Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner

  1. Arun Devotta
  2. Chang-Soo Hong
  3. Jean-Pierre Saint-Jeannet  Is a corresponding author
  1. New York University, United States
  2. Daegu University, Republic of Korea


Neural crest progenitors are specified through the modulation of several signaling pathways, among which the activation of Wnt/β-catenin signaling by Wnt8 is especially critical. Glycoproteins of the Dickkopf (Dkk) family are important modulators of Wnt signaling acting primarily as Wnt antagonists. Here we report that Dkk2 is required for neural crest specification functioning as a positive regulator of Wnt/β-catenin signaling. Dkk2 depletion in Xenopus embryos causes a loss of neural crest progenitors, a phenotype that is rescued by expression of Lrp6 or β-catenin. Dkk2 overexpression expands the neural crest territory in a pattern reminiscent of Wnt8, Lrp6 and β-catenin gain-of-function phenotypes. Mechanistically, we show that Dkk2 mediates its neural crest-inducing activity through Lrp6 and β-catenin, however unlike Wnt8, in a GSK3β independent manner. These findings suggest that Wnt8 and Dkk2 converge on β-catenin using distinct transduction pathways both independently required to activate Wnt/β-catenin signaling and induce neural crest cells.


The neural crest is a population of cells unique to the vertebrate embryo. They are induced at the neural plate border during gastrulation, and around the time of neural tube closure, leave the neuroepithelium to produce a diverse array of cell types, contributing to multiple tissues, including the heart, the peripheral nervous system, and the craniofacial skeleton.

Neural crest cells are generated through a sequence of events orchestrated by the modulation of several signaling pathways and the activation of a complex network of transcription factors (Meulemans and Bronner-Fraser, 2004; Simões-Costa and Bronner, 2015). A large body of evidence in several organisms indicates that attenuation of bone morphogenetic (BMP) signaling in conjunction with activation of Wnt/β-catenin signaling is critical to specify the neural crest (Stuhlmiller and García-Castro, 2012; Bae and Saint-Jeannet, 2014). Canonical Wnt ligands bind to Frizzled (Fzd) receptors and low-density-lipoprotein-related protein (Lrp5/6) co-receptors, which signals through the cytosolic adaptor protein Disheveled leading to inhibition of glycogen synthase kinase 3 (GSK3) and subsequent stabilization of β-catenin. β-catenin then translocates to the nucleus and in association with Tcf/Lef transcription factors activates Wnt target genes (Clevers and Nusse, 2012; MacDonald et al., 2009). Interfering with any components of Wnt/β-catenin signaling pathway blocks neural crest formation in the embryo.

The Dickkopf (Dkk) family of secreted glycoproteins acts primarily as negative modulators of Wnt signaling, this is especially true for Dkk1 and Dkk4 (Niehrs, 2006). Dkks interact with the Wnt co-receptors Lrp5/6, disrupting the binding of Lrp5/6 to the Wnt/Fzd ligand-receptor complex, thereby locally inhibiting Wnt regulated processes (Niehrs, 2006). Dkk1 was first identified for its ability to inhibit Wnt signaling in Xenopus embryos and promote head formation (Glinka et al., 1998). Dkk1 injected embryos formed enlarged heads, and injection of Dkk1 blocking antibodies resulted in microcephalic Xenopus embryos (Carmona-Fontaine et al., 2007). Similarly, Dkk1 deficient mouse embryos lacked most head structures anterior of the otic vesicle (Mukhopadhyay et al., 2001). During neural crest formation, Dkk1 is expressed in the prechordal mesoderm and has been proposed as the inhibitory signal that prevents neural crest formation anteriorly by blocking Wnt/β-catenin signaling (Carmona-Fontaine et al., 2007). The role of Dkk2 is not as well defined. It has been proposed that Dkk2 can either activate or inhibit the pathway, depending on cellular context (Wu et al., 2000; Li et al., 2002; Brott and Sokol, 2002; Li et al., 2005; Mukhopadhyay et al., 2006), however its role during neural crest development has not been studied.

Here we show that Dkk2 knockdown prevents neural crest formation in vivo and in neuralized animal cap explants injected with Wnt8. Furthermore, Dkk2 gain-of-function increases the neural crest progenitor pool, reminiscent of Wnt8, Lrp6 and β-catenin gain-of-function phenotypes. We demonstrate that Dkk2 mediates its neural crest-inducing activity by activation Wnt/β-catenin signaling in a GSK3β independent manner. We propose that during neural crest formation, Lrp6 mediates two independent signaling events triggered by Wnt8 and Dkk2 converging on β-catenin to specify the neural crest.


Dkk2 is required for neural crest formation

To evaluate Dkk2 function in the context of neural crest development we performed knockdown of Dkk2 using morpholino antisense oligonucleotides (MOs). A Dkk2MO was designed to specifically interfere with translation of dkk2 mRNA (Figure 1a). The specificity of the MO was confirmed by Western blot of embryos injected with Dkk2-Flag mRNA and increasing doses of MO (Figure 1b). Unilateral injection of Dkk2MO in the animal region of 2 cell stage embryos resulted in a severe reduction of expression of two neural crest-specific genes snai2 and sox10 in a majority of injected embryos (Figure 1c,d). Concomitant with the loss of these genes the neural plate expression of sox2 appeared broader on the injected side (Figure 1c,d). To confirm the specificity of Dkk2 knockdown phenotype, we used a second MO (Dkk2SMO) that specifically interferes with dkk2 pre-mRNA splicing by targeting the intron 1-exon 2 junction (Figure 1e), resulting in the production of a longer transcript, due to intron 1 retention (Figure 1f; see also Figure 1—figure supplement 1). The phenotype of Dkk2SMO-injected embryos was identical to the phenotype generated by injection of the translation blocking MO, with snai2 and sox10 reduction and sox2 expansion (Figure 1g,h). snai2 expression in morphant embryos was efficiently rescued by injection of 10 pg of Xenopus Dkk2 plasmid DNA further establishing the specificity of the phenotype (Figure 1—figure supplement 2). Later in development, morphant embryos had a marked decrease in the number of melanoblasts visualized by the expression of dct (Figure 1i,j), and exhibited reduced craniofacial cartilages (Figure 1k,l) indicating that multiple neural crest-derivatives are affected in these embryos. The similarity of the two MO knockdown phenotypes, which are interfering with dkk2 translation and splicing respectively, provides strong evidence for a specific requirement of Dkk2 during neural crest formation in vivo.

Figure 1 with 2 supplements see all
Dkk2 knockdown blocks neural crest formation in vivo.

(a) The translation blocking MO (Dkk2MO) targets the initiation codon. (b) Western blot using lysates from embryos injected with Dkk2-Flag mRNA (10 ng) alone or in combination with increasing amounts of Dkk2MO, 2 ng (+), 5 ng (++), and 10 ng (+++), shows that Dkk2MO blocks Dkk2 protein accumulation in vivo. α-tubulin is shown as a loading control. (c) Unilateral injection of Dkk2MO (30 ng) at the 2 cell stage caused a reduction of snai2 and sox10 expression and a lateral expansion of sox2 expression domain (brackets). The injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Dorsal views, anterior to top. (d) Quantification of the Dkk2MO phenotype. (e) Schematic representation of the dkk2 locus. The PCR primers used for the analysis of spliced transcripts are indicated. The position of the splice (Dkk2SMO) blocking MO is shown (red). (f) In Dkk2SMO-injected embryos a larger dkk2 transcript is detected due to intron 1 retention. For all samples, the RT-PCR was performed under the same experimental conditions. (g) Unilateral injection of Dkk2SMO (30 ng) also resulted in a reduction of snai2 and sox10 expression and a lateral expansion of sox2 expression domain (brackets). The injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Dorsal views, anterior to top. (h) Quantification of the Dkk2SMO phenotype. (i) At stage 30, Dkk2SMO-injected embryos show reduced dct expression. Lateral views, dorsal to top. (j) Quantification of the Dkk2SMO phenotype. (k) At stage 45, Dkk2SMO-injected tadpoles (20 ng) have reduced craniofacial structures (left panel). The white line indicates the distance between the brain and the eyes. These tadpoles have reduced craniofacial cartilages as revealed by alcian blue staining (right panel). In both panels the injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Ventral view, anterior to top. (l) Quantification of the results from three independent experiments. In all the graphs (d, h, j, l), the number of embryos analyzed (n) is indicated on the top of each bar.
Figure 1—source data 1

Quantification of Dkk2 knockdown phenotype.

We expanded our analysis to include a broader repertoire of genes expressed at the neural plate border, including the neural plate border specifiers pax3, snai1 and sox8 as well as neural crest specifiers, sox9 and twist1 (Meulemans and Bronner-Fraser, 2004; Hong and Saint-Jeannet, 2007). We found that the neural border specifiers pax3, snai1 and sox8 were only mildly affected in Dkk2-depleted embryos, their expression level was largely unchanged however their expression domain appeared to be shifted laterally (Figure 2a,c). In contrast, the expression of the neural crest specifier twist1 was downregulated, in a manner comparable to the phenotype observed for sox10 and snai2, while sox9 expression domain was either reduced or shifted laterally (Figure 2a,c). Furthermore the expression of the epidermal marker, krt, was reduced in a pattern consistent with the expansion of the neural plate (Figure 2b,c). Finally, the expression of the mesoderm markers myod and actc1 was unchanged in Dkk2-depleted embryos ruling out possible secondary effects. The protocadherin, pcdh8, which is more broadly expressed in the mesoderm was also largely unaffected although its expression was shifted anteriorly in a subset of morphant embryos (Figure 2c and d).

Dkk2 knockdown does not affect the expression of neural plate border specifiers and mesoderm formation.

(a). Unilateral injection of Dkk2SMO (20 ng) did not affect the expression levels of pax3, sox8 and snai1, although their expression was shifted laterally. (b) The neural crest specifier twist1 was reduced, while sox9 expression was shifted laterally in most embryos. The epidermal marker, krt, was reduced in a pattern consistent with the expansion of the neural plate. (c) The expression levels of the mesoderm markers myod, actc1 and pcdh8 were unchanged in Dkk2-depleted embryos, although pcdh8 expression domain was shifted anteriorly in a subset of morphant embryos. (a–c) Dorsal views, anterior to top. (d) Quantification of the Dkk2SMO phenotype. The number of embryos analyzed (n) is indicated on the top of each bar.
Figure 2—source data 1

Quantification of Dkk2 knockdown phenotype.

Altogether these results suggest that Dkk2 does not participate in neural plate border specification but rather plays a role in neural crest progenitors formation and/or maintenance.

We also tested the function of Dkk2 in an animal cap explant assay. Activation of the Wnt/β-catenin pathway in conjunction with attenuation of BMP signaling induces neural crest genes in animal cap explants (Figure 3a; Saint-Jeannet et al., 1997; LaBonne and Bronner-Fraser, 1998). We found that the induction of snai2 by Wnt8 and noggin (a BMP antagonist) was significantly repressed in Dkk2-depleted (Dkk2SMO-injected) animal cap explants, while co-injection of a control MO (CoMO) had no effect on snai2 induction (Figure 3b). The reduction in snai2 expression in these explants was associated with a significant increase in sox2 expression, indicative of a loss of neural crest fate through inhibition of Wnt/β-catenin signaling (Figure 3c). Consistent with this activity, Dkk2 depletion completely blocked the induction of the Wnt-responsive TOP-FLASH reporter by expression of Wnt8 in animal cap explants (Figure 3d). Importantly, Dkk2 knockdown had no significant effect on the induction of neural tissue (sox2) by BMP inhibition or mesoderm (bra) by fibroblast growth factor 8b (FGF8b) in these explants (Figure 3e,f), further suggesting that Dkk2 acts specifically in Wnt/β-catenin signaling pathway. Altogether, these results indicate that Dkk2 is critical for Wnt-mediated neural crest induction in both the whole embryo and animal cap explants, thereby, positioning Dkk2 as a key regulator of neural crest specification in Xenopus.

Dkk2 knockdown blocks neural crest induction by Wnt8 in neuralized animal cap explants.

(a) At the 2 cell stage, mRNAs encoding noggin (50 pg) and wnt8 (100 pg) were injected in the animal pole region alone or in combination with Dkk2SMO (30 ng) or CoMO (30 ng). At the blastula stage (NF stage 9), animal cap explants were dissected and cultured for 8 hr and analyzed by qRT-PCR. (b–c) Attenuation of Bmp signaling in combination with Wnt8 induces snai2 expression. Dkk2SMO blocks snai2 induction by Wnt8 to promote neural plate fate (sox2 expression). A CoMO had no effect on the neural crest-inducing activity of Wnt8. (d) wnt8 (100 pg mRNA) expression activates a TOP-FLASH reporter (10 pg DNA) construct in animal cap explants, an activity that is completely blocked by Dkk2SMO coinjection (30 ng). (e) The induction of the neural plate gene sox2 by noggin (50 pg mRNA), and (f) the induction of the mesoderm gene bra by Fgf8b (100 pg mRNA) were unaffected by Dkk2SMO injection (30 ng). Graph represents mean ± s.e.m. of 3 independent experiments. *p<0.03; paired two tailed Student’s t-test. n.s. not significant.

Developmental expression of Dkk2

We next analyzed the expression of dkk2 during neural crest development. By qRT-PCR, dkk2 is maternally expressed and dkk2 transcripts start to accumulate at gastrulation (NF stage 12.5/13), consistent with a potential role in neural crest induction. This expression increases over time to reach a maximum around stage 20 and then progressively declines (Figure 4a). By in situ hybridization dkk2 is broadly expressed at these stages, and does not appear to be distinctly enriched dorsally around the time of neural crest specification (Figure 4b). Later in embryogenesis (NF stage 40) dkk2 accumulates in the gills and the developing heart (Wu et al., 2000). While dkk1 is enriched anteriorly at the neurula stage, dkk2 appears to be more abundant posteriorly (Figure 4c; Carmona-Fontaine et al., 2007). Altogether this expression suggests a broad requirement for Dkk2 during Wnt/β-catenin signaling. Therefore the regionalized expression of other components of the pathway, such as Fzd receptors and Wnt ligands, is likely to provide the spatiotemporal cues to achieve a localized response.

Developmental expression of dkk2.

(a) Temporal expression of dkk2.L and dkk2.S by qRT-PCR. (b) By in situ hybridization, at all stages examined (NF stage 11-33/34) dkk2 does not appear to be spatially restricted. Sense probe is shown as a control. (c) qRT-PCR analysis of dkk1 and dkk2 expression in dissected embryos at stage 15. WE; whole embryo; D, dorsal half; V, ventral half; A, anterior half; P, posterior half. The values were normalized to Ef1a and presented as mean ± s.e.m. * p<0.05, Student’s t-test.

Lrp6 and β-catenin can rescue neural crest formation in Dkk2-depleted embryos

In order to firmly establish that Dkk2 is functioning in Wnt/β-catenin signaling pathway during neural crest formation we analyzed the ability of Wnt8, Lrp6 or β-catenin to restore neural crest formation in Dkk2-depleted embryos. Activation of Wnt signaling before the mid-blastula transition (MBT) results in axis duplication, while Wnt activation post-MBT expands neural crest progenitors (Saint-Jeannet et al., 1997; LaBonne and Bronner-Fraser, 1998). For these experiments we injected plasmid DNA, which becomes transcribed only after MBT. We found that injection of β-catenin or Lrp6 DNA was quite potent at restoring snai2 expression in Dkk2-depleted embryos, while injection of Wnt8 DNA was less efficient (Figure 5a,b). This rescue assay indicates that these factors are functioning in the same pathway, and that Dkk2 is acting upstream of Lrp6 and β-catenin during neural crest formation.

Expression of Lrp6 and β-catenin rescue neural crest formation in Dkk2-depleted embryos.

(a) Unilateral injection of Dkk2SMO (30 ng) reduced snai2 expression. This phenotype was efficiently rescued by injection of plasmid DNA encoding lrp6 (50 pg) or β-catenin (50 pg), and to a lesser extent by plasmid DNA encoding wnt8 (200 pg). Single injection of either plasmid DNA expanded snai2 expression domain. The injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Dorsal views, anterior to top. (b) Quantification of the phenotypes. The number of embryos analyzed (n) is indicated on the top of each bar.
Figure 5—source data 1

Quantification of Dkk2 knockdown phenotype upon β-catenin, lrp6 or wnt8 coexpression.

Dkk2 promote neural crest formation in the embryo but cannot substitute for Wnt8 activity in neuralized animal cap explants

We next analyzed the gain-of-function phenotype of Dkk2, by injection of dkk2 mRNA (500 pg) or plasmid DNA (25 pg) in one cell at the 2 cell stage. Dkk2 overexpression in both cases resulted in a lateral expansion of snai2 expression domain in the vast majority of the embryos (Figure 6a,b). A similar lateral expansion was also observed for sox8, sox9 and sox10 (not shown). This phenotype is very reminiscent of Wnt8, Lrp6 and β-catenin gain-of-function phenotypes (Tamai et al., 2000; Hong et al., 2008) suggesting that these factors are functioning in the same pathway. To demonstrate that this activity is not a unique feature of Xenopus dkk2, we injected zebrafish and human Dkk2 plasmid DNA in the embryo and found that both were also capable of expanding snai2 expression domain, although at a lower frequency (Figure 6c,d). This is in contrast to the well-described activity of Dkk1, which blocks snai2 expression when misexpressed in the embryo (Figure 6c,d; Carmona-Fontaine et al., 2007). Dkk2 overexpression had no impact on the expression of three genes expressed in the mesoderm myod, actc1 and pcdh8 (Figure 6e,f). We also tested the ability of Dkk2 to induce snai2 in animal cap explants neuralized by noggin. Interestingly, in this context Dkk2 was unable to induce snai2 (Figure 6g) indicating that Dkk2 is not functionally equivalent to Wnt8 in activating Wnt/β-catenin signaling pathway.

Dkk2 overexpression induces snai2 expression in vivo but cannot substitute for Wnt8 activity in neuralized animal cap explants.

(a) Unilateral injection of dkk2 mRNA (500 pg) or dkk2 plasmid DNA (25 pg) expanded snai2 expression domain laterally. (b) Quantification of the Dkk2 overexpression phenotype. The number of embryos analyzed (n) is indicated on the top of each bar. (c) Zebrafish or Human Dkk2 plasmid DNA injections also expanded snai2 expression, while dkk1 overexpression blocked snai2 expression. (e) The expression of the mesoderm markers myod, actc1 and pcdh8 was unchanged upon Dkk2 overexpression. (d, f) Quantification of the phenotypes. The number of embryos analyzed (n) is indicated on the top of each bar. (a, c, e) The injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Dorsal views, anterior to top. (g) Unlike wnt8, injection of dkk2 mRNA (500 pg) is unable to induce snai2 in animal cap explants neuralized by noggin.
Figure 6—source data 1

Quantification of Dkk2 gain-of-function phenotype.

Dkk2 neural crest-inducing activity requires active Wnt/β-catenin signaling

We next wished to determine whether Dkk2 mediated its neural crest-inducing activity in the embryo by activation of Wnt/β-catenin signaling. To test this we analyzed the ability of overexpressed Dkk2 to rescue snai2 expression domain in the context of β-catenin-, Lrp6- or Wnt8-depleted embryos, using well-characterized MOs (Heasman et al., 2000; Hassler et al., 2007; Park and Saint-Jeannet, 2008). We found that in all three conditions Dkk2 was unable to restore snai2 expression in these embryos (Figure 7a,b). These results indicate that β-catenin, Lrp6 and Wnt8 are all required for Dkk2 neural crest-inducing activity in vivo, and that Dkk2 induces neural crest via activation of Wnt/β-catenin signaling.

Dkk2 neural crest-inducing activity requires active Wnt/β-catenin signaling.

(a) Unilateral injection of dkk2 plasmid DNA (50 pg) expanded snai2 expression domain laterally (arrowhead). This activity was blocked in the context of β-catenin- (β-catMO; 20 ng), Lrp6- (Lrp6MO; 20 ng) or Wnt8- (Wnt8MO; 40 ng) depleted embryos. The injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Dorsal views, anterior to top. (b) Quantification of the phenotypes. The number of embryos analyzed (n) is indicated on the top of each bar.
Figure 7—source data 1

Quantification of β-catenin, Lrp6 and Wnt8 knockdown phenotypes upon Dkk2 coexpression.

Dkk2 activates Wnt/β-catenin signaling independently of GSK3β

Activation of Wnt/β-catenin signaling pathway is mediated through inhibition of GSK3β resulting in stabilization of β-catenin and its subsequent translocation to the nucleus to activate Wnt responsive genes. To gain further mechanistic insights into the activity of Dkk2 during neural crest induction, we compared the ability of BIO, a pharmacological GSK3-specific inhibitor (Sato et al., 2004), to rescue neural crest formation in Dkk2-depleted embryos and embryos overexpressing Dkk1. Control embryos treated with 10 μM BIO exhibited ectopic sox10 expression anteriorly in a region where Wnt signaling is normally blocked by Dkk1 activity (Figure 8a,b; Carmona-Fontaine et al., 2007). In Dkk1-injected embryos sox10 expression was efficiently rescued, consistent with Dkk1 interference with Wnt-mediated GSK3β inhibition. By contrast BIO treatment was unable to restore sox10 expression in the neural crest forming region of Dkk2-depleted embryos (Figure 8a,b). These observations further highlight the opposite function of these two Dkk family members, and indicate that Dkk2 mediates its neural crest-inducing activity through a branch of the Wnt/β-catenin signaling pathway that does not involve GSK3β inhibition.

Dkk2 mediates its activity independently of GSK3.

(a) BIO treatment (10 μM) expanded sox10 expression domain anteriorly. Unilateral injection of Dkk2SMO (30 ng) reduced sox10 expression a phenotype that cannot be rescued by BIO treatment. In contrast the Wnt inhibitory activity of Dkk1 (50 pg) on sox10 expression was efficiently rescued by BIO treatment. The injected side (arrowheads) is to the right as indicated by the presence of the lineage tracer (Red-Gal). Dorsal views, anterior to top. (b) Quantification of the phenotypes. The number of embryos analyzed (n) is indicated on the top of each bar.
Figure 8—source data 1

Quantification of Dkk2 knockdown and Dkk1 overexpression phenotypes upon BIO treatment.


It is widely accepted that Dickkopf proteins act as extracellular antagonists of Wnt/β-catenin signaling in development and cancer (Niehrs, 2006). In this study we show that one member of this family, Dkk2, acts in concert with Wnt ligands to activate Wnt/β-catenin signaling and promote neural crest formation. While overexpression studies have previously shown that Dkk2 can function as an activator of Wnt/β-catenin signaling when co-expressed with Fzd8 or Lrp6 (Wu et al., 2000; Brott and Sokol, 2002; Li et al., 2002), here we provide evidence for its positive role in a Wnt/β-catenin regulated developmental process. Dkk2 knockdown blocks and Dkk2 overexpression expands neural crest gene expression in the embryo. We show that Dkk2 mediates its neural crest-inducing activity through Lrp6 and β-catenin, however unlike Wnt8 in a GSK3β independent manner. We propose that during neural crest induction, Lrp6 mediates two independent signaling events triggered by Wnt8 and Dkk2, converging on β-catenin to promote neural crest formation (Figure 9).

Figure 9 with 1 supplement see all
Model for neural crest induction by Dkk2 and Wnt8.

During neural crest induction, Lrp6 mediates two independent signaling events triggered by Wnt8 and Dkk2 converging on β-catenin to promote neural crest formation (snai2 induction). The Lrp6/Wnt/Fzd complex signals through disheveled (DVL) leading to inhibition of GSK-3β and stabilization of β-catenin. The Lrp6/Dkk2 complex signals through an alternate pathway converging on β-catenin. The components of this alternate pathway are unknown.

One of the hallmarks of Dickkopf proteins is their ability to negatively modulate Wnt signaling, a well documented activity of Dkk1 (Glinka et al., 1998Semënov et al., 2001; Mukhopadhyay et al., 2001). Similarly Dkk2 has been shown to regulate several developmental processes including eye, heart and palate development through its inhibitory function (Mukhopadhyay et al., 2006; Gage et al., 2008; Phillips et al., 2011; Li et al., 2017). However, the situation for Dkk2 is somewhat more complex as its activity appears to be context dependent. For example, unlike Dkk1, Dkk2 does not promote the formation of enlarged heads when overexpressed in Xenopus embryo, it has in fact the opposite effect generating microcephalic and cyclopic embryos, similar to Wnt8 gain-of-function phenotype (Wu et al., 2000). Dkk2 is also a poor inhibitor of Wnt-8-induced axis duplication as compared to Dkk1 (Krupnik et al., 1999; Wu et al., 2000). Furthermore when overexpressed with Fzd8 or Lrp5/6, Dkk2 can activate Wnt/β-catenin signaling (Wu et al., 2000; Brott and Sokol, 2002; Li et al., 2002), and in Xenopus this activity can be blocked by Dkk1 expression (Mao and Niehrs, 2003). The molecular mechanism underlying these functional differences is not well understood. The Dkks are characterized by the presence of two conserved cysteine-rich domains, an N-terminal cysteine-rich domain, known as Dkk_N, and a C-terminal cysteine-rich domain, resembling a colipase fold (Niehrs, 2006). Structure function analyses using chimeric constructs and the axis duplication assay as readout have revealed that the different activities of Dkk1 and Dkk2 rest on the unique properties of their respective Dkk_N domains, while the C-terminal cysteine-rich domain primarily promotes Lrp6 signaling (Brott and Sokol, 2002). Similarly in cultured cells, the C-terminal region of Dkk2 inhibited Wnt3a signaling, but activated a Wnt-responsive promoter upon LRP6 co-expression (Li et al., 2002). Another study, has proposed a different mechanism by which the inhibitory activity of Dkk2 was primarily dependent on the presence of the Dkk receptor, kremen2, possibly by promoting internalization of the receptor complex, thereby preventing Lrp6 signaling. When kremen2 is absent, Dkk2 acts as an activator of the pathway (Mao and Niehrs, 2003).

Gain-of-function experiments indicate that Dkk2 is a potent inducer of neural crest genes in the embryos. Dkk2 requires Lrp6 and β-catenin to promote neural crest formation, suggesting that Dkk2 mediates its neural crest-inducing activity through activation of Wnt/β-catenin signaling. This activity is not a unique feature of Xenopus Dkk2, as Human and zebrafish Dkk2 were also capable of inducing neural crest genes in the embryo. Interestingly, Dkk2 was unable to induce neural crest formation in neuralized animal cap explants, indicating that Dkk2 in this context cannot substitute for Wnt8. This result suggests that signaling by Wnt8 and Dkk2 are likely to be concurrently required to activate the Wnt/β-catenin pathway during neural crest specification.

Dkk2-/- mutant mice are characterized by low bone density and osteopenia (Li et al., 2005). These animals have also a complete conversion of the corneal epithelium into stratified epithelium with epidermal characteristics. Analysis of a Wnt reporter (TOP-GAL) indicates that these mutants have increased Wnt/β-catenin signaling in the cornea (Mukhopadhyay et al., 2006). Our loss-of-function experiments point to a role of Dkk2 as a positive regulator of Wnt/β-catenin signaling. Using two distinct MOs interfering with Dkk2 mRNA translation and splicing we found that Dkk2 was required for neural crest induction in vivo and in animal cap explants. In these explants activation of the Wnt responsive TOP-FLASH reporter was also dependent on Dkk2 activity. The ability of Lrp6 and β-catenin to rescue Dkk2 knockdown phenotype, together with the fact that the GSK3 inhibitor (BIO) failed to restore neural crest gene expression in these embryos, strongly suggest that Dkk2 mediates its activity through Lrp6 and β-catenin, and point to a GSK3β independent function of Dkk2 during neural crest formation. These results are consistent with another study suggesting a DVL and GSK3β independent pathway in the activation of Wnt signaling by Dkk2 and Lrp6 in transfected cells (Li et al., 2002).

It is likely that this activity of Dkk2 as a positive regulator of Wnt/β-catenin signaling will apply to other biological contexts. For example Dkk1 and Dkk2 have been shown to have opposite functions in regulating angiogenesis, however it is still unclear whether Dkk2 mediates its activity through the Wnt pathway in this context. Interestingly, we were able to extend our observations (Figure 9) to another Wnt regulated process, axis duplication by Wnt8; (Sokol et al., 1991; Smith and Harland, 1991), demonstrating that Wnt8’s ability to induce secondary axis was directly dependent on Dkk2 function (Figure 9—figure supplement 1). Further studies are needed to identify the downstream effectors of the alternate pathway activated by the Lrp6/Dkk2 complex to understand the precise mechanism of Dkk2-mediated activation of Wnt signaling, and define the underlying mechanisms that contribute to its context dependent activity.

Materials and methods

Plasmids and morpholinos

Request a detailed protocol

Expression constructs for Xenopus, zebrafish and human Dkk2 were generous gifts of Dr. Christof Niehrs (University of Mainz, Mainz, Germany), Dr. Tatiana Piotrowski (Stowers Institute, MO, USA) and Dr. Sergei Sokol (Mount Sinai, NY, USA), respectively. A flagged version of Xenopus Dkk2 was generated by adding a Flag tag (DYKDDDDK) at the C-terminal using the following primers F: GAATTCGCCACCGAGATGAACATGGTTTTGCTGGGGA; R: ctcgagTTACTTGTCGTCGTCGTCCTTGTAGTCTATTTTCTGGCAAATG. The PCR product was cloned into pCS2+ (pCS2+ Dkk2 Flag). Control (CoMO), Dkk2 (Dkk2MO: TCCCCAGCAAAACCATGTTCATCTC; Dkk2SMO: GGAATGCAAATGCCTACAAGATATA), Lrp6 (Lrp6MO; Hassler et al., 2007), β-Catenin (β-CatMO; Heasman et al., 2000), Wnt8 (Wnt8MO; Park and Saint-Jeannet, 2008) morpholino antisense oligonucleotides (MO), were purchased from GeneTools (Philomath, OR). The specificity of the translation blocking MO (Dkk2MO) was tested on Western blot of embryos injected with a Dkk2-Flag mRNA and increasing doses of MO (Figure 1a,b). The splice blocking MO, Dkk2SMO, was validated by RT-PCR on injected embryos (Figure 1e,f) using the following primers E1: TAAGGAGTGTGAAGTTGGAAGG, E3: TTTGAAGAGTAGGTGGCATCTT; I1: AATATCTTCTTAGGGCCCAACTG and E2: GGTCTCAAGTGCTGGGATATG. The efficiency of Dkk2SMO was further established by qRT-PCR (Figure 1—figure supplement 1) using the following primers E1: CACGGAGTCTCACACAAGAAA; E2: GACTGTAGCAGTACCTTCCAA; I2: CAGCACTCTACAGCAGAACAA; and I3: TCCTTCCTCTTGGCTCTTTAAC.

Embryos, injections, and animal cap explants culture

Request a detailed protocol

Xenopus laevis embryos were staged according to Nieuwkoop and Faber, 1967 and raised in 0.1X NAM (Normal Amphibian Medium; Slack and Forman, 1980). This study was performed in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The procedures were approved by New York University Institutional Animal Care and Use Committee, under animal protocol # 150201. Xenopus wnt8 (25 pg; Christian et al., 1991), noggin (10 pg; Smith and Harland, 1992), dkk2 (500 pg; Wu et al., 2000), fgf8b (25 pg; Fletcher et al., 2006) mRNAs were synthesized in vitro using the Ambion Message Machine kit (Austin, TX). For plasmid DNA, 25 pg (dkk2), 200 pg (wnt8) or 50 pg (dkk1, lrp6 and β-catenin) was injected per embryo. MOs, mRNAs and plasmid DNA were injected in one blastomere at the 2 cell stage (NF stage 2) and embryos were analyzed by in situ hybridization at the neurula stage (NF stage 14–17). To identify the injected side, 500 pg of β-galactosidase mRNA was coinjected as a lineage tracer. Only embryos with co-localized expression of the lineage tracer with the cell type marker were considered for analysis. Control and injected embryos were treated in the dark with 10 μM of GSK3 inhibitor (BIO; Sigma-Aldrich, St Louis MO) at the gastrula stage (NF stage 11/11.5), and collected at NF stage 14–17. For the axis duplication assay, embryos were injected in the equatorial region in both ventral blastomeres at 4 cell stage (NF stage 3) and analyzed at NF stage 32. For animal cap explant experiments, both blastomeres at the 2 cell stage (NF stage 2) were injected in the animal pole region. Explants were dissected at the blastula stage (NF stage 9) and cultured for 8 hr in NAM 0.5X. In rescue experiments, the injections of mRNAs/plasmid DNA and MOs were performed sequentially. For whole embryo injections and animal cap explant assays each experiment was performed on at least three independent batches of embryos.

Lineage tracing, whole-mount in situ hybridization and cartilage staining

Request a detailed protocol

Embryos at the appropriate stage were fixed in MEMFA and stained for Red-Gal (Research Organics; Cleveland, OH) to visualize the lineage tracer (β-gal mRNA) on the injected side and processed for in situ hybridization. Antisense digoxygenin-labeled probes (Genius kit; Roche, Indianapolis IN) were synthesized using template cDNA encoding snai1 (Essex et al., 1993), snai2 (Mayor et al., 1995), sox8 (O'Donnell et al., 2006), sox9 (Spokony et al., 2002), sox10 (Aoki et al., 2003), sox2 (Mizuseki et al., 1998), pax3 (Bang et al., 1997), twist1 (Hopwood et al., 1989a), krt (Jonas et al., 1985), myod (Hopwood et al., 1989b), actc1 (Mohun et al., 1984), pcdh8 (Kim et al., 1998) and dct (Aoki et al., 2003). Whole-mount in situ hybridization was performed as described (Harland, 1991; Saint-Jeannet, 2017). Cartilage staining was performed on stage 45 tadpole heads as previously described (Devotta et al., 2016).

Western blot analysis

Request a detailed protocol

Embryos were injected at the 4 cell stage with 10 ng of Xenopus Dkk2-Flag mRNA alone or in the presence of increasing doses of Dkk2MO, and cultured to stage 13. Pools of 10 embryos were homogenized in lysis buffer (0.5% Triton X-100, 10 mM Tris–HCI at pH 7.5, 50 mM NaCl, 1 mM EDTA), containing HaltTM Protease Inhibitor Cocktail (ThermoFisher Scientific; Waltham, MA). After two consecutive centrifugations to eliminate lipids, the lysate was concentrated on an Amicon Ultra Centrifugal Filter (Merck Millipore; Billerica, MA), 5 μl of the concentrated lysate was resolved on a 10% NuPAGE Bis-Tris gel and transferred onto a PVDF membrane using the iBlot system (Invitrogen). Blots were subsequently incubated overnight with one of the following primary antibodies: monoclonal anti-Flag M2 antibody (Sigma Aldrich, F3165; 1:1000 dilution) and anti α-tubulin antibody (Sigma Aldrich, T9026; 1:500 dilution). The blots were then washed and incubated with anti-mouse IgG coupled to horseradish peroxidase (Santa Cruz Biotechnology; 1:10,000 dilution). Peroxidase activity was detected with the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) and imaged on a ChemiDoc MP Biorad gel documentation system (Hercules, CA). Membranes were stripped using Restore Western Blot Stripping Buffer (ThermoFisher Scientific) according to the manufacturer recommendations.

qRT-PCR analysis

Request a detailed protocol

Total RNAs were extracted from embryos or animal cap explants using the RNeasy micro RNA isolation kit (Qiagen, Valencia, CA). The RNA samples were digested with RNase-free DNase I before RT-PCR. The amount of RNA isolated was quantified by measuring the optical density using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE). Approximately 250 ng of total RNAs from animal caps was reverse transcribed using the Superscript VILO cDNA Synthesis Kit (Invitrogen, Grand Island, NY) and 2 μl of 1:1000 dilution of the synthesized cDNA was amplified using Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA) with the following primer sets: bra (F: GAATGGTGGAGGCCAGATTAT; R: TCAGGGAATGAATGGCTAGTG), sox2 (F: GCGTCCAACAACCAGAATAAG; R: GTTCTCCTGAGCCATCTTTCT), snai2 (F: AGGCACGTGAAGGGTAGAGA; R: CATGGGAATAAGTGCAACCA), luciferase (F: GTGTTGGGCTTATTTATC; R: TAGGCTGCGAAATGTTCATACT) and odc (F: ACATGGCATTCTCCCTGAAG; R: TGGTCCCAAGGCTAAAGTTG). The PCR conditions were as follows: denaturation 95°C (15 s), annealing and extension at 60°C (1 min) for 40 cycles.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.


  1. Book
    1. Bae CJ
    2. Saint-Jeannet JP
    Induction and Specification of Neural Crest Cells: Extracellular Signals and Transcriptional Switches
    In: Trainor P, editors. Neural Crest Cells: Evolution, Development and Disease. Elsevier. pp. 27–49.
    1. Bang AG
    2. Papalopulu N
    3. Kintner C
    4. Goulding MD
    Expression of Pax-3 is initiated in the early neural plate by posteriorizing signals produced by the organizer and by posterior non-axial mesoderm
    Development 124:2075–2085.
    1. Christian JL
    2. McMahon JA
    3. McMahon AP
    4. Moon RT
    Xwnt-8, a Xenopus Wnt-1/int-1-related gene responsive to mesoderm-inducing growth factors, may play a role in ventral mesodermal patterning during embryogenesis
    Development 111:1045–1055.
    1. Harland RM
    In situ hybridization: an improved whole-mount method for Xenopus embryos
    Methods in Cell Biology 36:685–695.
    1. Kim SH
    2. Yamamoto A
    3. Bouwmeester T
    4. Agius E
    5. Robertis EM
    The role of paraxial protocadherin in selective adhesion and cell movements of the mesoderm during Xenopus gastrulation
    Development 125:4681–4690.
    1. LaBonne C
    2. Bronner-Fraser M
    Neural crest induction in Xenopus: evidence for a two-signal model
    Development 125:240324–14.
    1. Mayor R
    2. Morgan R
    3. Sargent MG
    Induction of the prospective neural crest of Xenopus
    Development 121:767–777.
    1. Mizuseki K
    2. Kishi M
    3. Matsui M
    4. Nakanishi S
    5. Sasai Y
    Xenopus Zic-related-1 and Sox-2, two factors induced by chordin, have distinct activities in the initiation of neural induction
    Development 125:579–587.
  2. Book
    1. Nieuwkoop PD
    2. Faber J
    Normal Table of Xenopus Laevis (Daudin)
    Amsterdam: North Holland Publishing Company.
    1. Slack JM
    2. Forman D
    An interaction between dorsal and ventral regions of the marginal zone in early amphibian embryos
    Journal of Embryology and Experimental Morphology 56:283–299.
    1. Spokony RF
    2. Aoki Y
    3. Saint-Germain N
    4. Magner-Fink E
    5. Saint-Jeannet JP
    The transcription factor Sox9 is required for cranial neural crest development in Xenopus
    Development 129:421–432.

Decision letter

  1. Marianne Bronner
    Senior and Reviewing Editor; California Institute of Technology, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Marianne Bronner as the Senior and Reviewing Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


This is an interesting paper that addresses the role of Dkk2 in neural crest formation, showing that it is required for the expression of both Snai2 and Sox10. Loss of Dkk2 can be rescued by β-catenin and Lrp6, as well as Wnt8. Over-expression of Dkk2 leads to an expansion of Snai2. While a GSK3β inhibitor expands Snai2 expression anteriorly, the prospective neural crest territory remains sensitive to Dkk2 MO, suggesting it functions in a GSK3β independent manner.

Essential revisions:

1) It is critical to provide better expression profile of Dkk2 and it is suggested to move the images to main figures. The published expression pattern for Dkk2 does not show expression in the neural fold or neural crest. Furthermore the RNA seq data available on Xenbase shows a very low expression of Dkk2 during neural crest induction. It is even more striking when the expression data is compared to the Wnt partner namely Wnt8 and Lrp6. It is only in the Discussion that the authors refer to expression data presented in the supplemental material.

2) The expression data suggest that Dkk2 is an extremely potent activator of the pathway that despite its minute expression it is essential for proper Wnt signaling. This is not entirely consistent with the fact that loss of Dkk2 can be rescued by overexpression of Wnt8, Lrp6 or β-catenin since all of these mRNA are expressed at 10 to 100 folds excess when compared to Dkk2. Does the Dkk2 protein possess some particular property such as extreme stability or extreme binding affinity to the co-receptors? Following a tagged Dkk2 protein in the embryo (by blot and IF) could provide some clues. Dose response in the embryo or animal cap could be used to determine the effectiveness of Dkk2 compare to Dkk1. What is the minimal dose at which Dkk2 expression can expend the neural crest?

3) While the results strongly suggest that Dkk2 potentiates WNT signaling towards neural crest formation, the mechanism of action is unresolved. The authors should assess whether Dkk2 triggers expression of known direct targets of WNT/β-cat pathway, or non-canonical WNT pathways. They should also test mesoderm markers to rule out possible secondary effects.

4) The authors should test a broader repertoire of neural crest markers (in addition to Sox10 and Snai2). In addition, analysis of early stages (st. 13) is required to test effects on early NC specification markers.

5) In the absence of lineage tracing, the loss of snai2 and sox10 expression is not conclusive evidence for loss of neural crest cells. The authors should examine non-neural ectoderm markers. They should also let embryos grow to later stages, as loss of neural crest should result in complete unilateral absence of craniofacial cartilage and cranial peripheral nervous system. If so, is this rescued by β-catenin and Lrp6 injections in Dkk2-depleted embryos?

6) While the loss of function phenotype is compelling, the in vitro translation does not allow one to test the effective amount to inject in an embryo. Blocking the translation of a tagged Dkk2 mRNA would help define that dose. In addition, rescuing Dkk2 MO with an insensitive mRNA would confirm the specificity of the phenotype. The splice morpholino need to be more carefully quantified. Using realtime qPCR what is the percentage of properly spliced mRNA with various doses of the MO?

Other suggested revisions:

1) The authors should references previous studies that provide molecular insights into how Dkk2 activates Wnt/β-cat. For example, Li et al. (2002) suggested that it is the C2 domain of Dkk2 that is critical in its WNT activating functions, and further provide evidence suggesting that Dkk2 WNT inductive role operates through DVL and GSK3 independent mechanisms. Mao and Niehrs (2003) suggested that Krm2 is responsible for the WNT-antagonistic effect of Dkk2, and that in its absence, Dkk2 operates as a WNT activator.

2) It would be nice to examine biochemical interactions between Dkk2 function with Lrp5/6, Ror, Krm, during neural crest development.

3) The authors present a model where Dkk2 and Wnt8 appear to function in parallel pathways that converge on β-catenin. What's not clear is why eliminating Dkk2 prevents Wnt8 from its normal activation of β-catenin and neural crest cell formation and also why vice versa, Dkk2 can't activate β-catenin and specify neural crest cells in the absence of Wnt8. Do Dkk2 and Wnt8 somehow impact each other's function?

4) Better quantification would be appropriate.

5) On BIO experiments, it is puzzling that the Dkk1+BIO does not display expected anterior expansion of Snai2 on the control side, unlike the Dkk2+Bio…?

6) This statement in the Discussion is debatable:

"While overexpression studies have previously shown that Dkk2 can function as an activator of Wnt/β-catenin signaling when co-expressed with Fzd8 or Lrp6 (Wu et al., 2000; Brott and Sokol, 2002; Li et al., 2002), this is the first study that provides evidence for its positive role in a Wnt/β-catenin regulated developmental process."

7) It should be noted that the expanded domain of Sox2 does not correlate with neural crest cell generation. This contrasts with recent studies in Xenopus arguing for such a relationship and maintenance of pluripotency in neural crest cells.

8) Given the proposed role of Dkk2 one would expect that it could rescue the overexpression of GSK3 to complement the BIO- inhibitor data. Has this been tested?

Author response

Essential revisions:

1) It is critical to provide better expression profile of Dkk2 and it is suggested to move the images to main figures. The published expression pattern for Dkk2 does not show expression in the neural fold or neural crest. Furthermore the RNA seq data available on Xenbase shows a very low expression of Dkk2 during neural crest induction. It is even more striking when the expression data is compared to the Wnt partner namely Wnt8 and Lrp6. It is only in the Discussion that the authors refer to expression data presented in the supplemental material.

Although the Xenbase RNA-seq data indicates that Wnt8 and Lrp6 are expressed at higher levels than Dkk2 it is difficult to correlate this information to the amount of protein present at the time of neural crest induction. As suggested we have moved the dkk2 expression data as a main figure of the manuscript (see Figure 4). Dkk2 is broadly expressed during embryogenesis and is not distinctly enriched in the neural crest territory. It is likely that the regionalized expression of other components of the pathway, such as Fzd receptors and Wnt ligands, which are expressed at higher levels, provides the spatiotemporal cues to achieve a localized response. The expression pattern of dkk2 is presented and discussed in the Results section of the manuscript (see subsection “Developmental expression of Dkk2”).

2) The expression data suggest that Dkk2 is an extremely potent activator of the pathway that despite its minute expression it is essential for proper Wnt signaling. This is not entirely consistent with the fact that loss of Dkk2 can be rescued by overexpression of Wnt8, Lrp6 or β-catenin since all of these mRNA are expressed at 10 to 100 folds excess when compared to Dkk2. Does the Dkk2 protein possess some particular property such as extreme stability or extreme binding affinity to the co-receptors? Following a tagged Dkk2 protein in the embryo (by blot and IF) could provide some clues. Dose response in the embryo or animal cap could be used to determine the effectiveness of Dkk2 compare to Dkk1. What is the minimal dose at which Dkk2 expression can expend the neural crest?

Regarding the mRNA expression levels of Dkk2, Wnt8 and Lrp6 see response to point #1. As suggested we have performed Western blot analyses to evaluate the accumulation overtime of a Flag-tagged version of HuDkk2 (see Author response image 1, red arrow). Protein detection was only possible after injection of 5 ng of plasmid DNA at the 4-cell stage consistent with a previous study (Brott and Sokol, 2002). We observed that Dkk2 starts to accumulate at the gastrula stage (stages 10/12) to reach a maximum at neural stage (stages 14/18), and then progressively decreases (stage 20). A similar pattern was observed for a Flag-tagged version of HuDkk1 (not shown). Upon overexpression in the embryo, Dkk2 protein does not appear to have an unusual stability and/or degradation profile. For comparison the minimal dose at which Dkk2 can expand the neural crest in the embryo is 25 pg of plasmid DNA.

3) While the results strongly suggest that Dkk2 potentiates WNT signaling towards neural crest formation, the mechanism of action is unresolved. The authors should assess whether Dkk2 triggers expression of known direct targets of WNT/β-cat pathway, or non-canonical WNT pathways. They should also test mesoderm markers to rule out possible secondary effects.

We have performed the suggested experiment and found that with the exception of snai2, dkk2 overexpression did not significantly upregulate other known direct targets of Wnt/β-catenin signaling such as pax3, znf703 or kremen2. This result suggests that dkk2 alone is a poor activator of Wnt/β-catenin signaling, consistent with the view that it is acting in concert with a Wnt ligand to activate the pathway. The expression of the mesoderm marker myoD was unaffected in dkk2-depleted embryos ruling out any possible secondary effects (see Figure 2 and Results subsection “Dkk2 is required for neural crest formation”, second paragraph).

4) The authors should test a broader repertoire of neural crest markers (in addition to Sox10 and Snai2). In addition, analysis of early stages (st. 13) is required to test effects on early NC specification markers.

We have performed additional experiments to increase the repertoire of neural crest genes analyzed, which now include pax3, sox8, snai1, twist1 and sox9 (see Figure 2 and Results subsection “Dkk2 is required for neural crest formation”, second paragraph). We found that early neural crest markers (neural border specifiers) such as pax3, sox8 and snai1 were only mildly affected – their expression levels were unchanged but their expression domain appeared to be shifted laterally – while other markers (neural crest specifiers) such as twist1, and sox9 to a lesser extent, were downregulated, consistent with the phenotype observed for sox10 and snai2. This result suggests that dkk2 may not participate in neural plate border specification but rather in the neural crest progenitors formation and/or maintenance.

5) In the absence of lineage tracing, the loss of snai2 and sox10 expression is not conclusive evidence for loss of neural crest cells. The authors should examine non-neural ectoderm markers. They should also let embryos grow to later stages, as loss of neural crest should result in complete unilateral absence of craniofacial cartilage and cranial peripheral nervous system. If so, is this rescued by β-catenin and Lrp6 injections in Dkk2-depleted embryos?

We have analyzed the expression of keratin, a gene expressed in the non-neural ectoderm, and show that its overall expression is reduced/shifted laterally consistent with the expansion of sox2 expression domain (see Figure 2B and Results subsection “Dkk2 is required for neural crest formation”, second paragraph).

We also show that neural crest-derived craniofacial cartilages in addition to pigment cells are affected upon Dkk2 depletion (see Figure 1K and Results subsection “Dkk2 is required for neural crest formation”, end of first paragraph), pointing to a loss of neural crest lineages in these embryos.

6) While the loss of function phenotype is compelling, the in vitro translation does not allow one to test the effective amount to inject in an embryo. Blocking the translation of a tagged Dkk2 mRNA would help define that dose. In addition, rescuing Dkk2 MO with an insensitive mRNA would confirm the specificity of the phenotype. The splice morpholino need to be more carefully quantified. Using realtime qPCR what is the percentage of properly spliced mRNA with various doses of the MO?

In this study, we used two MOs interfering with Dkk2 mRNA translation and splicing, respectively. Both gave a similar phenotype resulting in the inhibition of snai2 and sox10 expression, associated with an expansion of sox2 expression domain. This phenotype was observed in both whole embryos and animal cap explants. We also used a control MO, which did not affect the expression of these genes. Importantly, this phenotype was efficiently rescued by expression of Lrp6 and β-catenin, two components of Wnt/β-catenin signaling pathway. We believe that this combination of approaches makes a compelling case for a specific requirement of dkk2 in neural crest formation. It is difficult to estimate the efficacy of a translation blocking MO without a good antibody, and we have not been able to identify one that could detect endogenous dkk2 in Xenopus. As suggested, we have performed qRT-PCR to evaluate the proportion of spliced versus unspliced transcripts generated upon injection of increasing doses of MO. These data are presented in Figure 1—figure supplement 1.

Other suggested revisions:

1) The authors should references previous studies that provide molecular insights into how Dkk2 activates Wnt/β-cat. For example, Li et al. (2002) suggested that it is the C2 domain of Dkk2 that is critical in its WNT activating functions, and further provide evidence suggesting that Dkk2 WNT inductive role operates through DVL and GSK3 independent mechanisms. Mao and Niehrs (2003) suggested that Krm2 is responsible for the WNT-antagonistic effect of Dkk2, and that in its absence, Dkk2 operates as a WNT activator.

Both studies are now referenced in the text (see Discussion, end of second paragraph and end of fourth paragraph).

2) It would be nice to examine biochemical interactions between Dkk2 function with Lrp5/6, Ror, Krm, during neural crest development.

We agree with the reviewer, and this is something we are planning to explore in order to elucidate the precise mechanism of Dkk2-mediated signaling during neural crest specification, however we feel that this is beyond the scope of the current study.

3) The authors present a model where Dkk2 and Wnt8 appear to function in parallel pathways that converge on β-catenin. What's not clear is why eliminating Dkk2 prevents Wnt8 from its normal activation of β-catenin and neural crest cell formation and also why vice versa, Dkk2 can't activate β-catenin and specify neural crest cells in the absence of Wnt8. Do Dkk2 and Wnt8 somehow impact each other's function?

Our model predicts that signaling by Dkk2 and Wnt8 are both independently required to induce neural crest cells, this is specifically supported by the BIO experiment. Further work will address the mechanisms underlying this dual requirement during neural crest formation.

4) Better quantification would be appropriate.

For all injection experiments we provide a rigorous quantification of the phenotypes, which are summarized in the form of graphs for all figures, supplemented with numerical data provided as “source data” files.

5) On BIO experiments, it is puzzling that the Dkk1+BIO does not display expected anterior expansion of Snai2 on the control side, unlike the Dkk2+Bio?

We have included a more representative image for Dkk1+BIO (see Figure 8).

6) This statement in the Discussion is debatable:

"While overexpression studies have previously shown that Dkk2 can function as an activator of Wnt/β-catenin signaling when co-expressed with Fzd8 or Lrp6 (Wu et al., 2000; Brott and Sokol, 2002; Li et al., 2002), this is the first study that provides evidence for its positive role in a Wnt/β-catenin regulated developmental process."

We have revised this statement (see Discussion, first paragraph).

7) It should be noted that the expanded domain of Sox2 does not correlate with neural crest cell generation. This contrasts with recent studies in Xenopus arguing for such a relationship and maintenance of pluripotency in neural crest cells.

We agree with the reviewer, sox2 expression does not behave in a way that is compatible with the model of pluripotency retention in the neural crest lineage – a model that is still up for debate. At the neurula stage, we consider sox2 as a marker for neural progenitors and not as much an indicator of pluripotency.

8) Given the proposed role of Dkk2 one would expect that it could rescue the overexpression of GSK3 to complement the BIO- inhibitor data. Has this been tested?

Because our model predicts that signaling by dkk2 and wnt8 are both independently necessary to induce neural crest we did not expect that overexpressing dkk2 would be sufficient to restore neural crest formation in embryos injected with GSK3. We have performed the suggested experiment and found that Dkk2 expression was indeed unable to rescue neural crest formation in embryo overexpressing GSK3 (see Author response image 2).

Article and author information

Author details

  1. Arun Devotta

    Department of Basic Science and Craniofacial Biology, College of Dentistry, New York University, New York, United States
    Conceptualization, Formal analysis, Investigation, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  2. Chang-Soo Hong

    1. Department of Basic Science and Craniofacial Biology, College of Dentistry, New York University, New York, United States
    2. Department of Biological Sciences, Daegu University, Gyeongsan, Republic of Korea
    Conceptualization, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared
  3. Jean-Pierre Saint-Jeannet

    Department of Basic Science and Craniofacial Biology, College of Dentistry, New York University, New York, United States
    Formal analysis, Investigation, Supervision, Funding acquisition, Methodology, Writing—review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3259-2103


National Institutes of Health (DE025468)

  • Jean-Pierre Saint-Jeannet

National Institutes of Health (DE014212)

  • Jean-Pierre Saint-Jeannet

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We are grateful to Dr. Christof Nierhs (University of Mainz, Germany), Dr. Tatiana Piotrowski (Stowers Institute, USA) and Dr. Sergei Sokol (Mount Sinai, USA) for reagents. This work was supported by grants from the National Institutes of Health to J-P S-J (R01-DE014212 and R01-DE025468).


Animal experimentation: This study was performed in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The procedures were approved by New York University Institutional Animal Care and Use Committee (IACUC), under animal protocol # 150201.

Senior and Reviewing Editor

  1. Marianne Bronner, California Institute of Technology, United States

Publication history

  1. Received: December 15, 2017
  2. Accepted: July 6, 2018
  3. Version of Record published: July 23, 2018 (version 1)


© 2018, Devotta et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,715
    Page views
  • 220
  • 16

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Arun Devotta
  2. Chang-Soo Hong
  3. Jean-Pierre Saint-Jeannet
Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner
eLife 7:e34404.

Further reading

    1. Developmental Biology
    2. Stem Cells and Regenerative Medicine
    Yizhuo Zhou, Ying Yang ... Wellington V Cardoso
    Research Article

    Basal cells are multipotent stem cells of a variety of organs, including the respiratory tract, where they are major components of the airway epithelium. However, it remains unclear how diverse basal cells are, and how distinct subpopulations respond to airway challenges. Using single cell RNA-sequencing and functional approaches, we report a significant and previously underappreciated degree of heterogeneity in the basal cell pool, leading to identification of six subpopulations in the adult murine trachea. Among these, we found two major subpopulations collectively comprising the most uncommitted of all the pool, but with distinct gene expression signatures. Notably, these occupy distinct ventral and dorsal tracheal niches and differ in their ability to self-renew and initiate a program of differentiation in response to environmental perturbations in primary cultures and in mouse injury models in vivo. We found that such heterogeneity is acquired prenatally, when the basal cell pool and local niches are still being established, and depends on the integrity of these niches, as supported by the altered basal cell phenotype of tracheal cartilage-deficient mouse mutants. Lastly, we show that features that distinguish these progenitor subpopulations in murine airways are conserved in humans. Together, the data provide novel insights into the origin and impact of basal cell heterogeneity on the establishment of regionally distinct responses of the airway epithelium during injury-repair and in disease conditions.

    1. Developmental Biology
    2. Stem Cells and Regenerative Medicine
    Jakke Neiro, Divya Sridhar ... Aziz Aboobaker
    Research Article Updated

    Planarians have become an established model system to study regeneration and stem cells, but the regulatory elements in the genome remain almost entirely undescribed. Here, by integrating epigenetic and expression data we use multiple sources of evidence to predict enhancer elements active in the adult stem cell populations that drive regeneration. We have used ChIP-seq data to identify genomic regions with histone modifications consistent with enhancer activity, and ATAC-seq data to identify accessible chromatin. Overlapping these signals allowed for the identification of a set of high-confidence candidate enhancers predicted to be active in planarian adult stem cells. These enhancers are enriched for predicted transcription factor (TF) binding sites for TFs and TF families expressed in planarian adult stem cells. Footprinting analyses provided further evidence that these potential TF binding sites are likely to be occupied in adult stem cells. We integrated these analyses to build testable hypotheses for the regulatory function of TFs in stem cells, both with respect to how pluripotency might be regulated, and to how lineage differentiation programs are controlled. We found that our predicted GRNs were independently supported by existing TF RNAi/RNA-seq datasets, providing further evidence that our work predicts active enhancers that regulate adult stem cells and regenerative mechanisms.