatocellular carcinoma cells.
(A) hSC2λ or (B) HepG2 cells were cells were transiently transfected with indicated expression plasmids and total cell numbers were counted over 4 days (top). Means of each data point were …
-
Figure 6—figure supplement 1—source data 1
Cell counts for hSCλ cells, treated as described in Figure 6—figure supplement 1.
- https://doi.org/10.7554/eLife.23966.018
-
Figure 6—figure supplement 1—source data 2
Cell counts for hSCλ cells, treated as described Figure 6—figure supplement 1.
- https://doi.org/10.7554/eLife.23966.019
Figure 6—figure supplement 2
Amot-p130S176 pro-proliferative phenotype is YAP dependent and regulates YAP transcriptional activity.
(A) HEK293-shAmot cells were co-transfected with the indicated plasmid DNAs and siRNAs. Fold variation of BrdU incorporation compared to HEK293-shAmot+pcDNA+siCtr (set to 1) was determined 48 hr, 72 …
-
Figure 6—figure supplement 2—source data 1
Counts for BrdU incoporation.
Cells treated as described in Figure 6—figure supplement 2A.
- https://doi.org/10.7554/eLife.23966.021
-
Figure 6—figure supplement 2—source data 2
Counts for luciferase activity.
Cells treated as described in Figure 6—figure supplement 2B.
- https://doi.org/10.7554/eLife.23966.022
Figure 6—figure supplement 3
Amot-p130S176 regulates YAP transcriptional activity.
Expression of the YAP target genes Areg and ApoE was assessed by quantitative real-time PCR in (A) hSC2λ or (B) HepG2 cells co-transfected with the indicated plasmid DNAs and siRNAs. Areg and ApoE …
-
Figure 6—figure supplement 3—source data 1
Source data for qPCR analysis of AREG expression in hSC-lambda cells.
Analysis as described in Figure 6—figure supplement 3.
- https://doi.org/10.7554/eLife.23966.024
-
Figure 6—figure supplement 3—source data 2
Source data for qPCR analysis of APOE expression in hSC-lambda cells.
Analysis as described in Figure 6—figure supplement 3.
- https://doi.org/10.7554/eLife.23966.025
-
Figure 6—figure supplement 3—source data 3
Source data for qPCR analysis of AREG expression in HepG2 cells.
Analysis as described in Figure 6—figure supplement 3.
- https://doi.org/10.7554/eLife.23966.026
-
Figure 6—figure supplement 3—source data 4
Source data for qPCR analysis of APOE expression in HepG2 cells.
Analysis as described in Figure 6—figure supplement 3.
- https://doi.org/10.7554/eLife.23966.027
Figure 7
AmotS176A but not AmotS176E is required for formation of the nuclear Yap-Tead complex.
HEK293-shAmot cells were co-transfected with Amot-WT or Amot-p130S176A or Amot-p130S176E. Total lysates (Input) and Pan-Tead or YAP IPs were subjected to immunoblot analysis with anti-Pan-Tead or …
-
Figure 7—source data 1
Source data for qPCR analysis of ApoE expression in HEK293 cells.
Analysis as described in Figure 7B.
- https://doi.org/10.7554/eLife.23966.030
-
Figure 7—source data 2
Source data for qPCR analysis of AREG expression in HEK293 cells.
Analysis as described in Figure 7B.
- https://doi.org/10.7554/eLife.23966.031
Tables
Table 1
Primer sequences used in qPCR.
| Gene | Primers | |
|---|---|---|
| Forward | Reverse | |
| Amot | 5’-CAGCTTGCAGAGAAGGAATATGAG-3’ | 5’-CTGGCTTTCTTTATTTTTTGCAAAG-3’ |
| ApoE | 5’-AGGAACTGAGGGCGCTGA-3’ | 5’-AGTTCCGATTTGTAGGCCTTCA-3’ |
| Areg | 5’-TGATCCTCACAGCTGTTGCT-3’ | 5’-TCCATTCTCTTGTCGAAGTTTCT-3’ |
| GAPDH | 5’ – GATCATCAGCAATGCCTCCT-3’ | 5’ – TGTGGTCATGAGTCCTTCCA-3’ |
Table 2
Primer sequences used in CHIP.
| Gene | Primers | |
|---|---|---|
| Forward | Reverse | |
| ApoE | GCGTTCACTGTGGCCTGTCCA | GCATGGAGGACAGCCCTGGC |
| Areg | TGTTCTTCCCAGAAACCCTC | TTTACCTACACCATCTCACAGC |
