Cellular acidosis triggers human MondoA transcriptional activity by driving mitochondrial ATP production
- University of Utah, United States
Figures
Figure 1 with 3 supplements
Acidosis drives MondoA transcriptional activity.
(A) TXNIP mRNA levels in murine embryonic fibroblasts (MEFs) following treatment with HBSS for the indicated times. (B) Glucose uptake was determined by quantifying the rate of 3H-2-deoxyglucose …
Figure 1—figure supplement 1
TXNIP expression correlates with genes that regulate intracellular pH.
(A) Heatmaps showing the expression of TXNIP mRNA compared to MCT4 (breast cancer), MCT1 (lung cancer) and NHE1 (brain cancer). All expression data was collected from TCGA. Spearman and Pearson …
Figure 1—figure supplement 2
Acidosis drives MondoA transcriptional activity.
(A) TXNIP and MondoA protein levels in MEFs treated with HBSS for the indicated times was determined by immunoblotting. (B) TXNIP protein levels of MEFs following 4 hr treatments with DMEM, HBSS and …
Figure 1—figure supplement 3
Acidosis drives MondoA transcriptional activity.
(A) TXNIP and MondoA protein levels were determined from MondoA-knockout MEFs complemented with empty vector, wild-type MondoA or MondoA(I766P) following 4 hr HBSS treatments. (B) Schematic showing …
Figure 2
Acidosis-driven MondoA transcriptional activity depends on electron transport.
(A and B) TXNIP protein levels were determine by immunoblotting following a 4 hr HBSS treatment of MEFs in the presence of the indicated inhibitors. Cont; control, Chlor; Chloroquine (25 μM), Mon; …
Figure 3 with 2 supplements
Acidosis drives the synthesis of mitochondrial ATP.
(A) Intracellular pH of HeLa cells was determined using BCECF-AM staining after a 4 hr treatment with DMEMAcidic. (B) Mitochondrial membrane potential of HeLa cells was determined by JC1 staining …
Figure 3—figure supplement 1
DMEMAcidic does not inhibit mTORC1 activity Immunoblotting was used to measure the levels of the indicated proteins following DMEMAcidic treatment of HeLa cells for the indicated times.
Levels of phosphorylated S6 (p–S6), which is a mTORC1 substrate, reflect mTORC1 activity.
Figure 3—figure supplement 2
Acidosis drives synthesis of mitochondrial ATP.
(A) Confocal images at 60X of Mit-ATEAM expressed in HeLa cells. Shown are the CFP and FRET channels as well as the ratio of FRET to CFP (indicating mtATP). (B) Widefield image at 60X of ATEAM. CFP …
Figure 4
MondoA is activated by G6P produced by hexokinase utilization of mtATP.
(A) Cellular fractionation of BJ-Tert cells indicating mitochondrial localization of HK2, MondoA and Mlx. Succinate dehydrogenase A (SDHA) serves as a control for the mitochondria fraction. (B) …
Figure 5
MondoA senses G6P produced by mitochondrial-bound hexokinase.
(A) TXNIP mRNA levels in BJ-Tert cells expressing mVDAC1-GFP and mVDAC1(E72Q)-GFP and treated for 4 hr with DMEMAcidic. HK2 localization was also analyzed by cellular fractionation and densitometry …
Figure 6
The MondoA-dependent acidosis response.
RNA-sequencing was used to determine differentially regulated genes for HeLa and HeLa:MondoA-knockout cells treated with DMEMAcidic for 4 hr. Differentially regulated genes from duplicate biological …
-
Figure 6—source data 1
Acidosis regulated genes and pathways.
- https://doi.org/10.7554/eLife.40199.013
-
Figure 6—source data 2
Pathways enriched in acidosis treated MondoA knockout HeLa cells.
- https://doi.org/10.7554/eLife.40199.014
Figure 7 with 1 supplement
MondoA preferentially occupies the promoters of TXNIP and ARRDC4.
ChIP sequencing was performed on single biological samples and used to identify MondoA’s genomic binding sites in HeLa cells grown in DMEM or treated with DMEMAcidic for 4 hr. (A) Heatmaps showing ~1…
Figure 7—figure supplement 1
DMEMAcidic increases MondoA genomic occupancy.
We analyzed the occupancy of MondoA at the 50 most highly bound promoters identified in our ChIP-seq experiment. The ratio of binding in DMEMAcidic/DMEM is presented and shows the fold increase in …
Figure 8
MondoA coordinates the transcriptional response to cytoplasmic glucose and mitochondrial ATP.
Schematic depicting how acidosis drives MondoA transcriptional activity through the generation of mitochondrial ATP and utilization by mitochondria-bound hexokinase to produce G6P, which drives …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-HK2 (goat polyclonal) | Santa Cruz | sc6521 | (1:1,000) |
| Antibody | Anti-MLX (rabbit monoclonal (D8G6W) | Cell Signaling | 85570S | (1:1,000) |
| Antibody | Anti-MlxIP (MondoA) (rabbit polyclonal) | Proteintech | 13614–1-AP | (1:2,000) |
| Antibody | Anti-SDHA (2E3GC12FB2AE2) (mouse monoclonal | Abcam | AB147 | (1:15,000) |
| Antibody | Anti-Tubulin (mouse monoclonal) | Molecular Probes | 236–10501 | (1:50,000) |
| Antibody | Anti-TXNIP (rabbit monoclonal) | Abcam | ab188865 | (1:2,000) |
| Antibody | Anti-LaminB1 (rabbit polyclonal) | Abcam | ab16048 | (1:1,000) |
| Antibody | anti-goat IgG-HRP (donkey polyclonal) | Santa Cruz | sc-2056 | (1:2,000) |
| Antibody | Mouse IgG, HRP-linked whole Ab (sheep polyclonal) | GE Life Science | NA-931 | (1:5,000) |
| Antibody | Rabbit IgG, HRP-linked whole Ab (donkey polyclonal) | GE Life Science | NA-934 | (1:15,000) |
| Chemical compound, drug | BCECF-AM | Thermo Fisher | B1170 | |
| Chemical compound, drug | Blotting Grade Blocker Non-fat Dry Milk | Bio-Rad | 1706404XTU | |
| Chemical compound, drug | CCCP | Sigma Aldrich | C2759 | |
| Chemical compound, drug | Chloroquine | Sigma Aldrich | 415480 | |
| Chemical compound, drug | Deoxy-D-Glucose, 2-[1,2-3H(N)] | American Radiolabeled Chemicals, Inc. | 0103–250 | |
| Chemical compound, drug | DMEM | Gibco | 11995–065 | |
| Chemical compound, drug | DMEM Powder without sodium bicarbonate, glucose, L-glutamine, sodium pyruvate and phenol red | Cellgro | 90–113-PB | |
| Chemical compound, drug | DMSO | Fisher | BP231 | |
| Chemical compound, drug | FCCP | Sigma Aldrich | C2920 | |
| Chemical compound, drug | Fetal bovine serum (FBS) | Gibco | 26140–079 | |
| Chemical compound, drug | Glucose | Fisher | D16-1 | |
| Chemical compound, drug | Glutamine | Cellgro | 25–005 Cl | |
| Chemical compound, drug | HBSS | Gibco | 24020–117 | |
| Chemical compound, drug | HEPES | Sigma Aldrich | H3375 | |
| Chemical compound, drug | JC1 | Thermo Fisher | T3168 | |
| Chemical compound, drug | Metformin | Sigma Aldrich | D150959 | |
| Chemical compound, drug | Monensin | Sigma Aldrich | M5273 | |
| Chemical compound, drug | Non-essential amino acids | Gibco | 11140–050 | |
| Chemical compound, drug | Oligomycin A | Sigma Aldrich | 75351 | |
| Chemical compound, drug | Pennicillin/Streptomycin | Gibco | 15140–112 | |
| Chemical compound, drug | Phenol Red | Sigma Aldrich | P-0290 | |
| Chemical compound, drug | Sodium bicarbonate | Fisher | L-23200 | |
| Chemical compound, drug | Sodium pyruvate | Gibco | 11360–070 | |
| Chemical compound, drug | Trypsin-EDTA (0.25%) | Gibco | 25200–056 | |
| Chemical compound, drug | Tween-20 | Fisher | BP-337 | |
| Commercial assay, or kit | Quick RNA miniprep kit | Genesee Scientific | R1055 | |
| Commercial assay, or kit | ATP determination kit | Thermo Fisher | A22066 | |
| Commercial assay, or kit | Mitochondria isolation kit for cultured cells | Thermo Fisher | 89874 | |
| Commercial assay, or kit | Stranded mRNA-Seq kit with mRNA capture beads | Kapa Biosystems | KK8421 | |
| Commercial assay, or kit | Galacto-Light Reaction Buffer Diluent with Galacton-Plus | Thermo Fisher | T1055 | |
| Commercial assay, or kit | Luciferase Assay System | Promega | E4550 | |
| Commercial assay, or kit | ProSignal Pico ECL | Genesee Scientific | 20-300B | |
| Commercial assay, or kit | Reporter 5X Lysis Buffer | Promega | E4030 | |
| Commercial assay, or kit | SuperSignal West Femto | Thermo Fisher | 34094 | |
| Cell line (M. musculus) | MondoA +/+mouse embryonic fibroblasts | Peterson et al. (2010), PMID: 20385767 | ||
| Cell line (M. musculus) | MondoA Δ/Δmouse embryonic fibroblasts | Peterson et al. (2010), PMID: 20385767 | ||
| Cell line (H. sapiens) | 143B | Weinberg et al. 2010, PMID: 20421486 | ||
| Cell line (H. sapiens) | 143Bρ0 | Weinberg et al. 2010, PMID: 20421486 | ||
| Cell line (H. sapiens) | 143Bρ0:Wild type cybrid | Weinberg et al. 2010, PMID: 20421486 | ||
| Cell line (H. sapiens) | 143Bρ0:ΔATP6/ΔATP8 cybrid | Boominathan et al. (2016), PMID: 27596602 | ||
| Cell line (H. sapiens) | 143Bρ0:ΔATP6/ΔATP8 cybrid + ATP6nuc+ATP8nuc | Boominathan et al. (2016), PMID: 27596602 | ||
| Cell line (H. sapiens) | HeLa | ATCC | CCL-2 | |
| Cell line (H. sapiens) | BJ-Tert | ATCC | CRL-4001 | |
| Sequence-based reagent | TXNIP_forward (human): TGACTTTGGCCTACAGTGGG | Peterson et al. (2010), PMID: 20385767 | ||
| Sequence-based reagent | TXNIP_reverse (human): TTGCGCTTCTCCAGATACTGC | Peterson et al. (2010), PMID: 20385767 | ||
| Sequence-based reagent | TXNIP_forward (mouse): CCTGACCTAATGGCACC | Peterson et al. (2010), PMID: 20385767 | ||
| Sequence-based reagent | TXNIP_reverse (mouse): GAGATGTCATCACCTTCAC | Peterson et al. (2010), PMID: 20385767 | ||
| Sequence-based reagent | ATP5I_forward: CAGGTCTCTCCGCTCATCAAG | This paper | ||
| Sequence-based reagent | ATP5I_reverse: GCCCGAGGTTTTAGGTAATTGT | This paper | ||
| Sequence-based reagent | Actin_forward: TCCATCATGAAGTGTGACGT | Peterson et al. (2010), PMID: 20385767 | ||
| Sequence-based reagent | Actin_reverse: TACTCCTGCTTGCTGATCCAC | Peterson et al. (2010), PMID: 20385767 | ||
| Sequence-based reagent | TXNIP_forward ChIP primer: CAGCGATCTCACTGATTG | This paper | ||
| Sequence-based reagent | TXNIP_reverse ChIP primer: AGTTTCAAGCAGGAGGCG | This paper | ||
| Sequence-based reagent | ARRDC4_forward ChIP primer: TGCTTTAGCGAGAACCCAGT | This paper | ||
| Sequence-based reagent | ARRDC4_reverse ChIP primer: TGGACAGACAGTGGGAAACA | This paper | ||
| Sequence-based reagent | TMEM97_forward ChIP primer: CTTACTGCAGAAGGCCCAAG | This paper | ||
| Sequence-based reagent | TMEM97_reverse ChIP primer: TGTAGATTGCGGTTGTGAGC | This paper | ||
| Sequence-based reagent | KLF10_forward ChIP primer: AATCAACGGCAAAGGTGTGT | This paper | ||
| Sequence-based reagent | KLF10_reverse ChIP primer: CACTCAATCAGGTGGCCTCT | This paper | ||
| Sequence-based reagent | siRNA: Dharmacon ON-TARGETplus control siRNA | GE Life Sciences | D00-1810-10-20 | |
| Sequence-based reagent | siRNA: siATP5I SmartPool | GE Life Sciences | M-019688–01 | |
| Sequence-based reagent | siRNA: siSLC25A5 SmartPool (siANT2) | GE Life Sciences | M-007486 | |
| Sequence-based reagent | siRNA: siHK2 SmartPool | GE Life Sciences | L-006735-00-0005 | |
| recombinant DNA reagent | LXSH (plasmid) | Stoltzman et al. (2008), PMID: 18458340 | ||
| Recombinant DNA reagent | LXSH-MondoA (plasmid) | Stoltzman et al. (2008), PMID: 18458340 | ||
| Recombinant DNA reagent | LXSH-MondoA(I766P) (plasmid) | Stoltzman et al. (2008), PMID: 18458340 | ||
| Recombinant DNA reagent | pcDNA3-AT1.03 (ATEAM) (plasmid) | Imamura et al. (2009), PMCID: PMC2735558 | ||
| Recombinant DNA reagent | pcDNA3-mitAT1.03 (Mit-ATEAM) (plasmid) | Imamura et al. (2009), PMID: 19720993 | ||
| Recombinant DNA reagent | pcDNA3-AT1.03 R122K/R126K (plasmid) | Imamura et al. (2009), PMID: 19720993 | ||
| Recombinant DNA reagent | pcDNA3-mitAT1.03 R122K/R126K (plasmid) | Imamura et al. (2009), PMID: 19720993 | ||
| Recombinant DNA reagent | pEGFP-N1-mVDAC1 (plasmid) | Zaid et al. (2005), PMID: 15818409 | ||
| Recombinant DNA reagent | pEGFP-N1-mVDAC1 (E72Q) (plasmid) | Zaid et al. (2005), PMID: 15818409 | ||
| Recombinant DNA reagent | pCDV-SPORT6-HK2 (plasmid) | Stoltzman et al. (2008), PMID: 18458340 | ||
| Recombinant DNA reagent | pCDV-SPORT6-HK2 (D657A) (plasmid) | Stoltzman et al. (2008), PMID: 18458340 | ||
| Recombinant DNA reagent | pcDNA3.1-mVDAC1- GFP(1-10) (plasmid) | This paper | Progenitors: PCR, pcDNAGFP(1-10) | |
| Recombinant DNA reagent | pcDNA3.1-mVDAC1 (E72Q)-GFP(1-10) (plasmid) | This paper | Progenitors: PCR, pcDNAGFP(1-10) | |
| Recombinant DNA reagent | pcDNA3.1-HK2-GFP(11) (plasmid) | This paper | Progenitors: PCR, pcDNAGFP(11) | |
| Recombinant DNA reagent | pGL3Basic-TXNIP_Promoter (plasmid) | Peterson et al. (2010), PMID: 20385767 | ||
| Recombinant DNA reagent | pGL3Basic-TXNIP_Promoter(ChoREmut) (plasmid) | Peterson et al. (2010), PMID: 20385767 | ||
| Recombinant DNA reagent | pcDNAGFP(1-10) | Kamiyama et al. (2016), PMID: 26988139 | ||
| Recombinant DNA reagent | pcDNAGFP(11) | Kamiyama et al. (2016), PMID: 26988139 | ||
| Software, algorithm | Prism | Graphpad Software | ||
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij/ | ||
| Software, algorithm | CFX Manager 3.1 | Bio-Rad | ||
| Software, algorithm | R | https://www.r-project.org | ||
| Software, algorithm | javaGSEA | Broad Institute | ||
| Software, algorithm | Cytoscape 3.6.1 | https://cytoscape.org | ||
| Software, algorithm | NIS Elements | Nikon | ||
| Other | Nunc Lab-Tek II Chambered Coverglass, 8-well | Thermo Fisher | 155409PK | |
| Other | 3.5 mm glass bottom culture dishes | MatTek Corporation | P35G-.15–14 C | |
| Other | Hybond P PVDF Membrane; 0.45 μm | Genesee Scientific | 83–646R | |
| Other | 2 ml PTFE tissue grinder | VWR | 89026–398 | |
| Other | Bioruptor Plus sonication devise | Diagenode | B01020001 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.40199.018
