1. Chromosomes and Gene Expression
  2. Evolutionary Biology
Download icon

Cis-regulatory evolution integrated the Bric-à-brac transcription factors into a novel fruit fly gene regulatory network

  1. Maxwell J Roeske
  2. Eric M Camino
  3. Sumant Grover
  4. Mark Rebeiz
  5. Thomas Michael Williams  Is a corresponding author
  1. University of Dayton, United States
  2. University of Pittsburgh, United States
Research Article
Cite this article as: eLife 2018;7:e32273 doi: 10.7554/eLife.32273
9 figures, 6 tables and 1 additional file

Figures

Contemporary model for the D. melanogaster tergite pigmentation Gene Regulatory Network.

Melanic tergite pigmentation requires the specific expression of the pigmentation genes yellow and tan, while blocking the expression of the yellow-pigment promoting ebony gene. (A) Tergite pigmentation pattern for a D. melanogaster male and the regulatory interactions experienced in the non-melanic male A2-A4 segments (top) and the melanic A5 and A6 segments (bottom). Abd-B is not expressed in the anterior A2-A4 segments and resultantly yellow and tan lack the direct and indirect activating input. In these anterior segments, Abd-A acts as a direct repressor of tan in combination with (direct or indirect) repressive effects of exd and hth. Abd-B is expressed in the posterior A5 and A6 segments, where it functions as a direct activator of yellow and an indirect activator of tan. In these segments, Abd-A acts as an indirect activator of tan. (B) Tergite pigmentation pattern of a D. melanogaster female and the key regulatory inputs experienced in the A2-A4 segments (top) and the A5 and A6 segments (bottom). In the female abdomen, Bab acts as a dominant repressor of yellow and tan expression, overriding the presence of Abd-B and Abd-A. In the GRN schematics, inactive genes are indicated in gray coloring, solid lines connecting genes indicate established direct interactions between a transcription factor and a target gene’s CRE, and dashed connections indicate indirect regulatory interactions or interactions not yet shown to be direct. Lines terminating with an arrowhead indicate regulation in which the transcription factor functions as an activator, and lines terminating in a nail-head shape indicate repression.

https://doi.org/10.7554/eLife.32273.002
Figure 2 with 1 supplement
The tandemly duplicated bab genes perform a derived role in repressing a CRE controlling male-specific expression of the gene yellow.

(A) An ancestral bab gene was duplicated into the paralogous bab1 and bab2 genes in a Dipteran lineage that includes Drosophila fruit flies. The time scale indicates approximate divergence times in millions of years ago. (B) Male-specific expression of yellow in the abdominal epidermis is under the control of the yBE0.6 CRE that possesses two binding sites for Abd-B that are shown as yellow rectangles. Blue bars delimit the SM4 and SM10 regions required to suppress CRE activity in females. (C and D) The yBE0.6 EGFP reporter transgene is elevated in the male A5 and A6 abdomen segments (C) but is only barely detected females (D). (E–G) Ectopic reporter expression occurs in the female abdomen when either the SM4, SM10, or both regions are mutated. (H) The pnr-GAL4 driver activates dorsal midline expression of the UAS-EGFP gene, demarcating its domain of misexpression. (I) Dorsal midline expression of the yBE0.6 CRE is lost when bab1 is ectopically expressed by pnr-GAL4. (J) When the SM4 and SM10 regions are mutated, the yBE0.6 CRE can activate reporter expression in midline regions in spite of ectopically expressed bab1.

https://doi.org/10.7554/eLife.32273.003
Figure 2—source data 1

Amino acid alignment for Bab homologs.

The amino acid sequences for Drosophila (D.) melanogaster Bab1 and Bab2, D. ananassae Bab1 and Bab2, D. willistoni Bab1, D. mojavensis Bab2, Glossina morsitans Bab1 and Bab2, and Anopheles gambiae Bab were aligned using the Clusta Omega multiple sequence alignment program. The BTB and Conserved Domains for D. melanogaster Bab1 and Bab2 are respectively indicated by the maroon and blue background colors. Within the Conserved Domain the psq domain is indicated by the amino acids with yellow font color and the AT-hooks by amino acids with red font color.

https://doi.org/10.7554/eLife.32273.005
Figure 2—source data 2

Sequence alignment of the yBE0.6 with scanning mutant versions.

Purple background with white letters indicate the AscI (GGCGCGCC) and SbfI (CCTGCAGG) restriction enzymes sites that were appended to primers for cloning CRE versions into matching sites in the S3aG reporter transgene vector. Maroon background and white letters indicate sequences that comprise scanning mutations. The lower case nucleotide letters indicate the non-complementary transversions. The yellow background with black letters indicates the Abd-B sites identified in Jeong et al. (2006) which were not mutated in this study. The blue background with white letters indicate the Bab-bound sequences identified in this study. The gray background with bolded black letters indicate the regions to which the BE2.5 Fwd and BE3.5 Rvs primers (reverse complement of that highlighted) were designed to initially amplify the wild-type CRE sequence.

https://doi.org/10.7554/eLife.32273.006
Figure 2—figure supplement 1
Scanning mutagenesis across the entire yBE0.6 CRE identifies sequences that normally function to repress CRE activity in the female abdomen.

(A) Name and location of yBE0.6 scanning mutations. Scanning mutations for which CRE activity in the female abdomen was not noticeably altered are indicated as gray rectangle and those for which ectopic activity occurred are shown as light blue rectangles. The two vertical yellow lines on the illustration of the wild type CRE indicate the position of previously identified Abd-B binding sites that were not mutated in this study. (B–M) The EGFP reporter gene expression pattern in the female abdomen at ~85 hr after puparium formation driven by the non-muntant (yBE0.6) and scan mutant CRE sequences. (M) Scanning mutations 4 and 10 were combined together. Light blue arrowheads indicate abdomen segments with conspicuous ectopic EGFP expression.

https://doi.org/10.7554/eLife.32273.004
The yBE0.6 possesses a binding site for Bab in the SM4 region.

(A) The wild type DNA sequence of the SM4 region is shown, which was subdivided into three smaller regions annotated below that were used as double stranded probes in gel shift assays with the GST-Bab1 DNA-binding Domain (Bab1-DBD). Red text delimits the inferred Bab-binding site. (B) Each probe was tested in gel shift assay reactions for binding with five different amounts of Bab1-DBD. These were from left to right: 0, 500, 1000, 2000, and 4000 ng. (C–E) Gel shift assays using wild type probe sequences. (F–K) Gel shift assays using mutant probe sequences. Lower case blue letters indicate probe mutations that did not noticeably alter protein binding. Probe base pairs in lower case red letters are changes that altered protein binding. Blue and red arrowheads indicate the location of shifted probe, with red arrowheads indicating cases where the quantity of shifted probe was noticeably reduced.

https://doi.org/10.7554/eLife.32273.007
The yBE0.6 possesses a binding site for Bab in the SM10 region.

(A) The wild type DNA sequence of the SM10 region is shown, which was subdivided into three smaller regions annotated below that were used as double stranded probes in gel shift assays with the GST-Bab1 DNA-binding Domain (Bab1-DBD). Red text delimits the inferred Bab binding site. (B) Each probe was tested in gel shift assay reactions for binding with five different amounts of Bab1-DBD. These were from left to right: 0, 500, 1000, 2000, and 4000 ng. (C–E). Gel shift assays using wild type probe sequences. (F–K) Gel shift assays using mutant probe sequences. Lower case purple letters indicate probe mutations that did not noticeably alter protein binding. Probe base pairs in lower case red letters are changes that altered protein binding. Purple and red arrowheads indicate the location of shifted probe, with red arrowheads indicating cases where the quantity of shifted probe was noticeably reduced. Asterisks indicate a situation where binding was non-specific as both the wild type and mutant probes were bound by the Bab1-DBD.

https://doi.org/10.7554/eLife.32273.008
RNA-interference reveals a necessity for both bab1 and bab2 in suppressing female tergite pigmentation.

(A–G) Double-stranded (ds) RNA transgenes with UAS binding sites were expressed in the dorsal midline abdomen region driven by GAL4 that was expressed in the midline pattern of the pnr gene. (A) Expression of a negative control dsRNA that targets a gene (mCherry) that does not naturally exist in the D. melanogaster genome resulted in no apparent pigmentation phenotype from RNA-interference (RNAi). (B and C) Two different dsRNAs specific to bab1 and to (D and E) bab2 were tested for pigmentation phenotypes from RNAi. (F and G) Simultaneous RNAi for bab1 and bab2 was accomplished by expressing ‘chained’ transgenes. Red arrowheads indicate tergite regions where RNAi caused the development of ectopic pigmentation. The anterior midline tergite regions (illustrated in panel A by dashed yellow rectangles) were quantified for their darkness percentage for replicate specimens (n = 4). These percentages and their standard error of the mean (±SEM) are provided below a representative image.

https://doi.org/10.7554/eLife.32273.009
Figure 5—source data 1

Analysis of RNA-interference pigmentation phenotypes.

https://doi.org/10.7554/eLife.32273.010
Figure 6 with 4 supplements
Bab1 and Bab2 are sufficient to suppress tergite pigmentation as DNA-binding transcription factors.

(A–L) Ectopic expression assays for various bab protein coding sequences. (A and G) D. melanogaster bab1, (B and H) D. melanogaster bab2, (C and I) a DNA-binding compromised version of D. melanogaster bab1 (bab1 DBM), (D and J) D. willistoni bab1, (E and K) D. mojavensis bab2, and (F and L) A. gambiae bab. (A–F) Leaky expression of transgenes from the attP40 transgene insertion site. (G–L) Ectopic expression of protein coding sequences in the male abdomen under the control of the y-GAL4 transgene. Red arrowheads indicate tergite regions with conspicuously reduced tergite pigmentation. The A5 and A6 tergite regions were quantified for their darkness percentage for replicate specimens (n = 4). These percentages and their standard error of the mean (±SEM) are provided below a representative image.

https://doi.org/10.7554/eLife.32273.013
Figure 6—source data 1

The DNA and translated protein sequences for the bab open-reading frames.

https://doi.org/10.7554/eLife.32273.018
Figure 6—source data 2

Analysis of pigmentation phenotypes from bab open-reading frame ectopic expression.

https://doi.org/10.7554/eLife.32273.019
Figure 6—figure supplement 1
Lethality from ectopic expression of orthologous bab open reading frame transgenes in the pnr pattern.

UAS-bab open-reading frame transgenes are located in the attP40 site on the D. melanogaster second chromosome. Male flies were crossed to females heterozygous for the third chromosome where the GAL4 gene is inserted into the pnr locus and the TM3 balancer. Fewer offspring were obtained that possessed an ectopic bab expressing genotype than expected by chance, indicating lethality due to bab expression in the spatial and temporal pattern of the pnr gene.

https://doi.org/10.7554/eLife.32273.014
Figure 6—figure supplement 2
Bab proteins are sufficient to suppress tergite pigmentation when ectopically expressed in the dorsal midline of D. melanogaster.

(A–E) Ectopic expression of bab protein coding sequences in the dorsal midline of male and female abdomens under control of the pnr-GAL4 driver. These coding sequences were (A) D. melanogaster bab2, (B) a DNA-binding compromised version of D. melanogaster bab1 (bab1-DBM), (C) D. willistoni bab1, (D) D. mojavensis bab2, and (E) A. gambiae bab. Red arrowheads indicate tergite regions with conspicuously reduced tergite pigmentation. (A, C, D, and E) Ectopic expression resulted in reduced tergite pigmentation and a non-specific split tergite phenotype. (B) The DNA-binding mutant Bab1 could neither suppress tergite pigmentation nor cause the non-specific split tergite phenotype.

https://doi.org/10.7554/eLife.32273.015
Figure 6—figure supplement 3
The temporal and spatial domains of activity for GAL4 drivers in D. melanogaster pupa.

(A) Dorsal midline expression of the UAS-GFP transgene under the control of the pnr-GAL4 driver at ~40–50 hr after puparium formation (hAPF). (B) Dorsal midline expression of the UAS-GFP transgene under the control of the pnr-GAL4 driver at ~80–88 hAPF. (C) The UAS-GFP transgene is not expressed at ~40–50 hAPF when under the regulatory control of the y-GAL4 driver. (D) The pan-abdomen expression of the UAS-GFP transgene under the control of the y-GAL4 driver at ~80–88 hAPF. The highest level expression occurs in the A5 and A6 segments due to the activity of the body element CRE which is included in the y-GAL4 transgene. All specimens shown are males.

https://doi.org/10.7554/eLife.32273.016
Figure 6—figure supplement 4
Ectopic expression of the Bab1-DNA-binding mutant protein.

(A) Little-to-no endogenous Bab1 protein can be detected in the dorsal abdominal epidermis of D. melanogaster male pupa. (B) In contrast, nuclear-localized expression of the Bab1 DNA-binding mutant protein can be observed when the UAS-transgene was ectopically expressed under the control of the pnr-GAL4 driver. (A’ and B’) Zoomed in view of the expression within the regions outlined by dashed red boxes in panels A and B. Samples shown are at a pupal developmental stage of ~88 hr after puparium formation.

https://doi.org/10.7554/eLife.32273.017
The Bab paralogs can suppress the male-specific activity of the regulatory region containing the wing element and body element CREs.

(A) 5’ of yellow exon one resides the wing element and body element CREs, and the position of the D. melanogaster yBE0.6 is shown below the to-scale representation of the partial locus. (B–G) Comparison of the levels of EGFP-reporter expression in the male A5 and A6 segments driven by the Wing Body Element of D. melanogaster. (H–M) Comparison of the levels of EGFP-reporter expression in the male A5 and A6 segments driven by the Wing Body Element of D. malerkotliana. The levels of EGFP expression are represented as the % of the mean ±SEM for samples in which the Bab1-DBM was expressed. (B and H) Robust EGFP reporter expression in samples ectopically expressing the Bab1-DBM protein in the y-GAL4 pattern. (C and I) Ectopic expression of Bab1 in the y-GAL4 pattern reduced A5 and A6 expression compared to the control. (D and J) Ectopic expression of Bab2 in the y-GAL4 pattern reduced A5 and A6 expression compared to the control. (E and K) Ectopic expression of D. willistoni Bab1 in the y-GAL4 pattern reduced A5 and A6 expression compared to the control. (F and L) Ectopic expression of D. mojavensis Bab2 in the y-GAL4 pattern reduced A5 and A6 expression compared to the control. (G and M) Ectopic expression of A. gambiae Bab in the y-GAL4 pattern reduced A5 and A6 expression compared to the control.

https://doi.org/10.7554/eLife.32273.020
Figure 7—source data 1

Analysis of ectopic expression effects of bab open-reading frames on the dimorphic activities of yellow gene CREs.

https://doi.org/10.7554/eLife.32273.021
Figure 8 with 1 supplement
The evolved repression by Bab for cis-regulatory regions 5’ of yellow.

(A–A’’) Comparison of the levels of EGFP-reporter expression in the male A5 and A6 segments driven by the Wing Body Element of D. melanogaster. (B–B’’) Comparison of the levels of EGFP-reporter expression in the male A5 and A6 segments driven by the Wing Body Element of D. malerkotliana. (C–C’’) Comparison of the levels of EGFP-reporter expression in the male A5 and A6 segments driven by the Wing Body Element of D. pseudoobscura. (D–D’’) Comparison of the levels of EGFP-reporter expression in the male A5 and A6 segments driven by the 5’ non-coding region of D. willistoni yellow. For each comparison, the level of EGFP expression are expressed as the percentage of the mean ±SEM for samples in which the Bab1-DBM was expressed. (A–D) Ectopic expression of the Bab1-DBM in the y-GAL4 pattern. (A’–D’) Ectopic expression of Bab1 in the y-GAL4 pattern. (A’’–D’’) Ectopic expression of Bab2 in the y-GAL4 pattern.

https://doi.org/10.7554/eLife.32273.022
Figure 8—source data 1

Analysis of the ectopic expression effects of bab open reading frames on yellow gene CREs from species with dimorphic and monomorphic tergite pigmentation.

https://doi.org/10.7554/eLife.32273.024
Figure 8—figure supplement 1
Orthologous regulatory regions 5’ of the yellow gene differ in their responsiveness to bab.

Scatter plots of the pixel intensity statistics obtained for the EGFP reporter expression occurring in the dorsal abdominal epidermis of the A5 and A6 segments and the A3 segment. For each condition (a reporter transgene with expression driven by a yellow CRE and an ectopically expressed bab open reading frame), expression was measured for five replicate male specimens, except for the D. pseudoobscura y5’ sequence in the presence of ectopic bab1 DBM expression (n = 4), for which the mean is shown as a horizontal black bar. All specimens used were at the developmental stage of ~85 hr after puparium formation for growth at 25°C.

https://doi.org/10.7554/eLife.32273.023
The evolution of male-specific pigmentation required the gain of a regulatory linkage between Bab and the newly evolved body element CRE controlling yellow expression.

(A) An alignment of the Bab-bound sequences in the SM4 (site 1) and SM10 (site 2) regions and for the two previously identified binding sites for Abd-B in the yBE0.6 CRE (Jeong et al., 2006). ‘Node 1’ on the phylogeny indicates the most recent common ancestor suspected to have possessed the derived male-specific pattern of pigmentation. Time scale shown is in millions of years ago. Bold capital letters indicate the bases bound by the transcription factor in the D. melanogaster CRE, and those which are conserved in the orthologous regions for related species. (B) Model for the derivation of a dimorphic pigmentation trait where dimorphic pigmentation required the evolution of a dimorphic Bab expression and the gain of a regulatory linkage between Bab and yellow through gains of binding sites in the body element CRE.

https://doi.org/10.7554/eLife.32273.025

Tables

Table 1
Design of small interfering RNA output for the bab1 ORF.
https://doi.org/10.7554/eLife.32273.011
siRNA idPositionSS sequence (Passenger)AS sequence (Guide)Corrected score
1560GGAUAGCUGAGAUGUUGAAAGUUCAACAUCUCAGCUAUCCUG99.7
21442CCGAUGACUUGGAGAUCAAGCUUGAUCUCCAAGUCAUCGGCG85.7
3278GGAACAACUAUCAGACGAACCUUCGUCUGAUAGUUGUUCCAG97.6
4162GAGUCAAGGUCAUGCUGUAGCUACAGCAUGACCUUGACUCUC95.2
51483CGAGAGGAAGAAAGGGUAAGUUUACCCUUUCUUCCUCUCGGA81.8
6150CGAGGACAAGGAGAGUCAAGGUUGACUCUCCUUGUCCUCGUC94.6
71473CGAGAUGAUCCGAGAGGAAGAUUCCUCUCGGAUCAUCUCGGC78.9
8219GGGCAGGAGUUCUUCGGUAGCUACCGAAGAACUCCUGCCCUG89.5
9359GCGAUGGUCGGUCCAUGAAGGUUCAUGGACCGACCAUCGCAU88.2
10664CCCAAGGAGAGCACUUCAACUUUGAAGUGCUCUCCUUGGGCG84.7
11368GGUCCAUGAAGGCCCACAAGAUUGUGGGCCUUCAUGGACCGA87.5
Table 2
Design of small interfering RNA output for the bab2 ORF.
https://doi.org/10.7554/eLife.32273.012
siRNA
_id
PositionSS sequence (Passenger)AS sequence (Guide)Corrected score
616GAUUGUGGACUUUGAAAUAAAUAUUUCAAAGUCCACAAUCUG98.1
12279CGGAGCUGGUGAAGUCCAAGGUUGGACUUCACCAGCUCCGUU94.5
2051GCGAAAUCGAUCAGUUCGAGGUCGAACUGAUCGAUUUCGCCG94.4
18155AGAAAGUACUCACCCGAAAGGUUUCGGGUGAGUACUUUCUGU93.6
19202AAGUGAGGUGGUUGAUCAAAUUUGAUCAACCACCUCACUUGG92.5
23241CGUUGGAGAAGUCAAGUCACCUGACUUGACUUCUCCAACGCU92.3
421GGACAUGACCAAACAGAUUGUAAUCUGUUUGGUCAUGUCCAU91.7
4314CAGAUUGUGGACUUUGAAAUAUUUCAAAGUCCACAAUCUGUU91.6
4563AGUUCGAGGCGAGUGACUACAUAGUCACUCGCCUCGAACUGA91.4
40154CAGAAAGUACUCACCCGAAAGUUCGGGUGAGUACUUUCUGUU90.7
4913ACAGAUUGUGGACUUUGAAAUUUCAAAGUCCACAAUCUGUUU90.7
28306CGAUGAACGACCAAGCUUUGAAAAGCUUGGUCGUUCAUCGGA90.6
46140CUAGAGGACCAGAACAGAAAGUUCUGUUCUGGUCCUCUAGAU90.4
13625GACCAAUGUCUUUGACGAACUUUCGUCAAAGACAUUGGUCAG90.3
5512AACAGAUUGUGGACUUUGAAAUCAAAGUCCACAAUCUGUUUG90.3
38297AGGCGAGUCCGAUGAACGACCUCGUUCAUCGGACUCGCCUUG89.8
27443CAGCCUCAACCAAAUCUUAAGUAAGAUUUGGUUGAGGCUGUG89.6
10822UGGUGGAGUUCAUGUACAAGGUUGUACAUGAACUCCACCAGG88.9
41099GGACUUGAAUCAGCGACAAAGUUGUCGCUGAUUCAAGUCCAA88.8
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiers
Gene (Drosophila melanogaster)bab1FLYB:FBgn0004870
Gene (D. melanogaster)bab2FLYB:FBgn0025525
Gene (D. melanogaster)yellowFLYB:FBgn0004034
Genetic reagent (D. melanogaster)pnr-Gal4Bloomington Drosophila Stock CenterBDSC:3039
Genetic reagent (D. melanogaster)y-Gal4Bloomington Drosophila Stock CenterBDSC:44267; FLYB:FBst0044267; RRID:BDSC_44267
genetic reagent (D. melanogaster)UAS-GFP-nlsBloomington Drosophila Stock CenterBDSC:4776
Genetic reagent (D. melanogaster)UAS-mCherry dsRNABloomington Drosophila Stock CenterBDSC:35785
Genetic reagent (D. melanogaster)UAS-bab1 ORF of D. melanogasterthis paper
Genetic reagent (D. melanogaster)UAS-bab2 ORF of D. melanogasterthis paper
Genetic reagent (D. melanogaster)UAS-bab1 DBM ORF of D. melanogasterthis paper
Genetic reagent (D. melanogaster)UAS-bab1 ORF of D. willistonithis paper
Genetic reagent (D. melanogaster)UAS-bab2 ORF of D. mojavensisthis paper
Genetic reagent (D. melanogaster)UAS-bab Anopheles gambiaethis paper
Genetic reagent (D. melanogaster)UAS-bab1 siRNA id #3this paper
Genetic reagent (D. melanogaster)UAS-bab1 siRNA id #4this paper
Genetic reagent (D. melanogaster)UAS-bab2 siRNA id #12this paper
Genetic reagent (D. melanogaster)UAS-bab2 siRNA id #16this paper
Genetic reagent (D. melanogaster)UAS-bab1 siRNA id #3 + bab2 siRNA id#12this paper
Genetic reagent (D. melanogaster)UAS-bab1 siRNA id #3 + bab2 siRNA id#16this paper
Genetic reagent (D. melanogaster)yBE0.6-EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)yBE0.6 SM4-EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)yBE0.6 SM10-EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)yBE0.6 SM4 + SM10 EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)yWing + Body Element (D. melanogaster)-EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)yWing + Body Element (D. malerkotliana)-EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)yWing + Body Element (D. pseudoobscura)-EGFP reporterPMID:25835988
Genetic reagent (D. melanogaster)y5'1 (D. willistoni)-EGFP reporterPMID:25835988
Antibodyanti-Bab1 (rabbit polyclonal)PMID:18724934
AntibodyAlexa 647-secondaryInvitrogenA-21244
Recombinant DNA reagentGST-Bab1 DNA Binding Domain (DBD)this paper
Table 3
Oligonucleotides used to make Scan Mutant four region gel shift probes.
https://doi.org/10.7554/eLife.32273.026
ProbeSequence (5’ to 3’)Oligo name
SM4 Region 1ATTCTTTAATTTGTATTTTAATATTyBE 4i1 Top
AATATTAAAATACAAATTAAAGAATyBE 4i1 Bottom
SM4 Region 2ATATTTTGAGAGGTTTTCCTTATTTAAAGTyBE 4i2 Top
ACTTTAAATAAGGAAAACCTCTCAAAATATyBE 4i2 Bottom
SM4 Region 3AAAGTGTAGATTATTGAGGATTAATyBE 4i3 Top
ATTAATCCTCAATAATCTACACTTTyBE 4i3 Bottom
SM4 Region 3 Scan MutantcAcGgGgAtAgTcTgGcGtAgTcAgy4i3 T Scrm
cTgAcTaCgCcAgAcTaTcCcCgTgy4i3 B Scrm
Region 3 TA > GAAAAGTGgAGATgATTGAGGATgAATyBE 4i3 TA > GA Top
ATTcATCCTCAATcATCTcCACTTTyBE 4i3 TA > GA Bottom
SM4 Region 3 sub1gggCgggCgATTATTGAGGATTAATy4i3 sub1 T
ATTAATCCTCAATAATcGgggGcccy4i3 sub1 B
SM4 Region 3 sub2AAAGTgggCgggCgTGAGGATTAATy4i3 sub2 T
ATTAATCCTCAcGcccGcccACTTTy4i3 sub2 B
SM4 Region 3 sub3AAAGTGTAGAgggCgggCgATTAATy4i3 sub3 T
ATTAATcGcccGcccTCTACACTTTy4i3 sub3 B
SM4 Region 3 sub4AAAGTGTAGATTATTGgggCgggCgy4i3 sub4 T
cGcccGcccCAATAATCTACACTTTy4i3 sub4 B
Table 4
Oligonucleotides used to make Scan Mutant 10 region gel shift probes.
https://doi.org/10.7554/eLife.32273.027
ProbeSequence (5’ to 3’)Oligo name
SM10 Region 1TCGTCCCTTTTGAAATTTTATGTAACACTCyBE 10i1 Top
GAGTGTTACATAAAATTTCAAAAGGGACGAyBE 10i1 Bottom
SM10 Region 2CACTCAATTATATTTATGTATATGTATGCTyBE 10i2 Top
AGCATACATATACATAAATATAATTGAGTGyBE 10i2 Bottom
SM10 Region 3ATGCTCAAAATCACCTGCCAATAACCCTGCAGGyBE 10i3 Top
CCTGCAGGGTTATTGGCAGGTGATTTTGAGCATyBE 10i3 Bottom
SM10 Region 1 Scan MutantgCtTaCaTgTgGcAcTgTgAgGgAcCcCgCy10i1 T Scrm
GcGgGgTcCcTcAcAgTgCcAcAtGtAaGcy10i1 B Scrm
SM10 Region 3 Scan MutantcTtCgCcAcAgCcCaTtCaAcTcAaCaTtCcGty10i3 T Scrm
aCgGaAtGtTgAgTtGaAtGgGcTgTgGcGaAgy10i3 B Scrm
SM10 Region 1 sub1gggCgggCgggCAAATTTTATGTAACACTCy10i1 sub1 T
GAGTGTTACATAAAATTTGcccGcccGcccy10i1 sub1 B
SM10 Region 1 sub2TCGTCCgggCgggCgggCTATGTAACACTCy10i1 sub2 T
GAGTGTTACATAGcccGcccGcccGGACGAy10i1 sub2 B
SM10 Region 1 sub3TCGTCCCTTTTGgggCgggCgggCACACTCy10i1 sub3 T
GAGTGTGcccGcccGcccCAAAAGGGACGAy10i1 sub3 B
SM10 Region 1 sub4TCGTCCCTTTTGAAATTTgggCgggCgggCy10i1 sub4 T
GcccGcccGcccAAATTTCAAAAGGGACGAy10i1 sub4 B
Table 5
Oligonucleotides for cloning bab1 and bab2 shRNAs into NheI and EcoRI sites of pattB-NE3 vector.
https://doi.org/10.7554/eLife.32273.028
siRNA name and sequenceOligo nameOligo sequence (5’ – 3’)
bab1 siRNA 3
TTCGTCTGATAGTTGTTCCAG
b1_3 Top b1_3
Bottom
ctagcagtCTGGAACAACAATCAGACGTAtagttatattcaagcataTTCGTCTGATAGTTGTTCCAGgcg aattcgcCTGGAACAACTATCAGACGAAtatgcttgaatataactaTACGTCTGATTGTTGTTCCAGactg
bab1 siRNA 4
TACAGCATGACCTTGACTCTC
b1_4
Top b1_4
bottom
ctagcagtGAGAGTCAAGCTCATGCTGAAtagttatattcaagcataTACAGCATGACCTTGACTCTCgcg aattcgcGAGAGTCAAGGTCATGCTGTAtatgcttgaatataactaTTCAGCATGAGCTTGACTCTCactg
bab2 siRNA 16
TATTTCAAAGTCCACAATCTG
b2_16
Top b2_16
Bottom
ctagcagtCAGATTGTGGTCTTTGAAAAAtagttatattcaagcataTATTTCAAAGTCCACAATCTGgcg aattcgcCAGATTGTGGACTTTGAAATAtatgcttgaatataactaTTTTTCAAAGACCACAATCTGactg
bab2 siRNA 12
TTGGACTTCACCAGCTCCGTT
b2_12
Top b2_12
Bottom
ctagcagtAACGGAGCTGCTGAAGTCCTAtagttatattcaagcataTTGGACTTCACCAGCTCCGTTgcg aattcgcAACGGAGCTGGTGAAGTCCAAtatgcttgaatataactaTAGGACTTCAGCAGCTCCGTTactg
bab2 siRNA 20
TCGAACTGATCGATTTCGCCG
b2_20
Top b2_20
Bottom
ctagcagtCGGCGAAATCCATCAGTTCCAtagttatattcaagcataTCGAACTGATCGATTTCGCCGgcg aattcgcCGGCGAAATCGATCAGTTCGAtatgcttgaatataactaTGGAACTGATGGATTTCGCCGactg

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)