1. Cancer Biology
  2. Cell Biology

Chimeric antigen receptors that trigger phagocytosis

  1. Meghan A Morrissey
  2. Adam P Williamson
  3. Adriana M Steinbach
  4. Edward W Roberts
  5. Nadja Kern
  6. Mark B Headley
  7. Ronald D Vale  Is a corresponding author
  1. University of California, San Francisco, United States
https://doi.org/10.7554/eLife.36688
Share this article
Cite this article
  1. Meghan A Morrissey
  2. Adam P Williamson
  3. Adriana M Steinbach
  4. Edward W Roberts
  5. Nadja Kern
  6. Mark B Headley
  7. Ronald D Vale
(2018)
Chimeric antigen receptors that trigger phagocytosis
eLife 7:e36688.
https://doi.org/10.7554/eLife.36688
  2. Download BibTeX
  3. Download .RIS
4 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
Identification of intracellular signaling region for CAR-P.

(A) Schematics show the structure of CAR-P constructs. An ɑCD19 (purple) or ɑCD22 (blue, center) scFv directs CAR specificity. Intracellular signaling domains from Megf10 or the indicated engulfment …

https://doi.org/10.7554/eLife.36688.003
Figure 1—figure supplement 1
Download asset Open asset
Expression level of CAR-P constructs in macrophages.

Images of macrophages infected with various ɑCD19 CAR-PGFP constructs were acquired with identical acquisition settings and scaling to depict differences in expression levels. Fluorescent intensity …

https://doi.org/10.7554/eLife.36688.004
Figure 1—video 1
Download asset
CAR-PMegf10 macrophage engulfs silica beads

A macrophage infected with ɑCD19 CAR-PMegf10 (green) engulfs 5 µm silica beads coated in a supported lipid bilayer (labeled with atto647, magenta) and ligated to his-tagged CD19 extracellular …

https://doi.org/10.7554/eLife.36688.005
Figure 2
Download asset Open asset
CAR-P expression drives specific engulfment of diverse beads.

(A) Macrophages infected with the ɑCD19 (purple) or ɑCD22 (blue) CAR-PMegf10 or mCherry-CAAX control were fed 5 µm beads ligated with either CD19 (left) or CD22 (right). Engulfment is quantified as …

https://doi.org/10.7554/eLife.36688.006
Figure 3 with 1 supplement
Download asset Open asset
A phosphorylated ITAM at the cell-target synapse drives engulfment.

(A) Macrophages expressing ɑCD19 CAR-PMegf10 (green, top) or ɑCD19 CAR-PGFP were incubated with CD19-ligated beads (position indicated with dotted line), fixed and stained for phosphotyrosine …

https://doi.org/10.7554/eLife.36688.007
Figure 3—figure supplement 1
Download asset Open asset
F-actin is enriched at the cell-target synapse.

Phalloidin staining (magenta overlayed with brightfield and DAPI, left; heatmap, right) of F-actin in a CAR-PFcRɣ expressing macrophage shows a 2.3 fold enrichment at the cell-bead synapse (standard …

https://doi.org/10.7554/eLife.36688.008
Figure 4 with 7 supplements
Download asset Open asset
CAR-P promotes trogocytosis and whole cell eating.

(A) J774A.1 macrophages expressing the ɑCD19 CAR-PMegf10 (top panel, green in merge, left; greyscale, center) engulf pieces of CD19 +Raji B cells (labeled with mCherry-CAAX; magenta in merge, left; …

https://doi.org/10.7554/eLife.36688.009
Figure 4—figure supplement 1
Download asset Open asset
CAR-P localizes with pTyr at synapse with Raji B cell.

Phosphotyrosine staining (teal) of macrophages expressing CAR-PMegf10 (green) in contact with Raji B cells (cell membrane visualized with mCherry-CAAX, magenta). Below, the enrichment at the synapse …

https://doi.org/10.7554/eLife.36688.010
Figure 4—figure supplement 2
Download asset Open asset
NIH 3T3 cells internalize Raji B cell bites.

NIH 3T3 cells expressing the ɑCD19 CAR-PMegf10 (green in merge, left; greyscale, center) engulf pieces of CD19 +Raji B cells (labeled with mCherry-CAAX; magenta in merge, left; greyscale, right). …

https://doi.org/10.7554/eLife.36688.011
Figure 4—figure supplement 3
Download asset Open asset
Opsonization by an anti-CD47 antibody enhances whole cell internalization through CAR-P Macrophages expressing CAR-PFcRɣ and Raji B cells were incubated together at a 1:2 macrophage:Raji ratio (20,000 macrophages and 40,000 Rajis) without antibody addition (No ab) or in the presence of anti-CD19 or anti-CD47 antibodies as indicated.

The number of whole Raji B cells eaten per 100 macrophages during 4–8 hr of imaging is graphed. Graph depicts pooled data from three independent experiments; n = 232 with no antibody, n = 257 with …

https://doi.org/10.7554/eLife.36688.012
Figure 4—figure supplement 4
Download asset Open asset
CAR-P promotes internalization of cancer antigen.

(A) Schematic of antigen internalization and cross-presentation assay. CAR-P expressing Bone Marrow Derived Dendritic Cells (BMDC) were differentiated using GM-CS. CAR-P BMDC were incubated with …

https://doi.org/10.7554/eLife.36688.013
Figure 4—video 1
Download asset
CAR-PMegf10 macrophage engulfs bites of a Raji B cell.

A macrophage infected with ɑCD19 CAR-PMegf10 (green) engages with a Raji B cell (labeled with mCherry-CAAX). The field of view is 43 × 43 µm. The movie is a maximum intensity projection of 7 …

https://doi.org/10.7554/eLife.36688.014
Figure 4—video 2
Download asset
CAR-PFcRɣ macrophage engulfs a Raji B cell.

A macrophage infected with ɑCD19 CAR-PFcRɣ (green) engages with a Raji B cell (labeled with mCherry-CAAX). The field of view is 53 × 53 µm. Images were acquired every 5 min. Time is indicated in the …

https://doi.org/10.7554/eLife.36688.015
Figure 4—video 3
Download asset
CAR-Ptandem macrophage engulfs a Raji B cell.

A macrophage infected with ɑCD19 CAR-Ptandem (green) engages with a Raji B cell (labeled with mCherry-CAAX). The field of view is 53 × 53 µm. Images were acquired every 5 min. Time is indicated in …

https://doi.org/10.7554/eLife.36688.016

Tables

Key resources table
Reagent type
(species)
or resource		DesignationSource or referenceIdentifiersAdditional information
Cell line
(Mus musculus)		J774A.1 MacrophagesUCSF Cell Culture
Facility
Cell line
(Homo sapiens)		Raji B CellsOtherObtained from M. McManus,
UCSF
Cell line
(Mus musculus)		3t3 FibroblastsUCSF Cell Culture
Facility
Cell line
(Mus musculus)		C57BL/6JPMID: 21356739Bone Marrow Derived
Macrophages (BMDM)
Cell line
(Mus musculus)		C57BL/6JPMID: 7489412Bone Marrow derived
Dendritic Cells (BMDC)
Cell line
(Homo sapiens)		HEK293T cellsUCSF Cell Culture
Facility		Lentivirus production
Genetic Reagent
(Mus musculus)		OTIPMID: 8287475E. Roberts/M. Krummel Lab UCSF
Recombinant
DNA reagent		CD19-mMegf10 CARthis paperSignal peptide: aa 1–21 CD8
(Uniprot Q96QR6_HUMAN)
Extracellular antibody sequence: V-L
chain: aa 23–130 anti-CD19
CAR (Genbank AMZ04819) -- GS linker:
ggtggcggtggctcgggcggtggtgggtcgggt
ggcggcggatct -- V-H chain: aa 148–267
anti-CD19 CAR (Genbank AMZ04819)
Stalk/Transmembrane: aa 138–206 CD8
(Uniprot Q96QR6_HUMAN)
Cytosolic sequence: aa 879–1147 Mouse
Megf10 (Uniprot Q6DIB5 (MEG10_MOUSE))
Fluorophore: mGFP
Recombinant
DNA reagent		CD19-FcGamma CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot
Q96QR6_HUMAN) Extracellular antibody
sequence: V-L chain: aa 23–130
anti-CD19 CAR (Genbank AMZ04819) -- GS
linker: ggtggcggtggctcgggcggtggtgggtcgg
gtggcggcggatct -- V-H chain: aa 148–267
anti-CD19 CAR (Genbank AMZ04819)
Stalk/Transmembrane: aa 138–206 CD8 (Uniprot
Q96QR6_HUMAN) Cytosolic sequence: aa
19–86 Mouse Fc ERG precursor (Uniprot
P20491 (FCERG_MOUSE)) Fluorophore: mGFP
Recombinant
DNA reagent		CD19-empty CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot
Q96QR6_HUMAN) Extracellular antibody
sequence: V-L chain: aa 23–130
anti-CD19 CAR (Genbank AMZ04819) -- GS
linker: ggtggcggtggctcgggcggtggtgggtcggg
tggcggcggatct -- V-H chain: aa 148–267
anti-CD19 CAR (Genbank AMZ04819)
Stalk/Transmembrane: aa 138–206 CD8 (Uniprot
Q96QR6_HUMAN) Cytosolic sequence:
basic linker NHRNRRR (nucleotide AACCACAGG
AACCGAAGACGT) Fluorophore: mGFP
Recombinant
DNA reagent		CD22-Megf10 CARthis paperSignal peptide: aa 1–21 CSF2R (Uniprot P15509
(CSF2R_HUMAN)) Extracellular antibody
sequence: aa 22–258 of translated JP
2016502512-A/1: M971 Chimeric Antigen
(Genbank HZ530416.1) Stalk/Transmembrane:
aa 138–206 CD8 (Uniprot Q96QR6_
HUMAN) Cytosolic sequence: aa 879–1147
Mouse Megf10 (Uniprot Q6DIB5 (MEG10_
MOUSE)) Fluorophore: mGFP
Recombinant
DNA reagent		CD22-empty CARthis paperSignal peptide: aa 1–21 CSF2R (Uniprot P15509
(CSF2R_HUMAN)) Extracellular antibody
sequence: aa 22–258 of translated JP
2016502512-A/1: M971 Chimeric Antigen
(Genbank HZ530416.1) Stalk/Transmembrane:
aa 138–206 CD8 (Uniprot Q96QR6_HUMAN)
Cytosolic sequence: basic linker NHRNRRR
(nucleotide AACCACAGGAACCGAAGACGT)
Fluorophore: mGFP
Recombinant
DNA reagent		CD19-MerTK CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot Q96QR6
_HUMAN) Extracellular antibody sequence:
V-L chain: aa 23–130 anti-CD19
CAR (Genbank AMZ04819) -- GS linker: ggtg
gcggtggctcgggcggtggtgggtcgggtggcggcggatct --
V-H chain: aa 148–267 anti-CD19 CAR
(Genbank AMZ04819) Stalk/Transmembrane: aa
138–206 CD8 (Uniprot Q96QR6_HUMAN)
Cytosolic sequence: aa 519–994 Mouse MerTK
(Uniprot Q60805 (MERTK_MOUSE))
Fluorophore: mGFP
Recombinant
DNA reagent		CD19-Bai1 CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot
Q96QR6_HUMAN)Extracellular antibody
sequence: V-L chain:aa 23–130 anti-CD19
CAR (Genbank AMZ04819)-- GS linker:
 ggtggcggtggctcgggcggtggtgggtcgggtggcgg
cggatct -- V-H chain: aa 148–267 anti-CD19
CAR (GenbankAMZ04819) Stalk/Transmembrane:
aa 138–206 CD8 (UniprotQ96QR6_HUMAN)
Cytosolic sequence: aa1188–1582 Mouse
Bai1 (Uniprot Q3UHD1 (BAI1_MOUSE))
Fluorophore: mGFP
Recombinant
DNA reagent		CD19-CD3zeta CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot Q96QR6_
HUMAN) Extracellular antibody sequence:
V-L chain: aa 23–130 anti-CD19 CAR
(Genbank AMZ04819) -- GS linker: ggtggcggtggctcg
ggcggtggtgggtcgggtggcggcggatct -- V-H chain:
aa 148–267 anti-CD19 CAR (Genbank
AMZ04819) Stalk/Transmembrane: aa 138–206 CD8
(Uniprot Q96QR6_HUMAN) Cytosolic sequence:
aa 52–164, Human TCR CD3 zeta chain
(Uniprot P20963) Fluorophore: sfGFP
Recombinant
DNA reagent		CD19-PI3K CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot Q96QR6
_HUMAN) Extracellular antibody sequence:
V-L chain: aa 23–130 anti-CD19 CAR
(Genbank AMZ04819) -- GS linker: ggtggcggtggct
cgggcggtggtgggtcgggtggcggcggatct -- V-H chain:
aa 148–267 anti-CD19 CAR (Genbank
AMZ04819) Stalk/Transmembrane: aa 138–206 CD8
(Uniprot Q96QR6_HUMAN) Cytosolic
sequence: aa 500–534 Mouse CD19 (Uniprot
CD19_MOUSE) Fluorophore: mCherry
Recombinant
DNA reagent		CD19 tandem CARthis paperSignal peptide: aa 1–21 CD8 (Uniprot Q96QR6_
HUMAN) Extracellular antibody sequence: V-L
chain: aa 23–130 anti-CD19 CAR
(Genbank AMZ04819) -- GS linker: ggtggcggtggctc
gggcggtggtgggtcgggtggcggcggatct -- V-H chain:
aa 148–267 anti-CD19 CAR (Genbank
AMZ04819) Stalk/Transmembrane: aa 138–206 CD8
(Uniprot Q96QR6_HUMAN) Cytosolic sequence:
aa 500–534 Mouse CD19 (Uniprot CD19
_MOUSE) fused to aa 19–86 Mouse Fc ERG
precursor (FCERG_MOUSE) Fluorophore: mGFP
Recombinant
DNA reagent		GFP-CaaXthis papereGFP fused to a c terminal
CaaX targeting sequence: aaaatgtccaaggatggta
agaaaaagaagaagaagtcaaaaaccaagtgtgttatcatg
Recombinant
DNA reagent		mCherry-CaaXthis papermCherry fused to a c terminal
CaaX targeting sequence: aaaatgtccaaggatggt
aagaaaaagaagaagaagtcaaaaaccaagtgtgttatcatg
Recombinant
DNA reagent		OVA/p2a/mCherry-CaaXthis paperCytoplasmic Ovalbumin (UNIPROT:
SERPINB14)/p2 a site: GGAAGCGGAGCTACTAA
CTTCAGCCTGCTGAAGCAGGCTGGAGA
CGTGGAGGAGAACCCTGGACCT/followed by
mCherry fused to a c terminal CaaX targeting
sequence: aaaatgtccaaggatggtaagaaaaagaag
aagaagtcaaaaaccaagtgtgttatcatg
Peptide,
recombinant protein		His10-CD3 zetaHui and Vale (2014)
PMID: 24463463		aa 52–164, Human TCR CD3 zeta chain
(Uniprot CD3Z_HUMAN) fused to Hisx10 tag
Peptide,
recombinant protein		His10-FcRɣthis paperaa 45–85, Human FcRɣ (Uniprot FCERG
_HUMAN) fused to Hisx10 tag
Peptide,
recombinant protein		SNAP-Syk tSH2this paperaa 1–262, Mouse Syk (Uniprot KSYK_MOUSE)
with N-term SNAP tag
Peptide,
recombinant protein		His10-Lck Y505FHui and Vale (2014)
PMID: 24463463		full length Human Lck with inhibitory Tyr 505
mutated to Phe (Uniprot LCK_HUMAN) fused
to Hisx10 tag
Antibodyanti phospho-TyrosineSanta CruzPY201:100 IF primary
Antibodyanti mouse IgG coupled to
Alexa Fluor 647		Thermo/LifetechA212361:200 IF secondary
Antibodyanti mouse CD11c coupled
to APC		BioLegend117313FACS
Antibodyanti mouse F4/80 coupled
to APC/Cy7		BioLegend123117FACS
OtherDMEMGibco11965–092
OtherPen-Strep-GlutamineCorning30–009 Cl
OtherFetal Bovine Serum (FBS)Atlanta BiologicalsS1150H
OtherRPMIGibco11875–093
OtherHEPESGibco1530080
Other2-MercaptoethanolSigmaM6250-100mL
Commercial
assay or kit		MycoAlert Mycoplasma
Testing Kit		LonzaLT07-318
Recombinant
DNA reagent		pMD2.G lentiviral
plasmid		otherAddgene 12259D. Stainier, Max Planck; VSV-G envelope
Recombinant
DNA reagent		pCMV-dR8.91otherCurrent Addgene
8455
Recombinant
DNA reagent		pHRSIN-CSGWotherAs cited James and Vale (2012),
PMID: 22763440
OtherLipofectamine LTXInvitrogen15338–100Lentivirus production
OtherLipofectamineInvitrogen18324–012Added to spin infections
to improve transduction
OtherHamilton Gastight
Syringes		Hamilton8 1100
OtherPOPCAvanti850457
OtherNi2+-DGS-NTAAvanti790404
OtherPEG5000-PEAvanti880230
Otheratto390 DOPEATTO-TEC GmbHAD 390–161
OtherPBS (Tissue Culture Grade)Gibco20012050
OtherBioruptor PicoDiagenodeUsed for producing SUVs
Other5 um silica microspheresBangsSS05N
Peptide,
recombinant protein		CD19-His8Sino Biological11880H08H50
Peptide,
recombinant protein		CD22-His8Sino Biological11958H08H50
Other2.5 um silica microspheres
(size titration)		CorpuscularC-SIO-2.5
Other5 um silica microspheres
(size titration)		CorpuscularC-SIO-5
Other10 um silica microspheres
(size titration)		CorpuscularC-SIO-10
Other15 um silica microspheres
(size titration)		CorpuscularC-SIO-15
Other20 um silica microspheres
(size titration)		CorpuscularC-SIO-20
OtherLow retention tubes
for microsphere cleaning		Eppendorf22431081
OtherMatriPlateBrooksMGB096-1-2-LG-L
Peptide,
recombinant protein		M-CSFPeprotech315–02
OtherIMDMThermo12440079
OtherRetronectinClontechT100A
Commercial
assay or kit		CD8 + T cell
purification kit		Stemcell19853
OthereFluor670
proliferation dye		Thermo65-0840-85
Chemical
compound, drug		phRSIN-CSGWSigmaL4516
OtherFluorobrite DMEMGibcoA1896701
OtherDMEM minus phenol
red		GibcoA14430-01
OtherRhodamine PEAvanti810150C
OtherDOPSAvanti840035C
OtherSNAP-Cell 505-StarNEBS9103S
OtherPD MiniTrap G-25 columnGE Healthcare28-9225-29 AB
Other6.4% Paraformaldehyde
solution		Electron Microscopy
Sciences		50980495
Chemical
compound, drug		AlexaFluor 647 PhalloidinThermo/Molecular ProbesA22284
Software,
algorithm		ImageJNIH
Software,
algorithm		IllustratorAdobeCC, CS6
Software,
algorithm		PhotoshopAdobeCC, CS6
Software,
algorithm		Fijihttps://fiji.sc/
Software,
algorithm		PrismGraphPad7
Antibodyanti human CD19
(mouse antibody)		OriGeneTA506240 Clone
OTI2F6		IgG2a mouse monoclonal antibody
Antibodyanti human CD47
(mouse antibody)		BD556044 Clone
B6H12		IgG1 mouse monoclonal antibody
Antibodyanti Ovalbumin
(rabbit antibody)		PiercePA1-196IgG rabbit polyclonal antibody

Additional files

Transparent reporting form
https://doi.org/10.7554/eLife.36688.017

Download links