Figures and data in The universally-conserved transcription factor RfaH is recruited to a hairpin structure of the non-template DNA strand

Figures
Tables
Additional files

6 figures, 3 tables and 2 additional files

Figures

Figure 1

Download asset Open asset

Life cycle of RfaH.

Available experimental data demonstrate RfaH recruitment to the *ops*-paused RNAP in vitro (Artsimovitch and Landick, 2002) and in vivo (Belogurov et al., 2009) *via* a hairpin in the NT DNA (this work). Belogurov et al. (2007) showed that destabilization of the interdomain interface was required for RfaH switch from the autoinhibited into the active state, and proposed that the RfaH-CTD refolds into a β-barrel upon release. The RfaH-CTD refolding and interactions with S10 were demonstrated by NMR spectroscopy, and functional evidence in support of their role in ribosome recruitment in vivo was reported (Burmann et al., 2012). A hypothesis that the autoinhibited state is regained after RfaH is released from TEC at a terminator has been proposed (Tomar et al., 2013) and awaits testing. The details of RfaH:RNAP contacts that mediate initial recruitment at *ops,* the molecular mechanism of ribosome recruitment, and hypothetical coupling of transcription and translation by RfaH (Burmann et al., 2012) remain to be investigated.β'CH, β' clamp helices; βGL, β gate loop.

https://doi.org/10.7554/eLife.36349.002

Figure 2 with 1 supplement

Download asset Open asset

Contribution of individual *ops* bases to RNAP pausing and RfaH recruitment.

(A) Consensus pause and *E. coli ops* sequences. (B) Expression of *luxCDABE* reporter fused to *ops* mutants in the absence and presence of RfaH determined in three independent experiments, each with three biological replicates (see source file), is presented as average ± standard deviation. Only the data obtained in the presence of RfaH are plotted; the levels of expression in the absence of RfaH are very low. RfaH effect, the ratio of *lux* activities observed with and without RfaH, is shown below each mutant. (C) In vitro analysis of *ops* mutants. Transcript generated from the T7A1 promoter on a linear DNA template is shown on top; the transcription start site (bent arrow), *ops* element (green box), and transcript end are indicated. Halted A24 TECs were formed as described in Materials and Methods on templates with single substitutions in the *ops* element. Elongation was restarted upon addition of NTPs and rifapentin in the absence or presence of 50 nM RfaH. Aliquots were withdrawn at 10, 20, 40, 80, 160, 320, 640, and 1280 s and analyzed on 8% denaturing gels. Positions of the paused and run-off transcripts are indicated with arrows. Pause sites within the *ops* region are numbered relative to the *ops* consensus sequence and color-coded. Results with WT, C3G, G5A, and G12C *ops* variants are shown, for all other variants see Figure 2—figure supplement 1. (D) Analysis of RfaH effects in vitro (from (C)). The assays were performed in triplicates. RfaH effects at U11 reflect the antipausing modification of RNAP by RfaH. RfaH effects at G12/C13 reflect RfaH binding to the NT DNA strand, which hinders RNAP escape from *ops*. Fractions of U11 RNA (left) and G12 +C13 RNAs (right) at 20 s in the absence or the presence of RfaH, presented as average ± standard deviation from three independent experiments. RfaH effects (determined as a ratio of RNA fractions with vs. without RfaH) are shown below the variant. The core *ops* region is indicated by a black box.

https://doi.org/10.7554/eLife.36349.003

Figure 2—source data 1 In vivo analysis of ops mutants by a lux reporter assay.: https://doi.org/10.7554/eLife.36349.005
Download elife-36349-fig2-data1-v2.xlsx
Figure 2—source data 2 In vitro analysis of the effect of ops mutants on RNAP pausing and RfaH recruitment.: https://doi.org/10.7554/eLife.36349.006
Download elife-36349-fig2-data2-v2.xlsx

Figure 2—figure supplement 1

Download asset Open asset

In vitro analysis of *ops* mutants.

Transcript generated from the T7A1 promoter on a linear DNA template is shown on top; the transcription start site (bent arrow), *ops* element (green box), and transcript end are indicated. Halted A24 TECs were formed as described in Methods on templates with single substitutions in the *ops* element. Elongation was restarted upon addition of NTPs and rifapentin in the absence or presence of 50 nM RfaH. Aliquots were withdrawn at 10, 20, 40, 80, 160, 320, 640, and 1280 s and analyzed on 8% denaturing gels. Positions of the paused and run-off transcripts are indicated with arrows. Pause sites within the *ops* region are numbered relative to the *ops* consensus sequence and color-coded.

https://doi.org/10.7554/eLife.36349.004

Figure 3

Download asset Open asset

RfaH recruitment to RNAP transcribing through the *ops* element.

(A) Schematic of Exo III footprinting of free and RfaH-bound TECs. Numbers indicate the upstream footprint boundaries relative to the RNA 3’ end. (B) The G8 TEC was assembled on the scaffold, with RNA and template (T) DNA strands labeled with [γ³²P]-ATP and T4 polynucleotide kinase (PNK), and walked in one-nucleotide steps to C9, G10, and U11 positions in the presence of the matching NTP substrates. (C) RfaH was added to 50 nM, where indicated. Following the addition of Exo III, the reactions were quenched at indicated times (0 represents an untreated DNA control) and analyzed on a 12% urea-acrylamide (19:1) gel in 0.5X TBE. Numbers indicate the distance from the RNA 3’ end. Hypothetical TEC structures are shown below. G8 and C9 complexes are predominantly post-translocated, as indicated by 14 bp protection of the upstream DNA. In G10 TEC, the pre-translocated state (15 bp protection) is observed, and in U11 an additional backtracked state (16 bp protection). Exo III may counteract backtracking; the sensitivity of the nascent RNA in G10 and U11 TECs to GreB-assisted cleavage (Nedialkov et al., 2018) was used to infer the translocation states shown in the schematics.

https://doi.org/10.7554/eLife.36349.007

Figure 4 with 2 supplements

Download asset Open asset

Specific recognition of *ops* by RfaH.

(A) Crystal structure of the RfaH:*ops*9 complex with the 2F_o – F_c electron density map contoured at 1 σ. (B) Structure of RfaH:*ops*9 complex with RfaH shown in surface representation, colored according to its electrostatic potential and *ops*9 as sticks. (C) Details of RfaH:*ops9* interactions. Hydrogen bonds are shown as black dashed lines. RfaH residues that interact with *ops* are labeled in green. Alanine substitutions of RfaH residues that make base-specific contacts to G5 and T6 *via* their side chains and that compromise RfaH recruitment (Belogurov et al., 2010) are highlighted in red (strongly defective) and orange (moderately defective). (D) RfaH:*ops* interactions in solution. [¹H, ¹⁵N]-HSQC spectra of 110 μM [¹³C, ¹⁵N]-RfaH titrated with 803 μM *ops*12 DNA. Arrows indicate changes of chemical shifts. Selected signals are labeled. (E) Mapping of normalized chemical shift perturbations observed in (D) on the RfaH:*ops9* structure.

https://doi.org/10.7554/eLife.36349.008

Figure 4—source data 1 Analysis of the chemical shift perturbations during the HSQC-titration of ¹⁵N-RfaH with ops12.: https://doi.org/10.7554/eLife.36349.011
Download elife-36349-fig4-data1-v2.xlsx

Figure 4—figure supplement 1

Download asset Open asset

Analysis of RfaH:*ops* interactions.

(A) Superposition of free RfaH (PDB ID 2OUG, blue) and RfaH in the RfaH:*ops*9 complex (RfaH-NTD, green; RfaH-CTD, cyan), both in ribbon representation. The superposition is based on C_α atoms, yielding a root mean square deviation value of 0.72 Å. (B) Two-dimensional view of *ops*9:RfaH interactions. Water molecules are shown as cyan spheres. Bases are labeled in blue, amino acids in green. Hydrogen bonds between amino acids and DNA are shown as pink dashed lines, water-mediated hydrogen bonds as blue dashed lines. Van-der-Waals interactions are indicated in red. (C) Crystal packing of RfaH:*ops*9 crystals (space group P1). The content of one asymmetric unit is shown in color, molecules from neighboring asymmetric units are in grey (all molecules in ribbon representation). The panel shows an enlargement of the arrangement of DNA molecules from neighboring asymmetric units. Bases are shown as sticks (oxygen, red; nitrogen, blue; carbon, according to backbone color) and are labeled. Hydrogen bonds are indicated by dashed lines.

https://doi.org/10.7554/eLife.36349.009

Figure 4—figure supplement 2

Download asset Open asset

Secondary structure of isolated *ops*9 and RfaH:*ops*9 interaction in solution.

(A) Downfield region of the 1D [¹H] NMR spectra of *ops*9 DNA measured at the temperatures indicated. The region characteristic for imino protons involved in Watson-Crick base pairs is highlighted in yellow. The inferred secondary structure of *ops*9 DNA is shown to the right. (B) RfaH:*ops*12 interaction in solution. [¹H, ¹⁵N]-HSQC-derived normalized chemical shift perturbations *vs.* residue position in RfaH. The chemical shift perturbation were obtained from a titration of ¹⁵N-RfaH with *ops*12 (for spectra see Figure 3D). Horizontal lines: significance levels of Δδ_norm = 0.04 ppm, black;=0.1 ppm, orange,=0.15 ppm, red. Disappearing signals are highlighted in red. The domain arrangement of RfaH is indicated above.

https://doi.org/10.7554/eLife.36349.010

Figure 5

Download asset Open asset

The role of NT DNA hairpin.

(A) Model of RfaH-NTD bound to the *ops*-paused TEC. Surface-accessible NT DNA bases are shown as sticks. (B) The double C3G + G8C substitution partially restores RfaH-dependent recruitment. The assay was done as in Figure 2. The position of an RfaH-induced delay in RNAP escape is shown with a blue bar, solid if delay is enhanced.

https://doi.org/10.7554/eLife.36349.013

Figure 6

Download asset Open asset

Specificity of RfaH for *ops*.

Superposition based on backbone atoms of NusG-NTD (PDB ID 2K06, light blue) and RfaH-NTD (taken from the RfaH:*ops*9 structure, green; root mean square deviation: 4.3 Å). Both proteins in ribbon representation. (B) Structure-based sequence alignment of NusG and RfaH. RfaH residues whose substitutions for Ala compromise RfaH recruitment (Belogurov et al., 2010) are highlighted in red (strongly defective) and orange (moderately defective). RfaH residues that make base-specific interactions with *ops* via their side chains are marked by an asterisk. (C) Structure of RfaH-NTD in (left) surface representation colored according to its electrostatic potential (from −3k_BT/e, red, to +3 _kBT/e, blue) and (right) ribbon representation with residues highlighted in (B) shown as sticks (C atoms, red or orange; N atoms, blue; O atoms, light red). (D) Structure of NusG-NTD (PDB ID 2K06) in (left) surface representation colored according to its electrostatic potential and (right) ribbon representation. Residues corresponding to the amino acids of RfaH highlighted in (B) are shown as sticks (C atoms, pink; N atoms, blue; O atoms, light red).

https://doi.org/10.7554/eLife.36349.014

Tables

Table 1

Data collection and refinement statistics

https://doi.org/10.7554/eLife.36349.012

Data collection
Wavelength (Å)	0.9184
Space group	P1
Unit cell parameters
a, b, c (Å)	36.309/43.187/61.859
α, β, γ (°)	80.449/75.485/75.392
Resolution (Å)^a	41.55–2.1 (2.2–2.1)
Unique/observed reflections^a,b	19,931/107,345 (2,633/14,210)
R_sym (%) ^a,c	6.3 (42.9)
I/σI^a	13.96 (3.47)
Completeness (%)^a	97.3 (97.9)
Molecules per asymmetric unit	2
Refinement statistics
R_work (%)^d	18.62
R_free (%)^e	23.34
Number of atoms
Protein	4283
Nucleic acid	574
Water	116
B-factors
Protein	56.062
Nucleic acid	87.427
water	48.058
r.m.s. deviations
Bond lengths (Å)	0.013
Bond angles (°)	1.149

^aHighest-Resolution shell values are given in parentheses.

^bFriedel mates were not treated as independent reflections.
^cR_sym = Σ_h Σ_I | I_i(h) - <I(h)> | / Σ_hΣ_iI(h); where I are the independent observations of reflection h.

^dR_work = Σ_h ||F_obs| - |F_calc|| / Σ_h |F_obs|.
^eThe free R-factor was calculated from 5 % of the data, which were removed at random before the structure was refined.

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers
Strain, strain background (E. coli)	BL21 (λ DE3)	Novagen	N/A
Strain, strain background (E. coli)	DH5α ΔrfaH (λ DE3)	Belogurov et al. (2010)	IA lab stock #149
Recombinant DNA reagent	list of recombinant plasmids used	Table 2
Sequence-based reagent	ops9 GCGGTAGTC	IDT	N/A
Sequence-based reagent	ops12 GGCGGTAGCGTG	Biomers.net	N/A
Sequence-based reagent	T7A1 promoter AAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATCGAGCAGGCAGCGGCAAAGCCATGG	Sigma Aldrich	IA lab stock #2536
Sequence-based reagent	DN PCR primer AAATAAGCGGCTCTCAGTTT	Sigma Aldrich	IA lab stock #2536
Sequence-based reagent	UP PCR primer AAAAAGAGTATTGACTTAAAG	Sigma Aldrich	IA lab stock #2499
Sequence-based reagent	R40 RNA oligo UUUAUCGGCGGUAG	IDT DNA Technologies	N/A
Sequence-based reagent	NT44 DNA oligo CACCACCACGCGGGCGGTAGCGTGCTTTTTTCGATCTTCCAGTG	IDT DNA Technologies	N/A
Sequence-based reagent	T44 DNA oligo CACTGGAAGATCGAAAAAAGCACGCTACCGCCCGCGTGGTGGTG	IDT DNA Technologies	N/A
Peptide, recombinant protein	E. coli RfaH (transcription assays, NMR)	Belogurov et al. (2007)	N/A
Peptide, recombinant protein	E. coli RfaH (crystallization)	Vassylyeva et al. (2006)	N/A
Peptide, recombinant protein	E. coli RNA polymerase	Svetlov and Artsimovitch, 2015	N/A
Peptide, recombinant protein	Exo III nuclease	New England Biolabs	Cat#: MO206
Peptide, recombinant protein	T4 polynucleotide kinase	New England Biolabs	Cat#: MO0201
Commercial assay or kit	QIAquick PCR purification kit	Qiagen	Cat#: 28104
Commercial assay or kit	QIAquick Nucleotide Removal Kit	Qiagen	Cat#: 28306
Chemical compound, drug	(¹⁵NH)₄SO₄	Campro Scientific	Cat#: CS01-185_148
Chemical compound, drug	D2O	Eurisotop	Cat#: D216L
Chemical compound, drug	ApU	Sigma-Aldrich	Cat #: A6800
Chemical compound, drug	[α−32P]-CTP	Perkin Elmer	Cat#: BLU008H
Chemical compound, drug	Rifapentin	Artsimovitch et al., 2005	N/A
Chemical compound, drug	PEG monomethyl ether 500	Sigma-Aldrich	Cat#: 202487
Chemical compound, drug	4-(2-hydroxyethyl)piperazineethanesulfonic acid (HEPES) for crystallization	Sigma-Aldrich	Cat#: H4034
Chemical compound, drug	MgCl2 for crystallization	Merck	Cat#: 105833
Chemical compound, drug	Glutaraldehyde for crystallization	Fluka	Cat#: 49629
Chemical compound, drug	Tris(hydroxymethyl)aminomethane (Tris) for crystallization	Roth	Cat#: 4855.3
Chemical compound, drug	KCl for crystallization	VWR	Cat#: 26764.298
Chemical compound, drug	Dithiothreitol (DTT) for crystallization	Roth	Cat#: 6908.1
Chemical compound, drug	Perfluoropolyether cryo oil	Hampton Research	Cat#: HR2-814
Software, algorithm	PyMol v. 1.7	The PyMOL Molecular Graphics System, Schrödinger, LLC.	https://pymol.org/2/
Software, algorithm	COOT	Emsley et al. (2010)	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
Software, algorithm	XDS	Kabsch, 2010b	http://xds.mpimf-heidelberg.mpg.de/
Software, algorithm	XDSAPP	Sparta et al., 2016	https://www.helmholtz-berlin.de/forschung/oe/np/gmx/xdsapp/index_en.html
Software, algorithm	PHASER	McCoy et al. (2007)
Software, algorithm	PHENIX suite	Adams et al. (2010)	https://www.phenix-online.org/
Software, algorithm	LigPlot	Wallace et al. (1995)	https://www.ebi.ac.uk/thornton-srv/software/LIGPLOT/
Software, algorithm	NMRViewJ	One Moon Scientific, Inc.	http://www.onemoonscientific.com/nmrviewj
Software, algorithm	GraFit v. 6.0.12	Erithacus Software Ltd.	http://www.erithacus.com/grafit/
Software, algorithm	MatLab v. 7.1.0.183	The MathWorks, Inc.	https://de.mathworks.com/products/matlab.html
Software, algorithm	ImageQuant	GE Healthcare Life Sciences	www.gelifesciences.com/
Software, algorithm	PISA Server	Krissinel and Henrick (2007)	http://www.ebi.ac.uk/pdbe/pisa/
Other	24-well VDXm plates with sealant	Hampton Research	HR3-306

Table 2

Plasmids

https://doi.org/10.7554/eLife.36349.015

Name	Description	Source
ops variants
pIA1087	P_BAD‒ops^WT‒luxCDABE	Burmann et al. (2012)
pZL6	P_BAD‒ops(G2C)‒luxCDABE	This work
pZL7	P_BAD‒ops(A7T)‒luxCDABE	This work
pZL12	P_BAD‒ops(T11G ‒luxCDABE	This work
pZL14	P_BAD‒ops(G5A)‒luxCDABE	This work
pZL21	P_BAD‒ops(G4C)‒luxCDABE	This work
pZL22	P_BAD‒ops(T6A)‒luxCDABE	This work
pZL23	P_BAD‒ops(G8C)‒luxCDABE	This work
pZL24	P_BAD‒ops(G12C)‒luxCDABE	This work
pZL25	P_BAD‒ops(G1C)‒luxCDABE	This work
pZL26	P_BAD‒ops(C3G)‒luxCDABE	This work
pZL27	P_BAD‒ops(C9G)‒luxCDABE	This work
pZL28	P_BAD‒ops(G10C)‒luxCDABE	This work
pIA1286	P_BAD‒ops(C3G + G8C)‒luxCDABE	This work
Gene expression vectors
pVS10	P_T7 promoter– E. coli rpoA–rpoB–rpoC^His6–rpoZ	Belogurov et al. (2007)
pVS12	E. coli rfaH in pTYB1	Vassylyeva et al. (2006)
pIA238	E. coli rfaH in pET28a	Artsimovitch and Landick (2002)