(A) Coomassie-stained SDS-PAGE gel of recombinant human eIF2 used as a substrate in the in vitro GEF assays. (B) Multi-angle light scattering analysis of purified eIF2, indicating good agreement …
(A) Primary sequence of the eIF2B δ1 and δ2 isoforms, showing the region in which they differ at the N-terminus of the protein. (B) Coomassie-stained SDS-PAGE gels of purified recombinant human …
(A) VWMD mutations tested in this study, visualized as spheres on the structure of S. pombe eIF2B (PDB: 5B04; Kashiwagi et al., 2016). The human mutation sites are shown in plain text and the …
(A) All eIF2B VWMD mutant complexes except εR136H have reduced GEF activity compared to WT. ISRIB dose-response curves of GDP release half-life for each mutant. Half-lives of GDP release at each …
(A–B) Immunoblotting of eIF2Bδ (representative of the 4mer subcomplex) and eIF2Bα from the SEC experiments in (A) Figure 2E and (B) Figure 3B. Bands shown are simulated representations of the …
(A) ISRIB-resistant mutations tested in this study, visualized as spheres on the structure of S. pombe eIF2B (PDB: 5B04; Kashiwagi et al., 2016). The human mutation sites are shown in plain text and …
(A) Levels of the five eIF2B subunits were measured by immunoblotting (Wes analysis) of lysates from WT and VWMD cell lines. The chemiluminescence signal of each subunit was normalized to α-tubulin …
(A) Schematic of the workflow used to generate VWMD mutant HEK293T cell lines. Cells were co-transfected with a Cas9-OFP-gRNA plasmid and a ssDNA HDR template targeting a specific mutation. …
(A) ISRIB blocks ATF4 induction in VWMD mutants. Immunoblot (Wes analysis) of endogenous ATF4 protein levels in WT and VWMD mutant cells. Total eIF2α was used as a loading control. Cells were …
Tg dose-response curves of ATF4-luciferase reporter activity in WT and VWMD cell lines. Cells were treated with increasing concentrations of Tg for 7 hr (N = 3, mean ± SD). The values for δR483W …
(A) Levels of the five eIF2B subunits were measured by immunoblotting (Wes analysis) of lysates from different cell lines. The cell lines were: HEK293T (human embryonic kidney, SV40-transformed), …
eIF2B subunit | Mutation | Age of disease onset (years) | Disease alleles | HEK293T cells generated | Recombinant protein generated |
---|---|---|---|---|---|
α | V183F | 10–17 | Homozygous* | X | X |
γ | I346T | 1–4 | Homozygous; also compound heterozygous with G47E† | X | - |
δ | R483W | <1 | Homozygous‡ | X | X |
ε | R113H | 1–30 | Homozygous; also compound heterozygous with multiple other mutations§ | X | X |
ε | R136H | 3 | Homozygous# | - | X |
ε | R195H | <1 | Homozygous** | X | X |
δ | L179F | ISRIB-resistant; not naturally occurring†† | - | X | |
δ | L487W | ISRIB-resistant; not naturally occurring | - | X |
*Ohlenbusch et al., 2005
†Wu et al., 2009
‡van der Knaap et al., 2003
§Fogli et al., 2004
#Kantor et al., 2005
**Fogli et al., 2002
††Sekine et al., 2015
Reagent type or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Cell line (H. sapiens) | HEK293T with ATF4-Luc reporter | PMID: 23741617 | ||
Cell line (H. sapiens) | HEK293T (eIF2Bα V183F) with ATF4-Luc reporter | This paper | two clones generated | |
Cell line (H. sapiens) | HEK293T (eIF2Bγ I346T) with ATF4-Luc reporter | This paper | two clones generated | |
Cell line (H. sapiens) | HEK293T (eIF2Bδ R483W) with ATF4-Luc reporter | This paper | two clones generated | |
Cell line (H. sapiens) | HEK293T (eIF2Bε R113H) with ATF4-Luc reporter | This paper | two clones generated | |
Cell line (H. sapiens) | HEK293T (eIF2Bε R195H) with ATF4-Luc reporter | This paper | two clones generated | |
Antibody | Rabbit monoclonal anti-ATF4 | Cell Signaling | #11815 | (1:50) in Wes |
Antibody | Rabbit monoclonal anti-eIF2α | Cell Signaling | #5324 | (1:100) in Wes |
Antibody | Rabbit polyclonal anti-eIF2Bα | ProteinTech | #18010–1-AP | (1:50) in Wes |
Antibody | Rabbit polyclonal anti-eIF2Bβ | ProteinTech | #11034–1-AP | (1:50) in Wes |
Antibody | Rabbit polyclonal anti-eIF2Bγ | ProteinTech | #11296–2-AP | (1:25) in Wes |
Antibody | Rabbit polyclonal anti-eIF2Bδ | ProteinTech | #11332–1-AP | (1:50) in Wes |
Antibody | Rabbit polyclonal anti-eIF2Bε | Bethyl Labs | #A302-556 | (1:50) in Wes |
Antibody | Mouse monoclonal anti-tubulin | Cell Signaling | #3873 | (1:50) in Wes |
Recombinant DNA reagent | CRISPR nuclease vector with OFP reporter | Thermo Fisher | #A21174 | |
Sequence-based reagent | eIF2Bα V183F guide RNA | This paper | GTGGTGCTAGATGCTGCTGTCGG | |
Sequence-based reagent | eIF2Bγ I346T guide RNA | This paper | TGACAATCTGGGCTGACGAATGG | |
Sequence-based reagent | eIF2Bδ R483W guide RNA | This paper | GACTAGATTCAACAACCGTAGGG | |
Sequence-based reagent | eIF2Bε R113H guide RNA | This paper | CCGCCCTACATCTCTCAATGTGG | |
Sequence-based reagent | eIF2Bε R195H guide RNA | This paper | TTGTCTTCGTGGCAACGAGTTGG | |
Recombinant protein | GST-PERK | Thermo Fisher | #PV5106 | Used to phosphorylate eIF2in vitro |
Commercial assay | ONE-GLO luciferase assay | Promega | #E6120 | |
Chemical compound | Bodipy-FL-GDP | Thermo Fisher | #G22360 | |
Chemical compound | ISRIB | PMID: 23741617 | Synthesized in-house | |
Chemical compound | Thapsigargin | Sigma-Aldrich | #T9033 | Stock solution prepared in DMSO |
Chemical compound | Tunicamycin | Sigma-Aldrich | #T7765 | Stock solution prepared in DMSO |
Allele sequences of HEK293T mutant cell lines used in this study.