Adrb2 controls glucose homeostasis by developmental regulation of pancreatic islet vasculature
- Johns Hopkins University, United States
Figures
Figure 1 with 1 supplement
Loss of Adrb2 in neonatal β-cells results in glucose intolerance and impaired insulin secretion in female mice.
(A) Adult (2-month-old) female Adrb2 cKO mice have elevated fasting blood glucose and are glucose intolerant. Means ± SEM for n = 6 control and seven mutant female mice. *p<0.05, ***p<0.001, t-test. (B) Area under the curve (AUC) for glucose tolerance. *p<0.05, t-test. (C) Glucose tolerance is unaffected in male Adrb2 cKO mice at 2 months. Means ± SEM for n = 6 control and nine mutant mice for glucose tolerance. (D) Area under the curve (AUC) for glucose tolerance in males. (E, F) Glucose-stimulated insulin secretion (GSIS) in vivo is reduced in female but not male Adrb2 cKO mice. Means ± SEM for n = 6 control and eight mutant female mice; n = 5 control and six mutant male mice *p<0.05, t-test. (G) Decreased basal insulin secretion and GSIS in isolated adult female Adrb2 cKO islets. Means ± SEM from n = 4 control and six mutant mice. **p<0.01, ****p<0.0001, two-way ANOVA with Bonferroni’s post-test. (H) Islet Adrb2 expression declines postnatally and is significantly lower in adult males and females compared to neonatal stages. For female islets, p<0.01, t-test for P60 compared to P6. For male islets, p<0.0001 for P60 compared to P6 (one sample t-test since male P6 values were normalized to (1). Adrb2 levels are higher in female islets compared to males at all timepoints assessed. *p<0.05, **p<0.01, t-test. Adrb2 expression in P2, P6, and P60 islets was assessed by qRT-PCR analyses and data were normalized to 18S rRNA. Results are means ±SEM and expressed as fold-change relative to P6 male islets for n = 3–5 mice/sex/age. (I) Neonatal β-cell-specific Adrb2 deletion elicits glucose intolerance in mice. Neonatal Adrb2 i-cKO mice were injected with TMX or vehicle on the day of birth and 1 day later (P0–P1), and glucose tolerance was tested when mice were 2 months old. Means ± SEM for n = 7 vehicle and 5 TMX-injected Adrb2 i-cKO mice. *p<00.5, **p<0.01, ***p<0.001, t-test. (J) AUC for glucose tolerance. *p<0.05, t-test. (K) Neonatal β-cell-specific Adrb2 deletion results in impaired GSIS. Means ± SEM for n = 4 vehicle and 4 TMX-injected Adrb2 i-cKO mice. *p<0.05, **p<0.01, t-test.
-
Figure 1—source data 1
This spreadsheet includes raw data for glucose tolerance and insulin secretion.
- https://doi.org/10.7554/eLife.39689.005
Figure 1—figure supplement 1
Adrb2 expression, insulin sensitivity and islet morphology in adult Adrb2 cKO mice, and effects of adult β-cell-specific Adrb2 deletion on glucose tolerance and insulin secretion.
(A) Adrb2 transcript levels are significantly decreased in P6 Adrb2 cKO pancreas, while other adrenergic receptors are unaltered. Transcript levels were normalized to 18S RNA. Results are means ±SEM and expressed as fold-change relative to control Adrb2f/f values. n = 6 control and 6–8 mutant mice. ****p<0.0001, one sample t-test. (B) Adrb2 mRNA is significantly reduced in both female and male Adrb2 cKO adult (2 month) islets compared to same-sex controls. Note that in controls, Adrb2 expression is higher in female islets compared to males. n = 3 control mice per sex, five female mutant and three male mutant mice. *p<0.05, **p<0.01, ****p<0.0001, one-sample t-test. (C, D) Normal insulin sensitivity in male (C) and female (D) Adrb2 cKO mice. Means ± SEM for n = 3 female control mice, four male control, six mutant females and six mutant male mice. **p<0.01, ***p<0.001, one-sample t-test. (E) Pancreatic Adrb2 loss does not affect adult islet organization, but results in increased insulin immunoreactivity. Scale bar, 50 µm. (F) Increased insulin content in adult (2 month) Adrb2 cKO islets. n = 5–7 mice/genotype. **p<0.01, t-test. (G) Normal endocrine cell numbers in adult Adrb2 cKO islets. Means ± SEM from n = 4 mice/genotype, one-way ANOVA with Tukey’s post-test. (H) Adrb2 cKO mice have smaller islets relative to controls. Means ± SEM from n = 3 control and four mutant mice, **p<0.01, t-tests. (I, J) Adrb2 loss does not affect β-cell proliferation in adult islets. Scale bar, 50 µm. Quantification of EdU/insulin-double positive cells from n = 3 mice/genotype. (K) Adrb2 is enriched in neonatal β-cells. β-cells were isolated by FACS purification from MIP-GFP mice at postnatal day 6 (P6). n = 9 β-cell samples and four non-β-cell samples, **p<0.01, one sample t-test. (L) Adult β-cell Adrb2 loss does not affect glucose tolerance. Mature Adrb2 i-cKO mice were injected with tamoxifen (TMX) or corn oil (vehicle) at 5–6 weeks of age and glucose tolerance was tested 4 weeks later. Means ± SEM for n = 5 vehicle and 7 TMX-injected mice. (M) Area under the curve (AUC) for glucose tolerance. (N) Normal GSIS with adult β-cell Adrb2 deletion. Means ± SEM for n = 6 control and 5 TMX-injected mice. (O) Adult β-cell Adrb2 loss does not affect GSIS in Adrb2 i-cKO islets. Means ± SEM for n = 3 mice per condition. **p<0.01, two-way ANOVA with Bonferroni’s post-test.
-
Figure 1—figure supplement 1—source data 1
This spreadsheet includes raw data for Adrb2 expression, metabolic analyses, and islet morphology.
- https://doi.org/10.7554/eLife.39689.004
Figure 2 with 1 supplement
Adrb2 suppresses insulin expression and islet vasculature in neonatal mice.
(A) Adrb2 loss increases insulin immunoreactivity in neonatal (P6) islets, although islet cyto-architecture is unaffected. Scale bar, 25 µm. (B) Enhanced Ins2 transcript levels in neonatal Adrb2 cKO pancreata. Ins2 levels were assessed by qRT-PCR and normalized to 18S RNA. Results are means ±SEM for n = 4 mice per genotype for the P0 and P2 time points, and 10 mice per genotype for P6. *p<0.05, n.s. not significant, one-sample t-test. (C) Transmission electron microscopy reveals an increase in insulin granules in β-cells from P6 Adrb2 cKO mice. β-cells outlined in dashed lines. Scale bar, 2 µm. (D) Quantification of cytoplasmic insulin granule density. Means for n = 3 mice per genotype. *p<0.05, t-test. (E) Adrb2 cKO mice have excess intra-islet vasculature, using PECAM1 immunostaining. Islets are outlined in dashed lines. Scale bar, 50 µm. (F) Quantification of total vessel length (mm) per islet area (mm2). Means ± SEM for n = 3 mice per genotype. **p<0.01, t-test. (G) Transmission electron microscopy shows disruptions in endothelial morphologies and vascular basement membrane in Adrb2 cKO islets. Fenestrae (arrows) are reduced, while caveolae (arrowheads) are increased in Adrb2 cKO islets. Basement Membrane (B.M) is expanded in mutants. Scale bar, 500 nm. (H) Quantification of fenestrae and (I) caveolae density. Means for n = 3 mice per genotype, *p<0.05, **p<0.01, t-test. (J) Vegfa transcript levels are significantly increased in the Adrb2 cKO pancreas starting at P2. Vegfa levels were assessed by qRT-PCR analysis and normalized to 18S RNA. Results are means ±SEM expressed as fold-change relative to age-matched control Adrb2f/f values. n = 3 P0 per genotype, 3 control and four mutant P2, and 5 P6 mice per genotype **p<0.01, n.s. not significant, one-sample t-test. (K) Increased Vegfa mRNA in purified β-cells from P6 Adrb2 cKO mice. Vegfa levels were assessed by qRT-PCR analysis and normalized to 18S RNA. Means ± SEM and expressed as fold-change relative to control values. n = 5 control and seven mutant mice. *p<0.05, one sample t-test. (L) Vegfa transcript levels (normalized to 18S rRNA) are unchanged in non-β-cells from Adrb2 cKO mice. Means ± SEM and expressed as fold-change relative to control values. n = 4 control and six mutant mice. n.s. not significant, one sample t-test.
-
Figure 2—source data 1
This spreadsheet includes raw data for islet morphology and transcript changes in neonatal mice.
- https://doi.org/10.7554/eLife.39689.009
Figure 2—figure supplement 1
Islet morphology and vasculature in neonatal Adrb2 cKO mice.
(A) Normal endocrine cell numbers in P6 Adrb2 cKO islets. Means ± SEM from n = 6 control and four mutant mice, one-way ANOVA with Tukey’s post-test. (B) Neonatal (P6) Adrb2 cKO mice have smaller-sized islets relative to controls. Means ± SEM from n = 6 control and four mutant mice, *p<0.05, ****p<0.0001 one-way ANOVA with Tukey’s post-test. (C) β-cell proliferation is unchanged in P6 Adrb2 cKO islets. Scale bar, 50 µm. (D) Quantification of EdU/insulin double-positive cells from n = 3 mice/genotype. (E) Insulin content is increased in neonatal (P6) Adrb2 cKO islets. Means ± SEM from n = 3 control and five mutant mice, *p<0.05, t-test. (F) Ins2 transcript levels are unchanged by stimulation with Adrb2 agonists, Salbutamol (SALB), Epinephrine (EPI), or Norepinephrine (NE) in MIN6 cells. MIN6 cells were treated with each agonist (10 µM) for 16 hr. Ins2 levels were assessed by qRT-PCR analysis and normalized to 18S RNA. Means ± SEM and expressed as fold-change relative to control values. n = 3 independent experiments for SALB and NE, four independent experiments for EPI. (G) Vascular basement membrane proteins, Collagen IV and Laminin-411/511, are increased in Adrb2 cKO islets at P6. Scale bar, 25 µm. (H) Sympathetic innervation, assessed by TH immunoreactivity, is unaltered in the Adrb2 cKO pancreas. Scale bar, 50 µm. (I) Quantification of TH immunofluorescence. Means from n = 3 control and five mutant mice. (J) Vegfa transcript levels are significantly decreased by Salbutamol (SALB), or epinephrine (EPI), but not norepinephrine (NE), in MIN6 cells. MIN6 cells were treated with each agonist (10 µM) for 16 hr. Means ± SEM and expressed as fold-change relative to control values. n = 3 independent experiments for SALB and NE, four independent experiments for EPI. *p<0.05, **p<0.01, one-sample t-test. (K) Vegfa transcript levels are higher in neonatal (P6) male pancreata compared to females. Adrb2 loss does not affect Vegfa expression in male pancreata. Vegfa levels were assessed by qRT-PCR analysis and normalized to 18S rRNA. Means ± SEM for n = 4 female and 4–5 male mice per genotype. *p<0.05 one-sample t-test. (L) Enhanced PECAM1 immunoreactivity in P6 male islets compared to females. PECAM1 expression is similar in male Adrb2 cKO and control islets. Scale bar, 50 µm. (M) Quantification of total vessel length (mm) per islet area (mm2) in P6 male islets. Means ± SEM for n = 3 mice per genotype. *p<0.05, t-test compared to control female values (dashed line), n.s. not significant.
-
Figure 2—figure supplement 1—source data 1
This spreadsheet includes raw data for islet morphology and transcript changes in neonatal mice.
- https://doi.org/10.7554/eLife.39689.008
Figure 3 with 1 supplement
Loss of Adrb2 perturbs islet calcium responses and exocytosis.
(A) Adrb2 is required for KCl-induced insulin secretion. Means ± SEM for n = 4 control and five mutant mice. *p<0.05, ****p<0.001, two-way ANOVA with Bonferonni’s post-test. (B) Adrb2 is necessary for glucose-induced surface localization of insulin granules. Docked insulin granules in β-cells (within 50 nm of plasma membrane) are indicated by arrowheads. Scale bar, 1 µm. (C) Quantification of docked insulin granules per micron of plasma membrane. Means ± SEM from n = 3 mice each per genotype/per condition. **p<0.01, n.s. not significant; two-way ANOVA with Bonferonni’s post-test. (D) Loss of Adrb2 loss impairs islet calcium responses induced by high glucose or KCl. Scale bar, 50 µm. (E) Quantification of normalized Fluo-4 intensities over time. Means ± SEM for n = 3 female mice per genotype, 10 cells analyzed per animal. (F) Decreased expression of transcripts involved in calcium signaling and insulin exocytosis in isolated islets from adult female Adrb2 cKO mice. Adrb2 loss also results in aberrant expression of genes involved in β-cell maturation including Neurod1, Npy, and Slc2a2. Transcript levels were assessed by qRT-PCR and data normalized to 18S RNA. Means ± SEM and expressed as fold-change relative to control female Adrb2f/f values. n = 6 control and 3 – 5 mutants. *p<0.05, one sample t-test compared to normalized female control values.
-
Figure 3—source data 1
This spreadsheet includes raw data for insulin secretion, calcium responses, and islet gene expression.
- https://doi.org/10.7554/eLife.39689.012
Figure 3—figure supplement 1
Altered expression of Glut2 and NPY in Adrb2 cKO islets.
(A) Adult (1.5 – 2 month-old) Adrb2 cKO islets have diminished Glut2 and increased NPY expression. Scale bar, 50 µm.
Figure 4 with 1 supplement
Developmental VEGF blockade rescues defects in islet vasculature, insulin secretion, and glucose tolerance in Adrb2 cKO mice.
(A) VEGFR2 antibody injections rescue islet hyper-vascularization in neonatal Adrb2 cKO mice. Islets are outlined in dashed lines. Scale bar, 25 µm. (B) Quantification of total vessel length (mm) per islet area (mm2). Means ± SEM from three control and Adrb2 cKO+ vehicle injected, and 4 Adrb2 cKO +antibody injected mice. *p<0.05, one-way ANOVA with Tukey’s post-test. (C) Ins2 levels are normalized in VEGFR2 antibody-injected Adrb2 cKO neonates. Means ± SEM from 12 control (Adrb2f/f)+vehicle injected, 7 Adrb2 cKO +vehicle injected, and 5 Adrb2 cKO +antibody injected mice. *p<0.05, **p<0.01, one-way ANOVA with Tukey’s post-test. (D) Neonatal administration of VEGFR2 blocking antibody (P0–P6) rescues glucose intolerance in adult female Adrb2 cKO mice. Means ± SEM for n = 10 control+vehicle, five mutant +vehicle, and six mutant +antibody injected mice. *p<0.05, **p<0.01 Adrb2 cKO +vehicle significantly different from control Adrb2f/f mice, and #p<0.05, ##p<0.01 Adrb2 cKO +vehicle significantly different from Adrb2 cKO +antibody injected mice, one-way ANOVA with Tukey’s post-test. (E) Area under the curve (AUC) for glucose tolerance. ***p<0.001, n.s. not significant, one-way ANOVA with Tukey’s post-test. (F) Rescue of adult islet GSIS in Adrb2 cKO mice injected with VEGFR2 antibody during the first week of birth. Means ± SEM for n = 4 control+vehicle, three mutant +vehicle, and four mutant +antibody injected mice. *p<0.05, n.s. not significant, two-way ANOVA with Bonferroni’s post-test. (G) Developmental VEGFR2 blockade restores expression of genes involved in calcium signaling, exocytosis, and β-cell maturation in adult Adrb2 cKO mice. Transcript levels were assessed by qRT-PCR analysis and normalized to 18S RNA. Means ± SEM and expressed as fold-change relative to control Adrb2f/f+ vehicle values. n = 3 control+vehicle, 4 – 6 mutant +vehicle, and three mutant +antibody injected mice. *p<0.05, **p<0.01, one-sample t-test and t-test where Adrb2 cKO values are significantly different from both control and cKO +AB values.
-
Figure 4—source data 1
This spreadsheet includes raw data for islet morphology, metabolic analyses, and gene expression after VEGF-A blockade.
- https://doi.org/10.7554/eLife.39689.018
Figure 4—figure supplement 1
VEGFR2 neutralizing antibody treatment does not affect Vegfa levels in Adrb2 cKO mice, but restores Glut2 and NPY expression.
(A) Vegfa transcript levels remain significantly increased in P6 Adrb2 cKO pups injected with VEGFR2 neutralizing antibody. Means ± SEM and expressed as fold change relative to vehicle injected control (Adrb2f/f) values for n = 6 control, 3 Adrb2 cKO per condition; **p<0.01, ***p<0.001, one-way ANOVA with Tukey’s post-test. (B) Islet Glut2 and NPY immunoreactivity in Adrb2 cKO mice injected with VEGFR2 neutralizing antibody are similar to control tissues. Scale bar, 50 µm.
-
Figure 4—figure supplement 1—source data 1
This spreadsheet includes raw data for insulin transcript levels after VEGF-A blockade.
- https://doi.org/10.7554/eLife.39689.017
Figure 5
Adrb2 regulates adult islet function by controlling bi-directional signaling between β-cells and islet vasculature during development.
During islet development, β-cell-Adrb2 receptors suppress VEGF-A expression to limit excessive growth of intra-islet endothelial cells. Endothelial cells, in turn, are critical for precise regulation of insulin gene expression in neighboring β-cells, via producing vascular basement membrane proteins, and likely for transcriptional regulation of key components of insulin exocytosis. Loss of Adrb2 disrupts bi-directional signaling between islet β-cells and endothelial cells during development, resulting in islet hyper-vascularization, aberrant insulin expression, and impaired glucose-stimulated insulin secretion in adult islets.
Videos
Video 1
Glucose- and KCl-induced calcium responses in a control islet.
Representative video (15 frames per second) of a Fluo-4 AM-loaded islet isolated from a female control (Adrb2f/f) mouse. Both high glucose and KCl elicit a robust increase in islet intracellular calcium levels.
Video 2
Diminished calcium responses to high glucose and KCl in an Adrb2 cKO islet.
Representative video (15 frames per second) of a Fluo-4AM loaded islet isolated from a female Adrb2 cKO mouse. Islet calcium levels are not elevated by high glucose or 30 mM KCl in the absence of Adrb2.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M.musculus) | B6.FVB-Tg(Pdx1-cre) 6Tuv/Nci; Pdx1-Cre | NCI Frederick mouse repository | RRID: IMSR_NCIMR:01XL5 | |
| Genetic reagent (M.musculus) | B6.Cg-Tg(Ins1-EGFP) 1Hara/J; MIP-GFP | The Jackson Laboratory | RRID:IMSR_JAX:006864 | |
| Genetic reagent (M. musculus) | Adrb2f/f | Hinoi et al. (2008) | Dr. Gerard Karsenty (Columbia University) | |
| Genetic reagent (M. musculus) | Tg(Pdx1-cre/Esr1*) #Dam/J; Pdx1- cre/Esr1*Dam | The Jackson Laboratory | RRID: IMSR_JAX:024968 | |
| Genetic reagent (M. musculus) | C57BL/6J | The Jackson Laboratory | RRID: IMSR_JAX:000664 | |
| Cell line (M. musculus) | MIN6 | Dr. Jun-ichi Miyazaki (Osaka University) | ||
| Antibody | Guinea Pig anti-insulin | Dako | Cat # A0564; RRID: AB_10013624 | IHC (1:300) |
| Antibody | Mouse anti-glucagon | Abcam | Cat # ab10988; RRID: AB_297642 | IHC (1:500) |
| Antibody | Rat anti-PECAM-1/CD-31 | BD Biosciences | Cat # 550274; RRID: AB_393571 | IHC (1:300) |
| Antibody | Rabbit anti-collagen IV | Abcam | Cat # ab19808; RRID: AB_445160 | IHC (1:500) |
| Antibody | Chicken anti-laminin | LifeSpan Biosciences | Cat # LS-C96142; RRID: AB_2134058 | IHC (1:200) |
| Antibody | Mouse VEGFR2/Kdr/Flk-1 | R and D Systems | Cat # AF644; RRID: AB_355500 | 1 µg injection dose |
| Antibody | Rabbit anti-NPY | BMA Biomedicals | Cat # T-4070; RRID:AB_518504 | IHC (1:1000) |
| Antibody | Rabbit anti-Glut2 | Alpha Diagnostics | Cat # GT21-A; RRID: AB_1616640 | IHC (1:300) |
| Sequence-based reagent | Adra1a TaqMan Probe | ThermoFisher | Assay ID: Mm00442668_m1 | |
| Sequence-based reagent | Adra1b TaqMan Probe | ThermoFisher | Assay ID: Mm00431685_m1 | |
| Sequence-based reagent | Adra1d TaqMan Probe | ThermoFisher | Assay ID: Mm01328600_m1 | |
| Sequence-based reagent | Adra2a TaqMan Probe | ThermoFisher | Assay ID: Mm00845383_s1 | |
| Sequence-based reagent | Adra2b TaqMan Probe | ThermoFisher | Assay ID: Mm00477390_s1 | |
| Sequence-based reagent | Adra2c TaqMan Probe | ThermoFisher | Assay ID: Mm00431686_s1 | |
| Sequence-based reagent | Adrb1 TaqMan Probe | ThermoFisher | Assay ID: Mm00431701_s1 | |
| Sequence-based reagent | Adrb2 TaqMan Probe | ThermoFisher | Assay ID: Mm02524224_s1 | |
| Sequence-based reagent | Adrb3 TaqMan Probe | ThermoFisher | Assay ID: Mm02601819_g1 | |
| Sequence-based reagent | Eukaryotic 18S rRNA Endogenous Control (VIC/MGB probe, primer limited) | ThermoFisher | Cat # 4319413E | |
| Commercial Assay | Ultrasensitive mouse insulin ELISA kit | Crystal Chem | Cat # 90080 | |
| Chemical compound, drug | Fluo-4, AM, cell permeant | ThermoFisher | Cat # F14201 |
Table 1
Primer sets used for qPCR.
https://doi.org/10.7554/eLife.39689.020| Sequence | Source | Identifier |
|---|---|---|
| Ins2-F: 5’-TGTCAAGCAGCACCTTTGTG-3’ | This paper | |
| Ins2-R: 5’-ACATGGGTGTGTAGAAGAAGCC-3’ | This paper | |
| Vegfa-F: 5’-GCACATAGAGAGAATGAGCTTCC-3’ | Ford et al, 2011 | |
| Vegfa-R: 5’-CTCCGCTCTGAACAAGGCT-3’ | Ford et al, 2011 | |
| Aldob-F: 5’- AGAAGGACAGCCAGGGAAAT-3’ | Gu et al. (2010) | |
| Aldob-R: 5’- GTTCAGAGAGGCCATCAAGC-3’ | Gu et al. (2010) | |
| PFKL-F: 5’- GCTGCAATGGAGAGTTGTGA-3’ | Gu et al. (2010) | |
| PFKL-R: 5’- GGATGTTGAAAGGGTCCTCA-3’ | Gu et al. (2010) | |
| LDHA-F: 5’- TGTCTCCAGCAAAGACTACTGT-3’ | Gu et al. (2010) | |
| LDHA-R: 5’- GACTGTACTTGACAATGTTGGGA-3’ | Gu et al. (2010) | |
| TPI-F: 5’- CCAGGAAGTTCTTCGTTGGGG-3’ | Gu et al. (2010) | |
| TPI-R: 5’- CAAAGTCGATGTAAGCGGTGG-3’ | Gu et al. (2010) | |
| PKLR-F: 5’- TCAAGGCAGGGATGAACATTG-3’ | Gu et al. (2010) | |
| PKLR-R: 5’- CACGGGTCTGTAGCTGAGTG-3’ | Gu et al. (2010) | |
| Kcnj11-F: 5’- AGGGCATTATCCCTGAGGAA −3’ | Harvard Primer Bank | PrimerBank ID 6754426a1 |
| Kcnj11-R: 5’- TTGCCTTTCTTGGACACGAAG-3’ | Harvard Primer Bank | PrimerBank ID 6754426a1 |
| Abcc8-F: 5’- TCAACTTGTCTGGTGGTCAGC-3’ | Gu et al. (2010) | |
| Abcc8-R: 5’- GAGCTGAGAAAGGGTCATCCA-3’ | Gu et al. (2010) | |
| Cacna1c-F: 5’-ATGAAAACACGAGGATGTACGTT-3’ | Harvard Primer Bank | PrimerBank ID 6753228a1 |
| Cacna1c-R: 5’-ACTGACGGTAGAGATGGTTGC-3’ | Harvard Primer Bank | PrimerBank ID 6753228a1 |
| Cacna1d-F: 5’- AGAGGACCATGCGAACGAG-3’ | Harvard Primer Bank | PrimerBank ID 20338999a1 |
| Cacna1d-R: 5’- CCTTCACCAGAAATAGGGAGTCT-3’ | Harvard Primer Bank | PrimerBank ID 20338999a1 |
| Snap25-F: 5’- CAACTGGAACGCATTGAGGAA-3’ | Harvard Primer Bank | PrimerBank ID 6755588a1 |
| Snap25-R: 5’- GGCCACTACTCCATCCTGATTAT-3’ | Harvard Primer Bank | PrimerBank ID 6755588a1 |
| Stx1A-F: 5’- AGAGATCCGGGGCTTTATTGA-3’ | Harvard Primer Bank | PrimerBank ID 15011853a1 |
| Stx1A-R: 5’- AATGCTCTTTAGCTTGGAGCG-3’ | Harvard Primer Bank | PrimerBank ID 15011853a1 |
| Pclo-F: 5’-TACTCGGACCCATTTGTGAA-3’ | Gu et al. (2010) | |
| Pclo-R: 5’-TACTGTTTGATTCCACTCGGGATT-3’ | Gu et al. (2010) | |
| Rph3al-F: 5’-GCAGTGGAAATGATCAGTGG-3’ | Gu et al. (2010) | |
| Rph3al-R: 5’-TCAGGCACTGGCTCCTCCTC-3’ | Gu et al. (2010) | |
| Neurod1-F: 5’- ATGACCAAATCATACAGCGAGAG-3’ | Harvard Primer Bank | PrimerBank ID 33563268a1 |
| Neurod1-R: 5’- TCTGCCTCGTGTTCCTCGT-3’ | Harvard Primer Bank | PrimerBank ID 33563268a1 |
| Nkx6.1-F: 5’-CTGCACAGTATGGCCGAGATG-3’ | Harvard Primer Bank | PrimerBank ID 21450629a1 |
| Nkx6.1-R: 5’CCGGGTTATGTGAGCCCAA-3’ | Harvard Primer Bank | PrimerBank ID 21450629a1 |
| Npy-F: 5’-AGAGATCCAGCCCTGAGACA-3’ | Gu et al. (2010) | |
| Npy-R: 5’-GATGAGGGTGGAAACTTGGA-3’ | Gu et al. (2010) | |
| Pdx1-F: 5’-CCCCAGTTTACAAGCTCGCT-3’ | Harvard Primer Bank | PrimerBank ID 22122647a1 |
| Pdx1-R: 5’-CTCGGTTCCATTCGGGAAAGG-3’ | Harvard Primer Bank | PrimerBank ID 22122647a1 |
| Ucn3-F: 5’-AAGCCTCTCCCACAAGTTCTA-3’ | Harvard Primer Bank | PrimerBank ID 21492632a1 |
| Ucn3-R: 5’-GAGGTGCGTTTGGTTGTCATC-3’ | Harvard Primer Bank | PrimerBank ID 21492632a1 |
| Slc2a2-F: 5’-TCAGAAGACAAGATCACCGGA-3’ | Harvard Primer Bank | PrimerBank ID 13654262a1 |
| Slc2a2-R: 5’-GCTGGTGTGACTGTAAGTGGG-3’ | Harvard Primer Bank | PrimerBank ID 1 3654262a1 |
| 18S rRNA-F: 5’-CGCCGCTAGAGGTGAAATTC-3’ | Park et al, 2016 | |
| 18S rRNA-R: 5’-TTGGCAAATGCTTTCGCTC-3’ | Park et al, 2016 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.39689.021
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Adrb2 controls glucose homeostasis by developmental regulation of pancreatic islet vasculature
eLife 7:e39689.
https://doi.org/10.7554/eLife.39689
