ZFP36 RNA-binding proteins restrain T cell activation and anti-viral immunity
- Howard Hughes Medical Institute, The Rockefeller University, United States
- New York Genome Center, United States
- Howard Hughes Medical Institute, Ludwig Center at Memorial Sloan Kettering Cancer Center, United States
Figures
Figure 1 with 3 supplements
HITS-CLIP as a transcriptome-wide screen for ZFP36 function in T cells.
(A) Immunoblots with pan-ZFP36 antisera after activation of naïve CD4 +T cells in DC co-cultures, and with re-stimulation at day 3. Antibody and MW markers are shown on the left. NS* indicates a …
Figure 1—figure supplement 1
ZFP36 paralog expression in T cells.
(A) ZFP36 expression was measured by immunoblotting in a time course of CD8 +T -cell activation using pan-ZFP36 antisera. NS *indicates a presumed non-specific band. (B) 293T cells were transfected …
Figure 1—figure supplement 2
ZFP36 HITS-CLIP.
(A) ZFP36 HITS-CLIP autoradiogram with a second pan-ZFP36 antisera (RF2046) is shown, with similar results to RF2047 (Figure 1D). (B) High MW and low MW ZFP36-RNA complexes were analyzed separately, …
Figure 1—figure supplement 3
Regulation of mRNA abundance by ZFP36.
(A) Transcriptome profiling data plotted as RPKM in Zfp36 KO cells versus RPKM in WT cells. Few large changes were observed, with the exception of highlighted mRNAs (e.g. Ig mRNAs) that were silent …
Figure 2 with 1 supplement
ZFP36 regulates target protein levels in T cells.
(A) Levels of mRNA and protein in Zfp36 KO and WT T cells and ZFP36 CLIP tracks measured 4 hr post-activation for targets with robust 3’UTR ZFP36 binding. RNA values are mean RPKM ± S.E.M. of 4 …
Figure 2—figure supplement 1
Protein levels of ZFP36 CLIP targets.
Representative flow cytometry data for analyses in Figure 2A.
Figure 3 with 1 supplement
ZFP36 regulates target ribosome association.
(A) Ribosome profiling of Zfp36 KO and WT CD4 +T cells. (B) Changes in ribosome association between Zfp36 KO and WT cells plotted as a CDF. (C) Change in translation efficiency (ΔTE) between Zfp36 …
Figure 3—figure supplement 1
Analysis of ZFP36 translational control by ribosome profiling.
(A) Outline of biochemical strategy to isolate ribosome-protected fragments (RPFs), corresponding to ribosome associated mRNAs. (B) Normalized RPF read coverage is shown for ZFP36 mRNA in WT and Zfp3…
Figure 4 with 2 supplements
ZFP36 regulates T-cell activation kinetics.
(A) Gene expression patterns from a T-cell activation time course (Yosef et al., 2013) were partitioned by k-means, and enrichment of ZFP36 3’UTR and CDS targets was determined across clusters …
Figure 4—figure supplement 1
ZFP36 targets regulate T-cell activation.
The T cell activation KEGG pathway is shown with robust ZFP36 CLIP targets shaded based on the location and timing of ZFP36 binding.
Figure 4—figure supplement 2
ZFP36 regulates early activation across T cell lineages.
(A) Measurement of proliferation after activation of CD8 +T cells, varying TCR signal strengths (anti-CD3); co-stimulation (DCs); and the presence of recombinant IL-2. The mean c.p.m. ± S.E.M. of …
Figure 5
ZFP36 regulation of T cell activation kinetics cell-intrinsic.
(A) Lethally irradiated mice were reconstituted with congenically marked WT and Zfp36 KO BM to generate mixed chimeras. 10–12 weeks after reconstitution, naïve CD4 +WT and Zfp36 KO T cells were …
Figure 6 with 2 supplements
Accelerated signs of in vitro T cell exhaustion in absence of ZFP36.
(A) Log2-transformed RPKM values from Zfp36 KO versus WT CD4 +Th1 cell RNAseq 72 hr post-activation, with red indicating differential expression (FDR < 0.05). Lines mark 2-fold changes. RNAseq data …
Figure 6—figure supplement 1
Analysis of ZFP36 function 3 days after T cell activation.
(A) Top enriched motifs and (B) annotation of ZFP36 HITS-CLIP sites from CD4 +T cells activated for 3 days under Th1 conditions. Site distribution was similar to the 4 hr time point, except for …
Figure 6—figure supplement 2
Dysfunction of Zfp36 KO T cells at late time points.
(A) GSEA analysis found that genes promoting proliferation and cell division, including transcriptional targets of E2F and Myc, were down-regulated in Zfp36 KO Th1 cells versus WT 3 days after …
Figure 7 with 3 supplements
ZFP36 regulates anti-viral immunity.
(A) Virus-specific CD4 + or (B) CD8 +T cells were tracked in peripheral blood using MHC-tetramers after LCMV Armstrong infection (n = 8–9 mice per genotype). (C) Virus-specific CD4 +T cells and CD69 …
Figure 7—figure supplement 1
The T cell compartment in naïve Zfp36 KO mice is largely normal.
(A) Counts of CD4 +and CD8+T cells in peripheral blood of WT and Zfp36 KO mice (n = 9–10 per genotype). Mean values ± S.E.M are shown; circles are individual mice (n = 9–10 per genotype) (B) Counts …
Figure 7—figure supplement 2
ZFP36 regulates anti-viral immunity.
(A) The fraction of CD8 +T cells producing IFN-γ and IFN-γ proteins levels were measured splenic CD8 +T cells by ICS 6 days post-infection, after ex vivo stimulation with the LCMV antigenic peptide …
Figure 7—figure supplement 3
LCMV infection in mixed bone marrow chimeras.
(A) Schematic of mixed chimeric experiments. (B) Analysis of T cell numbers in peripheral blood in mixed bone marrow chimeras 10 weeks after constitution. Values were normalized to levels of Thy1.1 …
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Zfp36 | NA | Entrez ID: 22695 | |
| Gene (M. musculus) | Zfp36l1 | NA | Entrez ID: 12192 | |
| Gene (M. musculus) | Zfp36l2 | NA | Entrez ID: 12193 | |
| Strain (M. musculus), strain background (C57BL6/J) | C57BL6/J | Jackson Laboratory | Stock No: 000664 | |
| Strain (M. musculus), strain background (C57BL6/J) | ZFP36 KO | PMID:8630730 | gift from P. Blackshear | |
| Strain (M. musculus), strain background (C57BL6/J) | BG2 | PMID:19478869 | gift from N. Restifo | |
| Strain (M. musculus), strain background (C57BL6/J) | Thy1.1 | Jackson Laboratory | Stock No: 000406 | |
| Strain (M. musculus), strain background (C57BL6/J) | CD45.1 | Jackson Laboratory | Stock No: 002014 | |
| Strain (M. musculus), strain background (C57BL6/J) | FoxP3-EGFP | Jackson Laboratory | Stock No: 006769 | |
| Strain (Lymphocytic Choriomeningitis Virus, LCMV), strain background (Armstrong) | LCMV Arm | PMID:6875516 | ||
| Cell line (Homo sapien) | 293 T-rex | Life Technologies | Cat# R71007 | |
| Cell line (H. sapien) | 293T | ATCC | ATCC Cat# CRL-3216, RRID:CVCL_0063 | |
| Cell line (M. musculus) | J558L/GM-CSF | PMID:1460426 | ||
| Transfected construct (M. musculus) | pOZ-N-FH-ZFP36 | This study | mouse Zfp36 ORF in pOZ-N vector | |
| Transfected construct (M. musculus) | pOZ-N-FH-ZFP36L1 | This study | mouse Zfp36l1 ORF in pOZ-N vector | |
| Transfected construct (M. musculus) | pOZ-N-FH-ZFP36L2 | This study | mouse Zfp36l2 ORF in pOZ-N vector | |
| Transfected construct | pOZ-N-FH vector | PMID:14712665 | ||
| Transfected construct | pcDNA3.1(+) | Life Technologies | Cat# V79020 | |
| Transfected construct | pcDNA3.1(+)-Acgfp1- IFNG-WT-UTR | This paper | Acgfp1 with mouse Ifng 3'UTR | |
| Transfected construct | pcDNA3.1(+)-Acgfp1- IFNG-WT-UTR | This paper | Acgfp1 with mouse Ifng 3'UTR with Zfp36 binding site deleted | |
| Transfected construct | pcDNA5/FRT/TO | Life Technologies | Cat# V652020 | |
| Transfected construct | pcDNA5/FRT/TO/ Acgfp1-TNF-WT-UTR | This paper | Acgfp1 with mouse Tnf 3'UTR | |
| Transfected construct | pcDNA5/FRT/TO/ Acgfp1-TNF-Δ-UTR | This paper | Acgfp1 with mouse Tnf 3'UTR with Zfp36 binding site deleted | |
| Transfected construct | pcDNA5/FRT/TO/ Acgfp1-CD69-WT-UTR | This paper | Acgfp1 with mouse Cd69 3'UTR | |
| Transfected construct | pcDNA5/FRT/TO/ Acgfp1-CD69-Δ-UTR | This paper | Acgfp1 with mouse Cd69 3'UTR with Zfp36 binding site deleted | |
| Antibody | Rabbit anti-pan- ZFP36 RF2046 | This paper | Covance custom service | 1:2000 for Western |
| Antibody | Rabbit anti-pan- ZFP36 RF2047 | This paper | Covance custom service | 1:2000 for Western |
| Antibody | anti-Br-dU | Millipore | Millipore Cat# MAB3222; RRID:AB_11212494 | 5 μg per IP |
| Antibody | rabbit anti-TTP/ZFP36 | Sigma | Sigma-Aldrich Cat# T5327; RRID:AB_1841222 | 1:500 |
| Antibody | rabbit anti-ZFP36L1/2 (BRF1/2) | CST | Cell Signaling Technology Cat# 2119S; RRID:AB_10695874 | 1:500 |
| Antibody | mouse anti-FLAG | Sigma | Sigma-Aldrich Cat# F3165; RRID:AB_259529 | 1:500 |
| Antibody | mouse anti-FUS | Santa Cruz | Santa Cruz Biotechnology Cat# sc-47711; RRID:AB_2105208 | 1:1000 |
| Antibody | rabbit anti-FUS | Novus | Novus Cat# NB100-562; RRID:AB_10002858 | 1:10000 |
| antibody | goat anti-rabbit-IgG- 680RD | LICOR | LI-COR Biosciences Cat# 925–68071; RRID:AB_2721181 | 1:25000 |
| Antibody | goat anti-rabbit-IgG- 800CW | LICOR | LI-COR Biosciences Cat# 925–32211; RRID:AB_2651127 | 1:25000 |
| Antibody | goat anti-mouse-IgG- 800CW | LICOR | LI-COR Biosciences Cat# 925–32210; RRID:AB_2687825 | 1:25000 |
| Antibody | anti-CD4-PerCP-Cy5.5 | BD Biosciences | BD Biosciences Cat# 550954; RRID:AB_393977 | 1:400 |
| Antibody | anti-CD25-PE/Cy7 | Biolegend | BioLegend Cat# 102016; RRID:AB_312865 | 1:400 |
| Antibody | anti-CD62L-APC | BD Biosciences | BD Biosciences Cat# 561919; RRID:AB_10895379 | 1:800 |
| Antibody | anti-CD44-PE | BD Biosciences | BD Biosciences Cat# 560569; RRID:AB_1727484 | 1:1000 |
| Antibody | anti-CD8-BV510 | Biolegend | BioLegend Cat# 100752; RRID:AB_2563057 | 1:400 |
| Antibody | anti-Thy1.2-BUV395 | BD Biosciences | BD Biosciences Cat# 565257 | 1:200 |
| Antibody | anti-Thy1.1-FITC | Biolegend | BioLegend Cat# 202504; RRID:AB_1595653 | 1:400 |
| Antibody | anti-CD19-eFlour780 | eBiosciences | Thermo Fisher Scientific Cat# 47-0193-82; RRID:AB_10853189 | 1:200 |
| Antibody | anti-CD11b-eFlour780 | eBiosciences | Thermo Fisher Scientific Cat# 47-0112-82; RRID:AB_1603193 | 1:200 |
| Antibody | anti-CD11c-eFlour780 | eBiosciences | Thermo Fisher Scientific Cat# 47-0114-80; RRID:AB_1548663 | 1:100 |
| Antibody | anti-NK1.1-eFlour780 | eBiosciences | Thermo Fisher Scientific Cat# 47–5941; RRID:AB_10853969 | 1:100 |
| Antibody | anti-CD69-FITC | Biolegend | BioLegend Cat# 104506; RRID:AB_313109 | 1:200 |
| Antibody | anti-BCL2-PE/Cy7 | Biolegend | BioLegend Cat# 633512; RRID:AB_2565247 | 1:200 |
| Antibody | anti-TNF-APC/Cy7 | BD Biosciences | BD Biosciences Cat# 560658; RRID:AB_1727577 | 1:200 |
| Antibody | anti-IFNG-Alexa647 | BD Biosciences | BD Biosciences Cat# 557735; RRID:AB_396843 | 1:1000 |
| Antibody | anti-Ki67-PE/Cy7 | Biolegend | BioLegend Cat# 652426; RRID:AB_2632694 | 1:200 |
| Antibody | anti-CD44-BUV737 | BD Biosciences | BD Biosciences Cat# 564392 | 1:400 |
| Antibody | anti-PD-1-PE/Cy7 | Biolegend | BioLegend Cat# 135216; RRID:AB_10689635 | 1:200 |
| Antibody | anti-LAG3-APC | Biolegend | BioLegend Cat# 125210; RRID:AB_10639727 | 1:200 |
| Antibody | anti-ICOS-PE | Biolegend | BioLegend Cat# 107706; RRID:AB_313335 | 1:200 |
| Antibody | anti-mouse-IL-2 (neutralizing) | Biolegend | BioLegend Cat# 503705; RRID:AB_11150768 | 10 μg/ml |
| Antibody | anti-mouse-CD3e (stim) | Biolegend | BioLegend Cat# 100314; RRID:AB_312679 | 0.25 μg/ml |
| Antibody | anti-mouse-CD28 (co-stim) | Biolegend | BioLegend Cat# 102112; RRID:AB_312877 | 1 μg/ml |
| Other, MHC tetramer | LCMV GP33-41-specific H-2Db- MHC-tetramer, PE conjugate | MBL | Cat# TS-M512-1 | 1:400 |
| Other, MHC tetramer | LCMV GP66-77-specific I-Ab- MHC-tetramer, APC conjugate | NIH Tetramer Core Facility | 1:300 | |
| Peptide, recombinant protein | LCMV GP33-41 peptide KAVYNFATM | Life Technologies | Custom synthesis | |
| Peptide, recombinant protein | LCMV GP66-77 peptide DIYKGVYQFKSV | Life Technologies | Custom synthesis | |
| Peptide, recombinant protein | Ovalbumin p257 peptide SIINFEKL | Life Technologies | Custom synthesis | |
| Peptide, recombinant protein | Ovalbumin p323 peptide ISQAVHAAHAEINEAGR | Life Technologies | Custom synthesis | |
| Peptide, recombinant protein | Recombinant mouse TNF-α | R and D Systems | Cat# 410-MT-050 | |
| Peptide, recombinant protein | Recombinant human IL-2 | Peprotech | Cat# 200–02 | |
| Peptide, recombinant protein | Recombinant mouse IL-12 | eBiosciences | Cat# 14-8121-80 | |
| Peptide, recombinant protein | Recombinant mouse IL-23 | eBiosciences | Cat# 14-8231-63 | |
| Peptide, recombinant protein | Recombinant mouse IL-6 | eBiosciences | Cat# 14–8061 | |
| Peptide, recombinant protein | Recombinant human TGF-β1 | R and D Systems | Cat# 240-B-010 | |
| Peptide, recombinant protein | T4 Polynucleotide Kinase | New England Biolabs | Cat# M0201L | |
| Peptide, recombinant protein | T4 RNA ligase 2, truncated KQ | New England Biolabs | Cat# M0373L | |
| Peptide, recombinant protein | CircLigase | Epicentre | Cat# CL4115K | |
| Peptide, recombinant protein | Phusion Polymerase | New England Biolabs | Cat# M0530L | |
| Peptide, recombinant protein | Micrococcal nuclease | New England Biolabs | Cat# M0247S | |
| Peptide, recombinant protein | RNAsin Plus | Promega | Cat# N2611 | |
| Peptide, recombinant protein | RNAse A | Affymetrix | Cat# 70194Y | |
| Peptide, recombinant protein | RNAse I | Thermo Fisher | Cat# EN0601 | |
| Peptide, recombinant protein | alkaline phosphatase | Roche | Cat# 10 713 023 001 | |
| Commercial assay or kit | Xtremegene 9 Transfection Reagent | Roche | Cat# 06 365 787 001 | |
| Commercial assay or kit | Mouse CD4 microbeads | Miltenyi | Cat# 130-049-201 | |
| Commercial assay or kit | Mouse CD8 microbeads | Miltenyi | Cat# 130-049-401 | |
| Commercial assay or kit | Mouse CD11c microbeads | Miltenyi | Cat# 130-108-338 | |
| Commercial assay or kit | Mouse CD19 microbeads | Miltenyi | Cat# 130-052-201 | |
| Commercial assay or kit | Mouse CD11b microbeads | Miltenyi | Cat# 130-049-601 | |
| Commercial assay or kit | Mouse CD4 + CD62L + T cell isolation kit | Miltenyi | Cat# 130-093-227 | |
| Commercial assay or kit | Trizol Reagent | Life Technologies | Cat# 15596026 | |
| Commercial assay or kit | High Pure RNA Isolation Kit | Roche | Cat# 11828665001 | |
| Commercial assay or kit | Truseq RNA Library Kit | Illumina | Cat# RS-122–2001 | |
| Commercial assay or kit | Ribo-Zero rRNA removal kit | Illumina | Cat# MRZH11124 | |
| Commercial assay or kit | Cytofix/Cytoperm Kit | BD Biosciences | Cat# 554722 | |
| Commercial assay or kit | Ampure XP beads | Beckman-Coulter | Cat# A63881 | |
| Commercial assay or kit | Quant-IT dsDNA Assay Kit, High Sensitivity | Life Technologies | Cat# Q33120 | |
| Commercial assay or kit | iQ SYBR Green SuperMix | Biorad | Cat# 1708880 | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | Biorad | Cat# 1708891 | |
| Chemical compound, drug | doxycycline | Sigma | Cat# D9891 | |
| Chemical compound, drug | DAPI | Sigma | Cat# 32670 | |
| Chemical compound, drug | dimethylpidilate (DMP) | Life Technologies | Cat# 21666 | |
| Chemical compound, drug | 5-bromo2’-deoxyuridine | Sigma | Cat# B9285 | |
| Chemical compound, drug | Denhardt’s Solution (50X) | Life Technologies | Cat# 750018 | |
| Chemical compound, drug | cycloheximide | Sigma | Cat# C104450 | |
| Chemical compound, drug | Ribonucleoside vanadyl complexes (RVC) | New England Biolabs | Cat# S1402S | |
| Chemical compound, drug | Live-Dead Fixable Aqua | Life Technologies | Cat# L34957 | |
| Chemical compound, drug | TO-PRO-3 Iodide | Life Technologies | Cat# T3605 | |
| Software, algorithm | CLIP Toolkit (CTK) | PMID:27797762 | ||
| Software, algorithm | STAR Aligner | PMID:23104886 | ||
| Software, algorithm | Bowtie2 | PMID:22388286 | ||
| Software, algorithm | HOMER | PMID:20513432 | ||
| Software, algorithm | GenomicRanges (R Bioconductor) | PMID:23950696 | ||
| Software, algorithm | TxDb.Mmusculus. UCSC.mm10.ensGene (R Bioconductor) | DOI: 10.18129/B9.bioc. TxDb.Mmusculus.UCSC. mm10.knownGene | ||
| Software, algorithm | TopGO (R Bioconductor) | DOI: 10.18129/B9.bioc. topGO | Adrian Alexa, Jorg Rahnenfuhrer | |
| Software, algorithm | edgeR (R Bioconductor) | PMID:19910308 | ||
| Software, algorithm | HTseq | PMID:25260700 | ||
| Software, algorithm | Cluster 3.0 | PMID:14871861 | ||
| Software, algorithm | Java Treeview | PMID:15180930 | ||
| Software, algorithm | Gene Set Enrichment Analysis (GSEA) | PMID:16199517 |
Table 1
Oligonucleotide sequences
https://doi.org/10.7554/eLife.33057.022| Primer name | Sequence | Description |
|---|---|---|
| cloning | ||
| MJM9 | ATGACTCGAGGATCTCTCTGCCATCTACGAGAGCC | mouse ZFP36 forward XhoI primer |
| MJM10 | ATGAGCGGCCGCTCACTCAGAGACAGAGATACGATTGAAGATGG | mouse ZFP36 reverse NotI primer |
| MJM266 | ATGACTCGAGACCACCACCCTCGTGTCC | mouse ZFP36L1 forward XhoI primer |
| MJM267 | ATGAGCGGCCGCTTAGTCATCTGAGATGGAGAGTCTGC G | mouse ZFP36L1 reverse NotI primer |
| MJM270 | ATGACTCGAGTCGACCACACTTCTGTCACCC | mouse ZFP36L2 forward XhoI primer |
| MJM271 | ATGAGCGGCCGCTCAGTCGTCGGAGATGGAGAGG | mouse ZFP36L2 reverse NotI primer |
| RT-qPCR | ||
| GP-f | CATTCACCTGGACTTTGTCAGACTC | LCMV RNA forward qPCR |
| GP-r | GCAACTGCTGTGTTCCCGAAAC | LCMV RNA reverse qPCR |
| MJM432 | GATTGTGGGACATCCTGGTC | mouse RPL10A forward qPCR |
| MJM433 | TCAGACCCATGACTGCTGAG | mouse RPL10A reverse qPCR |
| MJM500 | AACATCGAAGACGGCTCTGT | IFNG reporter forward qPCR |
| MJM501 | GCGCTCTGTGTGGACAAGTA | IFNG reporter reverse qPCR |
| MJM504 | CCACTACCTGAGCACCCAGT | CD69 and TNF reporters forward qPCR |
| MJM505 | GAACTCCAGCAGGACCATGT | CD69 and TNF reporters reverse qPCR |
| GAPDH-f | GTCTCCTCTGACTTCAACAGCG | human GAPDH forward qPCR |
| GAPDH-r | ACCACCCTGTTGCTGTAGCCAA | human GAPDH reverse qPCR |
| HITS-CLIP and ribosome profiling | ||
| preA-L32 | /5rApp/GTGTCAGTCACTTCCAGCGG/3ddc/ | Pre-Adenylated 3' ligation linker |
| RT1 | /5Phos/DDDCGATNNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT2 | /5Phos/DDDTAGCNNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT3 | /5Phos/DDDATCGNNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT4 | /5Phos/DDDGCTANNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT5 | /5Phos/DDDCTAGNNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT6 | /5Phos/DDDGATCNNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT7 | /5Phos/DDDAGTCNNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| RT8 | /5Phos/DDDTCGANNNNNNNAGATCGGAAGAGCGTCGT/iSp18/CACTCA/iSp18/CCGCTGGAAGTGACTGAC | Indexed RT primer |
| DP5-PE | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | forward PCR primer, Illumina adapter |
| SP3-PE | CAAGCAGAAGACGGCATACGAGATCTCGGCATTCCTGCCGCTGGAAGTGACTGACAC | reverse PCR primer, Illumina adapter |
| PE-R1 | ACACTCTTTCCCTACACGACGCTCTTCCGATCT | sequencing primer (standard Illumina read 1) |
Additional files
-
Supplementary file 1
ZFP36 binding sites in CD4 +T cells 4 hr post-activation (attached spreadsheet).
Pan-ZFP36 HITS-CLIP peaks (A) in WT CD4 +T cells 4 hr post-activation (B) in Zfp36 KO CD4 +T cells 4 hr post-activation. (C) identified only in Zfp36 KO and not WT cells, and (D) pooled from WT and Zfp36 KO samples. (E) Cross-link induced truncation (CITS) cites from all pooled ZFP36 HITS-CLIP data (FDR < 0.01).
- https://doi.org/10.7554/eLife.33057.023
-
Supplementary File 2
Gene Ontology enrichments for ZFP36 target mRNAs in CD4 +T cells, 4 hr post-activation (attached spreadsheet).
- https://doi.org/10.7554/eLife.33057.024
-
Supplementary File 3
ZFP36 binding sites in CD4 +T cells 72 hr post-activation (attached spreadsheet).
- https://doi.org/10.7554/eLife.33057.025
-
Transparent reporting form
- https://doi.org/10.7554/eLife.33057.026
