The small molecule ISRIB rescues the stability and activity of Vanishing White Matter Disease eIF2B mutant complexes
- Calico Life Sciences LLC, United States
- AbbVie, United States
Figures
Figure 1 with 1 supplement
eIF2B isoforms have identical GEF activity and ISRIB alters the sensitivity of eIF2B to eIF2 phosphorylation.
(A) Coomassie-stained SDS-PAGE gel of recombinant human eIF2 used as a substrate in the in vitro GEF assays. (B) Multi-angle light scattering analysis of purified eIF2, indicating good agreement …
Figure 1—figure supplement 1
Purification of eIF2B mutants.
(A) Primary sequence of the eIF2B δ1 and δ2 isoforms, showing the region in which they differ at the N-terminus of the protein. (B) Coomassie-stained SDS-PAGE gels of purified recombinant human …
Figure 2 with 2 supplements
Recombinant eIF2B VWMD mutants have reduced GEF activity and complex stability that is rescued by ISRIB.
(A) VWMD mutations tested in this study, visualized as spheres on the structure of S. pombe eIF2B (PDB: 5B04; Kashiwagi et al., 2016). The human mutation sites are shown in plain text and the …
Figure 2—figure supplement 1
Recombinant eIF2B VWMD mutants have reduced GEF activity that is rescued by ISRIB.
(A) All eIF2B VWMD mutant complexes except εR136H have reduced GEF activity compared to WT. ISRIB dose-response curves of GDP release half-life for each mutant. Half-lives of GDP release at each …
Figure 2—figure supplement 2
Recombinant eIF2B VWMD mutants have reduced complex stability that is rescued by ISRIB.
(A–B) Immunoblotting of eIF2Bδ (representative of the 4mer subcomplex) and eIF2Bα from the SEC experiments in (A) Figure 2E and (B) Figure 3B. Bands shown are simulated representations of the …
Figure 3
ISRIB-resistant mutants in the δ subunit can exhibit WT or VWMD-like stability and GEF activity.
(A) ISRIB-resistant mutations tested in this study, visualized as spheres on the structure of S. pombe eIF2B (PDB: 5B04; Kashiwagi et al., 2016). The human mutation sites are shown in plain text and …
Figure 4 with 4 supplements
ISRIB attenuates the ISR and rescues the GEF activity of eIF2B in HEK293T VWMD mutant cells.
(A) Levels of the five eIF2B subunits were measured by immunoblotting (Wes analysis) of lysates from WT and VWMD cell lines. The chemiluminescence signal of each subunit was normalized to α-tubulin …
Figure 4—figure supplement 1
Several VWMD mutations reduce the protein level of the affected subunit in cells.
(A) Schematic of the workflow used to generate VWMD mutant HEK293T cell lines. Cells were co-transfected with a Cas9-OFP-gRNA plasmid and a ssDNA HDR template targeting a specific mutation. …
Figure 4—figure supplement 2
VWMD mutant cells have normal rates of protein synthesis and ISRIB partially rescues a stress-induced reduction.
(A) ISRIB blocks ATF4 induction in VWMD mutants. Immunoblot (Wes analysis) of endogenous ATF4 protein levels in WT and VWMD mutant cells. Total eIF2α was used as a loading control. Cells were …
Figure 4—figure supplement 3
VWMD mutant cells show a similar response to ER stress as WT cells.
Tg dose-response curves of ATF4-luciferase reporter activity in WT and VWMD cell lines. Cells were treated with increasing concentrations of Tg for 7 hr (N = 3, mean ± SD). The values for δR483W …
Figure 4—figure supplement 4
Lysates from VWMD cells exhibit reduced GEF activity in vitro that is enhanced by ISRIB.
(A) Levels of the five eIF2B subunits were measured by immunoblotting (Wes analysis) of lysates from different cell lines. The cell lines were: HEK293T (human embryonic kidney, SV40-transformed), …
Tables
Table 1
eIF2B mutants generated in this study
https://doi.org/10.7554/eLife.32733.007| eIF2B subunit | Mutation | Age of disease onset (years) | Disease alleles | HEK293T cells generated | Recombinant protein generated |
|---|---|---|---|---|---|
| α | V183F | 10–17 | Homozygous* | X | X |
| γ | I346T | 1–4 | Homozygous; also compound heterozygous with G47E† | X | - |
| δ | R483W | <1 | Homozygous‡ | X | X |
| ε | R113H | 1–30 | Homozygous; also compound heterozygous with multiple other mutations§ | X | X |
| ε | R136H | 3 | Homozygous# | - | X |
| ε | R195H | <1 | Homozygous** | X | X |
| δ | L179F | ISRIB-resistant; not naturally occurring†† | - | X | |
| δ | L487W | ISRIB-resistant; not naturally occurring | - | X | |
-
*Ohlenbusch et al., 2005
†Wu et al., 2009
-
‡van der Knaap et al., 2003
§Fogli et al., 2004
-
#Kantor et al., 2005
**Fogli et al., 2002
-
††Sekine et al., 2015
Key resources table
| Reagent type or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (H. sapiens) | HEK293T with ATF4-Luc reporter | PMID: 23741617 | ||
| Cell line (H. sapiens) | HEK293T (eIF2Bα V183F) with ATF4-Luc reporter | This paper | two clones generated | |
| Cell line (H. sapiens) | HEK293T (eIF2Bγ I346T) with ATF4-Luc reporter | This paper | two clones generated | |
| Cell line (H. sapiens) | HEK293T (eIF2Bδ R483W) with ATF4-Luc reporter | This paper | two clones generated | |
| Cell line (H. sapiens) | HEK293T (eIF2Bε R113H) with ATF4-Luc reporter | This paper | two clones generated | |
| Cell line (H. sapiens) | HEK293T (eIF2Bε R195H) with ATF4-Luc reporter | This paper | two clones generated | |
| Antibody | Rabbit monoclonal anti-ATF4 | Cell Signaling | #11815 | (1:50) in Wes |
| Antibody | Rabbit monoclonal anti-eIF2α | Cell Signaling | #5324 | (1:100) in Wes |
| Antibody | Rabbit polyclonal anti-eIF2Bα | ProteinTech | #18010–1-AP | (1:50) in Wes |
| Antibody | Rabbit polyclonal anti-eIF2Bβ | ProteinTech | #11034–1-AP | (1:50) in Wes |
| Antibody | Rabbit polyclonal anti-eIF2Bγ | ProteinTech | #11296–2-AP | (1:25) in Wes |
| Antibody | Rabbit polyclonal anti-eIF2Bδ | ProteinTech | #11332–1-AP | (1:50) in Wes |
| Antibody | Rabbit polyclonal anti-eIF2Bε | Bethyl Labs | #A302-556 | (1:50) in Wes |
| Antibody | Mouse monoclonal anti-tubulin | Cell Signaling | #3873 | (1:50) in Wes |
| Recombinant DNA reagent | CRISPR nuclease vector with OFP reporter | Thermo Fisher | #A21174 | |
| Sequence-based reagent | eIF2Bα V183F guide RNA | This paper | GTGGTGCTAGATGCTGCTGTCGG | |
| Sequence-based reagent | eIF2Bγ I346T guide RNA | This paper | TGACAATCTGGGCTGACGAATGG | |
| Sequence-based reagent | eIF2Bδ R483W guide RNA | This paper | GACTAGATTCAACAACCGTAGGG | |
| Sequence-based reagent | eIF2Bε R113H guide RNA | This paper | CCGCCCTACATCTCTCAATGTGG | |
| Sequence-based reagent | eIF2Bε R195H guide RNA | This paper | TTGTCTTCGTGGCAACGAGTTGG | |
| Recombinant protein | GST-PERK | Thermo Fisher | #PV5106 | Used to phosphorylate eIF2in vitro |
| Commercial assay | ONE-GLO luciferase assay | Promega | #E6120 | |
| Chemical compound | Bodipy-FL-GDP | Thermo Fisher | #G22360 | |
| Chemical compound | ISRIB | PMID: 23741617 | Synthesized in-house | |
| Chemical compound | Thapsigargin | Sigma-Aldrich | #T9033 | Stock solution prepared in DMSO |
| Chemical compound | Tunicamycin | Sigma-Aldrich | #T7765 | Stock solution prepared in DMSO |
Additional files
-
Supplementary file 1
Allele sequences of HEK293T mutant cell lines used in this study.
- https://doi.org/10.7554/eLife.32733.014
-
Transparent reporting form
- https://doi.org/10.7554/eLife.32733.015
