miR-34a is a microRNA safeguard for Citrobacter-induced inflammatory colon oncogenesis
- Institute of Biophysics, Chinese Academy of Sciences, China
- University of Chinese Academy of Sciences, China
- Duke University, United States
- Affiliated Hospital of Nanjing University of TCM, China
- Cornell University, United States
Figures
Figure 1 with 2 supplements
C.rodentium infection induces colonic tumor formation and stem cell enrichment in miR-34a-/- mice.
(A) Representative H and E staining of colon tissues from infected and uninfected wildtype (WT) and miR-34a-/- mice. Scale bar, 100 μm. (B) Representative images of mouse colons uninfected or infected with C. rodentium. The arrows indicate the visible colon tumors. 2 × 109 CFU C. rodentium were used to infect the mice orally. Six months after the infection, the mice were euthanized and the colons were imaged. Scale bar, 5 mm. (C) Frequencies of colonic tumor formation in infected and uninfected mice. (D) Immunofluorescence of Ascl2 showing enriched colon stem cells in miR-34a-/- colon tumors. Scale bar, 40 μm. (E) Western blot of Ascl2 and Lgr5 showing enriched colon stem cells in miR-34a-/- colon tumors. (F–H) Representative colon organoids images (F) and quantification showing organoid-forming efficiency (H) and organoid sizes. Colon organoids were cultured from uninfected mice and C. rodentium infected mice after 2 months. 1000 organoid cells from each condition were reseeded to examine organoid-forming efficiency and organoids growth.
Figure 1—figure supplement 1
C.rodentium infection induces colonic tumor formation in miR-34a-/- mice.
(A) Representative H and E staining of C. rodentium infection-induced colon lesions in miR-34a-/- mice. (B and C) Representative images of liver (B) and lung (C) from colonic adenoma and adenocarcinoma burdened miR-34a-/- mice showing no liver or lung metastasis.
Figure 1—figure supplement 2
No detectable APC mutation in tumors from infected miR-34a-/- mice.
(A–C) PCR was performed using primers to amply three most APC mutation regions in mouse colon cancer. Primers: ‘GCCATCCCTTCACGTTAG’ and ‘TTCCACTTTGGCATAAGGC’ for DNA sequence containing mutation 1 (A); Primers: ‘TGACAGCACAGAATCCAGTG’ and ‘TACCAAGCATTGAGAG’ for DNA sequence contains mutation 2 (B); Primers: ‘TAGGCACTGGACATAAGGGC’ and ‘GTAACTGTCAAGAATCAATGG’ for DNA sequence containing mutation 3 (C).
Figure 2 with 1 supplement
C.rodentium infection enhances Th17 cell infiltration in miR-34a-/- colonic tumors.
(A) RT-qPCR showing relative expression of the CD4+ T lymphocyte genes associated with Th1 (IFN-γ), Th2 (IL-4), Th17 (IL-17), and Treg (FOXP3) cells in the colons from C. rodentium infected wild-type and miR-34a-/- mice. (B) FACS analysis showing Th17 cells (CD4+/IL-17+) numbers in infected and uninfected mice colon at month 2. (C) FACS analyses of CD4 +T cells from each infected and uninfected WT and miR-34a-/- mice colon at month 6. The percentages of Th17 cells (CD4+/IL-17+) are marked. (D and E) Immunofluorescence of CD4 (D) and IL-17 (E) in infected colons showing enhanced Th17 cells infiltrating in miR-34a-/- colonic tumors. Scale bar, 40 μm. Error bars denote s.d. of triplicates. ***p<0.001. p-value was calculated based on Student’s t-test.
Figure 2—figure supplement 1
Presence of innate immune cells in C. rodentium-infected wild-type and miR-34a-/- mice.
(A) FACS plots based on CD117 and CD45 markers performed on lineage- cell populations isolated from colons of C. rodentium-infected wild-type and miR-34a-/- mice. (B) RT-qPCR showing IL-17 expression in lineage-/CD117+/CD45 +cells isolated from C. rodentium-infected colon of wild-type and miR-34a-/- mice. (C) FACs analysis of macrophages in C. rodentium infected colons of wildtype and miR-34a-/- mice. (D) FACs analysis of neutrophils in C. rodentium infected colons of wildtype and miR-34a-/- mice.
Figure 3 with 4 supplements
miR-34a targets IL-6R, IL-23R and CCL22.
(A) Western blot showing IL-6R and IL-23R expression levels in CD4 +T cells isolated from C. rodentium infected colon of wild-type and miR-34a-/- mice. (B and C) Schematic representation of mouse IL-6r (B) and IL-23r (C) 3`UTRs containing the putative miR-34a binding sites. (D and E) Luciferase reporter assays confirming the miR-34a binding sites. 3`UTRs of mouse IL-6r (D) and IL-23r (E) containing wild-type (Wt) or mutated (Mut) putative miR-34a binding sites were cloned into the 3`UTR of firefly luciferase (Fluc). Ectopic miR-34a expression in CT26 cells downregulated luciferase in Wt cells, but not in Mut cells. Fluc signals were normalized by a simultaneously delivered Renillar luciferase (Rluc) expression plasmid. (F) FACS showing knockdown of IL-6r or IL-23r in CD4 +T cells largely offsets the effect of miR-34a loss on Th17 cell differentiation. (G) Western blot showing increase of CCL22 expression in miR-34a-/- colon crypts. (H) Schematic representation of miR-34a binding site on the mouse CCL22 3`UTR. (I) Luciferase reporter assays confirming the miR-34a binding sites in mouse CCL22 3`UTR. (J) Chemotaxis assay showing knockdown of CCL22 in colon tumor organoid cells or neutralization of CCL22 with anti-CCL22 antibody suppresses Th17 cell migration to colon tumor organoid conditioned medium. Error bars denote s.d. of triplicates. **p<0.01; ***p<0.001. p-value was calculated based on Student’s t-test.
Figure 3—figure supplement 1
miR-34a loss upregulates target genes in uninfected mice.
(A–D) Western blots showing levels of IL-6R (A) and IL-23R (B) in CD4 +T cells and levels of CCL22 (C) and IL-17RD (D) in colon epithelial cells from wild-type (WT) and miR-34a-/- mice. (E–H) Western blot showing levels of IL-6R (E) and IL-23R (F) in CD4 +T cell and levels of CCL22 (G) and IL-17RD (H) in colon epithelial cells from Lgr5-EGFP-CreERT2/miR-34aflox/flox mice.
Figure 3—figure supplement 2
Validation of gene knockdown efficiency.
Western blots showing the knockdown efficiency of IL-6r, IL-23r, CCL22, IL-17ra, and IL-17rd.
Figure 3—figure supplement 3
Loss of miR-34a enhances CCL22 expression in colon epithelium.
(A) RT-qPCR showing relative expression of CCR6 and CCR4 in CD4 +T cells derived from C. rodentium- infected miR-34a-/- colonic tumors and wild-type controls. (B) RT-qPCR showing relative expression of CCL20 and CCL22 in C. rodentium infected miR-34a-/- colonic tumors and wild-type controls. Error bars denote s.d. of triplicates. ***p<0.001. p-value was calculated based on Student’s t-test.
Figure 3—figure supplement 4
Global gene expression in colon epithelial and CD4 +T cells from wildtype vs. miR-34a-/- mice.
(A and B) Heatmaps of global gene expression in miR-34a-/- and wildtype mouse colon epithelial cells (A) and CD4 +T cells (B). (C) Volcano plots showing differential gene expression between wildtype and miR-34a-/- cells. (D) Cumulative distribution plots of miR-34a targets.
Figure 4 with 1 supplement
Th17 cells enhance colon organoid growth through IL-17.
(A) Th17 cells enhance colon organoid growth in co-culture. When co-cultured with Th17 cells, colon organoids grow faster with bigger surface area. Anti-IL-17 antibody abrogates Th17 promotion of colon organoids growth. (B and C) Recombinant mouse IL-17 enhances mouse organoids growth as shown by representative mouse colon organoids images (B) and quantitative organoid area (C). (D) Western blot showing that mouse IL-17 increases the expression of colon stem cell markers, Ascl2 and Lgr5, in mouse colon organoids. (E) Western blot of phospho-stat3 with IL-17 (20 ng) and STAT3 inhibitor, stattic (20 μM). (F and G) Representative organoid images (F) and quantification of organoid area (G) with IL-17 and stattic. (H) Western blot of phospho-stat3 and phospho-p65 with IL-17 (20 ng) and an NF-κB inhibitor, BAY 11–7802 (5 μM). (I and J) Representative organoid images (I) and quantificaiton of organoid area (J) with IL-17 and BAY 11–7802. Error bars denote s.d. of triplicates. **p<0.01; ***p<0.001. p-value was calculated based on Student’s t-test. .
Figure 4—figure supplement 1
IL-17 activates STAT3 and promotes organoid growth.
(A) Western blot showing IL-17 rescues inhibition of STAT3 phosphorylation by Stattic. (B) Representative organoid images showing IL-17 rescues organoids growth suppressed by Stattic.
Figure 5 with 2 supplements
miR-34a targets orphan receptor IL-17RD in colon stem cells to suppresses IL-17-induced growth.
(A) RT-qPCR showing relative expression of IL-17ra and IL-17rd in C. rodentium infected miR-34a-/- colonic tumors and wildtype controls. (B) Western blot showing increase of IL-17RD expression in miR-34a-/- colonic tumors. (C) Schematic representation of mouse IL-17rd 3`UTR and the putative miR-34a binding site. (D) Luciferase reporter assay confirming the miR-34a binding sites in mouse IL-17rd 3`UTR. (E) Immunoprecipitation showing the IL-17RA and IL-17RD complex in the colon crypt. (F) Western blot showing IL-17RA and IL-17RD is required for IL-17 mediated STAT3 activation. (G and H) IL-17RA and IL-17RD knockdown suppresses IL-17 mediated colon organoids growth as shown by representative organoids images (G) and quantitative organoids surface area (H). (I) IL-17RD knockdown reduces miR-34a deficiency-induced colon organoids growth. Error bars denote s.d. of triplicates. **p<0.01; ***p<0.001. p-value was calculated based on Student’s t-test.
Figure 5—figure supplement 1
Validation of miR-34a targeting IL-17RD using CRISPER/CAS9.
(A) DNA sequencing showing mutation of miR-34a binding site in the IL-17rd 3`UTR in wildtype and miR-34a-/- colonic organoids. The blue box indicate miR-34a binding site and the red box indicates sequence complementary to the miR-34a seed region. (B) Western blot showing CRISPR-induced mutation of the miR-34a binding site increased IL-17RD expression in wildtype colon epithelial cells but not in miR-34a-/- cells.
Figure 5—figure supplement 2
Expression of miR-34a, miR-34b and miR-34c.
(A) RT-qPCR showing higher miR-34a expression in Lgr5-GFP + colon epithelial cells than Lgr5-GFP- cells. (B) RT-qPCR showing miR-34a, miR-34b and miR-34c levels in colon epithelial cells. (C and D) RT-qPCR showing miR-34a expression levels in colon epithelial cells (C) and CD4 +T cells (D) from mice infected with C. rodentium for 7 days, 14 days and 21 days.
Figure 6 with 3 supplements
Conditional miR-34a knockout in LGR5-EGFP + stem cells and in bone marrow transplanted immune cells contribute to tumorigenesis and Th17 cell accumulation while IL-17 neutralizing antibody blocks stem cell proliferation and tumorigenesis.
(A) Schematic of the C. rodentium-infected Lgr5-EGFP-CreERT2/miR-34aflox/flox mouse model. (B) Frequencies of colon tumor formation in C. rodentium infected and uninfected Lgr5-EGFP-CreERT2/miR-34aflox/flox mice model. (C) FACS analyses of Th17 cells (CD4+/IL-17+) in C. rodentium infected and uninfected Lgr5-EGFP-CreERT2/miR-34aflox/flox mice colon. (D) Schematic of the C. rodentium-infected miR-34a-/- bone marrow transplant mouse model. (E) Frequencies of colonic tumor formation in C. rodentium infected and uninfected miR-34a-/- bone marrow transplant mice. (F) FACS analyses of Th17 cells (CD4+/IL-17+) in C. rodentium infected and uninfected miR-34a-/- bone marrow transplant mice colon. (G) Schematic of the IL-17 neutralizing antibody treatment. 500 ug isotype control or IL-17 antibody were intraperitoneally injected at the indicated days. (H) Immunofluorescence of Ascl2 showing IL-17 antibody largely abrogated C. rodentium-infection-induced colon cancer stem cell proliferation. Scale bar, 40 μm. (I) Western blot of Ascl2 and Lgr5 showing IL-17 antibody-abrogated C. rodentium-infection-induced colon stem cell marker expression. (J) Schematic of the IL-17 neutralizing antibody treatment. 500 μg isotype control or IL-17 antibody were intraperitoneally injected at the indicated days. (K) Representative H and E staining of colon tissues from IL-17 antibody or isotype control treated mice. Scale bar, 50 μm. (L) Frequencies of colonic tumor formation in IL-17 antibody or isotype control treated mice.
Figure 6—figure supplement 1
Validation of miR-34a conditional knockout mice.
Lgr5-EGFP-CreERT2/miR-34aflox/flox mice were treated with tamoxifen. Genotyping was performed to validate miR-34a deletion.
Figure 6—figure supplement 2
Numbers of Th17 cells in infected Lgr5-EGFP-CreERT2/miR-34aflox/flox mouse colons.
The numbers of CD4 +IL17+Th17 cells in infected Lgr5-EGFP-CreERT2 (control) and Lgr5-EGFP-CreERT2/miR-34aflox/flox mouse colon (CKO) colon, quantified by FACS analysis.
Figure 6—figure supplement 3
Validation of bone marrow transplantation efficiency.
Bone marrow cells from male C57BL/6J miR34a-/- donor mice with Ptprcb leukocyte marker CD45.2/Ly5.2 were transplanted into irradiated male C57BL/6J.SJL mice (Ly5.1) with the Ptprcb leukocyte marker CD45.1/Ly5.1 mice. 6 weeks after transplantation, blood cell lineages from the recipient mice were analyzed by flow cytometry using CD45.1-PE and CD45.2-FITC.
Figure 7 with 1 supplement
IL-17 and miR-34a expression in human CRC.
(A and B) Human IL-17 enhances human colon organoids growth as shown by representative human colon organoids images (A) and quantitative organoids area (B). Error bars denote s.d. of triplicates. **p<0.01; p-value was calculated based on Student’s t-test. (C–F) RT-qPCR of colonic tumor and normal colon tissue samples from CRC patients (Figure 7—source data 1) comparing IL-17, RORC, IL-17RD, and miR-34a transcript levels. Dots refer to different samples, and lines connect the paired samples. Error bars denote s.e.m. of 17 normal and cancer samples. p-values were calculated based on paired t-test.
-
Figure 7—source data 1
Source data for Figure 7.
This file contains the information of CRC patients.
- https://doi.org/10.7554/eLife.39479.023
-
Figure 7—source data 2
Source data for Figure 7.
This file contains RT-qPCR primers used in this study.
- https://doi.org/10.7554/eLife.39479.024
Figure 7—figure supplement 1
miR-34a targets human IL-6R, IL-17RD and CCL22.
(A) Western blot showing ectopic miR-34a expression suppresses human IL-6R expression. (B) Schematic representation of human IL-6r 3`UTRs containing the putative miR-34a binding sites. (C) Luciferase reporter assays confirming the miR-34a binding sites at 3`UTRs of human IL-6r. (D) Western blot showing ectopic miR-34a expression suppresses human CCL22 expression. (E) Schematic representation of human CCL22 3`UTRs containing the putative miR-34a binding sites. (F) Luciferase reporter assays confirming the miR-34a binding sites at 3`UTRs of human IL-6r. (G) Western blot showing ectopic miR-34a expression suppresses human IL-17RD expression. (H) Schematic representation of human IL-17rd 3`UTRs containing the putative miR-34a binding sites. (I) Luciferase reporter assays confirming the miR-34a binding sites at 3`UTRs of mouse IL-17rd. (J–L) Western blot and luciferase reporter assay showing human IL-23R is not targeted by miR-34a.
Figure 8
with two source data miR-34a regulates Th17 cell-mediated proliferation.
A schematic illustration of the central role of miR-34a in Th17 cell-mediated colon stem cell proliferation. miR-34a suppresses Th17 cell differentiation and expansion by targeting IL-6R and IL-23R in immune cells. miR-34a further inhibits Th17 cells recruitment by targeting CCL22 in the colon epithelium. miR-34a also inhibits IL-17RD expression to suppress IL-17-IL-17RD/IL17-RA-mediated colon stem cell proliferation.
-
Figure 8—source data 1
Transcriptomic profiling of epithelial cells.
- https://doi.org/10.7554/eLife.39479.026
-
Figure 8—source data 2
Transcriptomic profiling of CD4+ T cells.
- https://doi.org/10.7554/eLife.39479.027
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.39479.028
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
miR-34a is a microRNA safeguard for Citrobacter-induced inflammatory colon oncogenesis
eLife 7:e39479.
https://doi.org/10.7554/eLife.39479
