Codon usage bias controls mRNA and protein abundance in trypanosomatids
- University of Dundee, United Kingdom
Figures
Figure 1
Protein expression is increased by GC3 codons in T.brucei.
(A) Schematic map of the pRPai-based, tetracycline-inducible reporter construct. Relevant restriction sites are shown. Black bars, tubulin untranslated regions; arrow, pol-I promoter; pA, …
Figure 2
mRNA expression is increased by GC3 codons in T.brucei.
(A) Schematic map of the reporter cassette. The grey bar indicates the position of the tubulin untranslated region probe. The RNA blot indicates native tubulin transcripts and the gLUC transcripts. …
Figure 3
Genome scale analysis of codon usage bias.
(A) CAI value distribution is shown for all non-redundant T. brucei genes and the cohorts of genes indicated. See the text for more detail on each cohort. (B) CAI values are shown in heat-map format …
Figure 4
Genome scale analysis of codon pair bias in T.
brucei. (A) Codon co-occurrence by encoded amino acid. Amino acid pairs are over-represented; highlighted by white boxes. (B) Analysis of third position followed by first position pairs. Examples of …
Figure 5 with 1 supplement
Transcriptome and proteome data and the impact of gene length in T.brucei.
(A) Correspondence between observed mRNA and protein expression. (B) Relationship between observed mRNA expression and protein coding sequence (CDS) length. RPKM, Reads Per Kilobase of transcript …
Figure 5—figure supplement 1
RNA-seq data.
Replicate read counts and correspondence analysis. RPKM (Reads Per Kilobase of transcript per Million mapped reads).
Figure 6 with 1 supplement
Codon usage is predictive of relative mRNA and protein expression in T.brucei.
(A) Correspondence between relative observed mRNA expression and CAI. (B) Correspondence between relative observed mRNA levels and predicted expression based on CAI and CDS length in kbp (L); the …
Figure 6—figure supplement 1
Length-adjusted CAI is predictive of relative mRNA expression in previously published datasets.
Data from distinct life cycle stages of T. brucei and from different research groups were analysed; the data source is indicated in each case. Correspondence is shown between relative observed mRNA …
Figure 7
Codon usage predicts the relative expression of protein complexes and cohorts of proteins with related functions in T.brucei.
Correspondence between observed peptide counts and predicted abundance based on CAI. The complexes and cohorts are listed in order of peptides/kbp and number of proteins is indicated for each; …
Figure 8
Length-adjusted CAI and CAI are predictive of translation efficiency and mRNA half-life, respectively, in previously published data from T.brucei; the data source is indicated in each case.
(A) Correspondence between translation efficiency (footprint levels/mRNA levels) and length-adjusted CAI. n = 4880 genes. Data from bloodstream-form cells is shown; correlation coefficient for …
Figure 9
Length-adjusted CAI is predictive of relative mRNA and protein expression in previously published data from the other trypanosomatids, T.vivax and Leishmania mexicana; the data source is indicated in each case.
The plots indicate correspondence between relative observed mRNA or protein expression and our predictions based on CAI and CDS length in kbp (L). (A) T. vivax mRNA expression. n = 5170 genes. (B) T.…
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| gene (Gaussia princeps) | gLUC | PMID: 18408930 | AY015993.1 | wild-type |
| gene (Gaussia princeps) | gLUC | PMID: 18408930 | EU372000 | human codon-optimised |
| cell line (Trypanosoma brucei) | 2T1 | PMID: 16182389 | ||
| transfected construct (Trypanosoma brucei) | pRPa-iSL plasmid | PMID: 18588918 | 69244 | available from addgene.org |
| transfected construct (Trypanosoma brucei) | pRPa plasmid | PMID: 18588918 | ||
| transfected construct (Trypanosoma brucei) | pRPa-λ plasmid | this paper | see materials and methods | |
| antibody | α-gLUC | New England Biolabs | one in 1000 | |
| sequence-based reagent | EUluc5 oligonucleotide | this paper | GATCCTGCAGCTCGAGATGAAGCCCACCGAGAACAACG | |
| sequence-based reagent | EUluc3 oligonucleotide | this paper | GATCGAATTCAGATCTAAGCTTTTACAGCTTCGAGTCGCCGCCGGCGCC | |
| sequence-based reagent | WTluc5 oligonucleotide | this paper | GATCCTCGAGATGAAACCAACTGAAAACAATG | |
| sequence-based reagent | WTluc3 oligonucleotide | this paper | GATCAAGCTTTTATAATTTACTATCACCACCGGCACCCTT | |
| sequence-based reagent | Lambda5 oligonucleotide | this paper | GATCAAGCTTTGCAGGGTGAGATTGTGGC | |
| sequence-based reagent | Lambda3 oligonucleotide | this paper | GATCGAATTCGCTCAGTTGTTCAGGAATATG | |
| sequence-based reagent | TUBF oligonucleotide | this paper | AGATCTTCAAACACTAGTTTAAGC | |
| sequence-based reagent | TUBR oligonucleotide | this paper | CATGATAAATAAATAGAAGTGCTTTGTTG | |
| sequence-based reagent | λF oligonucleotide | this paper | GATTCATAAGTTCCGCTGTGTGCCGCATCTC | |
| sequence-based reagent | λR oligonucleotide | this paper | GCTCAGTTGTTCAGGAATATGGTGCAGCAG | |
| commercial assay or kit | BioLux Gaussia luciferase | New England Biolabs | ||
| software, algorithm | Bowtie 2 | PMID: 22388286 | ||
| software, algorithm | SAMtools | PMID: 19505943 | ||
| software, algorithm | edgeR | PMID: 19910308 | ||
| software, algorithm | CAI calculator | http://www.umbc.edu//codon/cai/cais.php | ||
| software, algorithm | ANACONDA | http://bioinformatics.ua.pt/software/anaconda/ | ||
| online database | TriTrypDB, RRID:SCR_007043 | http://tritrypdb.org/tritrypdb/ |
Additional files
-
Supplementary file 1
Sheet 1: Synthetic genes.
Sequences of gLUC and GFP genes with high, medium or low proportions of GC3-codons. Sheet 2: T. brucei expression data. CAI values, proteome and transcriptome data and predicted expression levels are tabulated for the non-redundant gene sets analysed in Figures 5–6. Sheet 3: T. brucei gene cohorts. Data for the genes analysed in Figure 7. Sheet 4: T. brucei - extended set of ranked CAI values and predictions, including GeneID and product description; n = 8479. Sheet 5: T. vivax - ranked CAI values and predictions, including GeneID and product description; n = 7836. Sheet 6: L. mexicana - ranked CAI values and predictions, including GeneID and product description; n = 5715.
- https://doi.org/10.7554/eLife.32496.014
-
Transparent reporting form
- https://doi.org/10.7554/eLife.32496.015
