Strain, strain background (E. coli) | BL21(DE3) bacteria | NEB | C2527H | |
Strain, strain background (E. coli) | NiCo21(DE3) bacteria | NEB | C2529H | |
Strain, strain background (E. coli) | Artic Express (DE3) bacteria | Fisher Scientific | NC9444283 | |
Strain, strain background (S. cerevisiae) | 246.1.1 (MATa ura3 trp1 leu2 his4) | Gift of A. Vershon | | |
Cell line (human) | HEK293T (human embryonic kidney cells) | ATCC | CRL-3216 | |
Recombinant DNA reagent | pIA900 | Gift of I. Artsimovitch | | |
Recombinant DNA reagent | pET NudC-His | (Bird et al., 2016) | | |
Recombinant DNA reagent | pJJ1399 | gift of J. Jaehning | | |
Recombinant DNA reagent | pTrcHisC-Mtf1 | gift of J. Jaehning | | |
Recombinant DNA reagent | pPROEXHTb-POLRMT (43–1230)−6xHis | (Ramachandran et al., 2017) | | |
Recombinant DNA reagent | pPROEXHTb-TFAM (43-245)−6xHis | (Ramachandran et al., 2017) | | |
Recombinant DNA reagent | pT7TEV-HMBP4 | (Yakubovskaya et al., 2014) | | |
Recombinant DNA reagent | pAR1219 | (Jia et al., 1996) | | |
Sequence-based reagent | DK64 | Integrated DNA Technologies (IDT) | tailed template with PEG6 linker | GGCTCGCCTCGGCTCG/iSp18/ CGAGCCGAGGCGAGCGTCACCAA |
Sequence-based reagent | JB459 | IDT | human LSP DNA template + 1 AGU variant nontemplate strand | GTGTTAGTTGGGGGGTGACTGTT AAAAGTGCATACCGCCAAAGTATA AAATTTGTGGGCC |
Sequence-based reagent | JB460 | IDT | human LSP DNA template + 1 AGU variant template strand | GGCCCACAAATTTTATACTTTGGC GGTATGCACTTTTAACAGTCACCC CCCAACTAACAC |
Sequence-based reagent | JB469 | IDT | T7φ2.5–35 n nontemplate strand (−1T) | CAGTAATACGACTCACTATTAGCGAA GCGGGCATGCGGCCAGCCATAGC CGATCA |
Sequence-based reagent | JB470 | IDT | T7φ2.5–35 n template strand (−1A) | TGATCGGCTATGGCTGGCCGCATGCC CGCTTCGCTAATAGTGAGTCGTA TTACTG |
Sequence-based reagent | JB471 | IDT | T7φ2.5–35 n nontemplate strand (−1A) | CAGTAATACGACTCACTATAAGCGAAGC GGGCATGCGGCCAGCCATAG CCGATCA |
Sequence-based reagent | JB472 | IDT | T7φ2.5–35 n template strand (−1T) | TGATCGGCTATGGCTGGCCGCATGCCC GCTTCGCTTATAGTGAGTCGTATTACTG |
Sequence-based reagent | JB473 | IDT | T7φ2.5–35 n nontemplate strand (−1G) | CAGTAATACGACTCACTATGAGCGAAG CGGGCATGCGGCCAGCCATAG CCGATCA |
Sequence based reagent | JB474 | IDT | T7φ2.5 35 n template strand (−1C) | TGATCGGCTATGGCTGGCCGCATGCC CGCTTCGCTCATAGTGAGTCGTATTACTG |
Sequence-based reagent | JB475 | IDT | T7φ2.5–35 n nontemplate strand (−1C) | CAGTAATACGACTCACTATCAGCGAA GCGGGCATGCGGCCAGCCA TAGCCGATCA |
Sequence-based reagent | JB476 | IDT | T7φ2.5–35 n template strand (−1G) | TGATCGGCTATGGCTGGCCGCATGC CCGCTTCGCTGATAGTG AGTCGTATTACTG |
Sequence-based reagent | JB515 | IDT | probe for human LSP-generated RNA (complementary to positions + 2 to+31) | CACCAGCCTAACCAGATTTCAA ATTTTATC |
Sequence-based reagent | JB525 | IDT | probe for S. cerevisiae 21S RNA (complementary to positions + 9 to+42) | CTATATAATAAATATTTCAAATC TATTATTCTAC |
Sequence-based reagent | JB526 | IDT | S. cerevisiae 21S RNA DNAzyme; cleaves transcript at position + 53 | ACTCCATGATTAGGCTAGCTACAA CGACTCTTTAAATCT |
Sequence-based reagent | JB555 | IDT | probe for S. cerevisiae COX2 RNA (complementary to positions + 8 to+46) | ATCTTAACCTTTAGACTCTTTTGTC TATTTATAATATGT |
Sequence-based reagent | JB557 | IDT | S. cerevisiae COX2 DNAzyme; cleaves at position + 57 | TCTTAATAAATCTAAGGCTAGCTACA ACGAATTTTAATAAATCTT |
Sequence-based reagent | JB559 | IDT | human LSP-generated RNA DNAzyme; cleaves at position + 67 | GCACTTAAACAGGCTAGCTACAA CGAATCTCTGCCA |
Sequence-based reagent | JB560 | IDT | S. cerevisiae COX2 −40 to + 125 nontemplate strand oligo (for generation of in vitro transcription template) | TATATAATAATAAATTATAAATAAATTTT AATTAAAAGTAGTATTAACATATTATAAA TAGACAAAAGAGTCTAAAGGTTAAGATT TATTAAAATGTTAGATTTATTAAGATTAC AATTAACAAC |
Sequence-based reagent | JB561 | IDT | S. cerevisiae COX2 −40 to + 3 forward primer (for generation of in vitro transcription template) | TATATAATAATAAATTATAAATAAATTTT AATTAAAAGTAGT |
Sequence-based reagent | JB562 | IDT | S. cerevisiae COX2 + 83 to+125 reverse primer (for generation of in vitro transcription template) | GTTGTTAATTGTAATCTTAATAAATCTAA CATTTTAATAAATC |
Sequence-based reagent | UB1 | IDT | human LSP DNA template (−43 to + 19) nontemplate strand | ATGTGTTAGTTGGGGGGTGACTGTTAA AAGTGCATACCGCCAAAAGATAAAATT TGAAATCTG |
Sequence-based reagent | UB2 | IDT | human LSP DNA template (−43 to + 19) template strand | CAGATTTCAAATTTTATCTTTTGGCGGT ATGCACTTTTAACAGTCACCCCCCAAC TAACACAT |
Sequence-based reagent | UB3 | IDT | human HSP1 DNA template (−43 to + 20) nontemplate strand | ACACACCGCTGCTAACCCCATACCCCGA ACCAACCAAACCCCAAAGACACCCGCC ACAGTTTA |
Sequence-based reagent | UB4 | IDT | human HSP1 DNA template (−43 to + 20) template strand | TAAACTGTGGCGGGTGTCTTTGGGGT TTGGTTGGTTCGGGGTATGGGGTTA GCAGCGGTGTGT |
Sequence-based reagent | UB5 | IDT | S. cerevisiae 15S DNA template (−25 to + 1; C-less cassette) nontemplate strand | ATAATTTATTTATTATTATATAAGTAAT AAATAATTGTTTTATATAATAAGAA TTCTCCTTC |
Sequence-based reagent | UB6 | IDT | S. cerevisiae 15S DNA template (−25 to + 1; C-less cassette) template strand | GAAGGAGAATTCTTATTATATAAAACA ATTATTTATTACTTATATAATAATAA ATAAATTAT |
Sequence-based reagent | UB7 | IDT | S. cerevisiae 21S DNA template (−25 to + 1; C-less cassette) nontemplate strand | TATTATTATTATTATATATATAAGTAG TAAAAAGTAGAATAATAGATTT GAAATACC |
Sequence-based reagent | UB8 | IDT | S. cerevisiae 21S DNA template (−25 to + 1; C-less cassette) template strand | GAAGGAGACCAACCACAAACACACA ACAACCACCAACTACTTATATAATAA TAAATAAATTAT |
Sequence-based reagent | UB9 | IDT | S. cerevisiae 21S DNA template (−25 to + 1; C-less and A-less cassette) nontemplate strand | ATAATTTATTTATTATTATATAAGTAG TTGGTGGTTGTTGTGTGTTTGTG GTTGGTCTCCTTC |
Sequence-based reagent | UB10 | IDT | S. cerevisiae 21S DNA template (−25to + 1; C-less and A-less cassette) template strand | GAAGGAGACCAACCACAAACACAC AACAACCACCAACTACTTATATAA TAATAAATAAATTAT |
Sequence-based reagent | UB11 | IDT | S. cerevisiae 21S nontemplate strand (−1A) | ATAATTTATTTATTATTATATAAGAA GTTGGTGGTTGTTGTGTGTTTGTG GTTGGTCTCCTTC |
Sequence-based reagent | UB12 | IDT | S. cerevisiae 21S template strand (−1T) | GAAGGAGACCAACCACAAACACA CAACAACCACCAACTTCTTATATA ATAATAAATAAATTAT |
Sequence-based reagent | UB13 | IDT | S. cerevisiae 21S nontemplate strand (−1G) | ATAATTTATTTATTATTATATAAGG AGTTGGTGGTTGTTGTGTGTTTG TGGTTGGTCTCCTTC |
Sequence-based reagent | UB14 | IDT | S. cerevisiae 21S template strand (−1C) | GAAGGAGACCAACCACAAACACA CAACAACCACCAACTCCTTATAT AATAATAAATAAATTAT |
Sequence-based reagent | UB15 | IDT | S. cerevisiae 21S nontemplate strand (−1C) | ATAATTTATTTATTATTATATAAG CAGTTGGTGGTTGTTGTGTGT TTGTGGTTGGTCTCCTTC |
Sequence-based reagent | UB16 | IDT | S. cerevisiae 21S template strand (−1G) | GAAGGAGACCAACCACAAACACA CAACAACCACCAACTGCTTATATA ATAATAAATAAATTAT |
Sequence-based reagent | UB17 | IDT | S. cerevisiae 21S nontemplate strand (+1C) | ATAATTTATTTATTATTATATAAGTC GTTGGTGGTTGTTGTGTGTTTGT GGTTGGTCTCCTTC |
Sequence-based reagent | UB18 | IDT | S. cerevisiae 21S template strand (+1G) | GAAGGAGACCAACCACAAACACAC AACAACCACCAACGACTTATATAA TAATAAATAAATTAT |
Sequence-based reagent | JB527 | IDT | S. cerevisiae 21S nontemplate strand (−1 abasic) | ATAATTTATTTATTATTATATAAG/ idSp/AGTTGGTGGTTGTTGTGTGT TTGTGGTTGGTCTCCTTC |
Peptide, recombinant protein (S. cerevisiae) | Rpo41 (mtRNAP) | (Tang et al., 2009) | | |
Peptide, recombinant protein (S. cerevisiae) | Mtf1 | (Paratkar and Patel, 2010) | | |
Peptide, recombinant protein (Human) | POLRMT (mtRNAP) | (Ramachandran et al., 2017) | | |
Peptide, recombinant protein (Human) | TFAM | (Ramachandran et al., 2017) | | |
Peptide, recombinant protein (Human) | TFB2 | (Yakubovskaya et al., 2014) | | |
Peptide, recombinant protein (S. cerevisiae) | RNA polymerase II | Gift of C. Kaplan | | |
Peptide, recombinant protein (E. coli) | RNA polymerase core (β'−6xHis) | (Artsimovitch et al., 2003) | | |
Peptide, recombinant protein | T7 RNA polymerase | (Jia et al., 1996) | | |
Peptide, recombinant protein (E. coli) | NudC | (Cahová et al., 2015) | | |
Peptide, recombinant protein | Phusion Flash HF master mix | ThermoFisher | F-548L | |
Peptide, recombinant protein | T4 Polynucleotide Kinase | NEB | M0201L | |
Peptide, recombinant protein | RNA 5' pyrophosphohydrolase (RppH) | NEB | M0356S | |
Peptide, recombinant protein | FastAP Alkaline Phosphatase | Thermo Fisher | EF0651 | |
Commercial assay or kit | Monarch PCR and DNA clean up kit | NEB | T1030S | |
Chemical compound, drug | Nuclease-free water (not DEPC-treated) | ThermoFisher | AM9932 | |
Chemical compound, drug | Bacto agar | VWR | 90000–760 | |
Chemical compound, drug | Bacto tryptone | VWR | 90000–286 | |
Chemical compound, drug | Bacto yeast extract | VWR | 90000–726 | |
Chemical compound, drug | D-Glucose monhydrate | Amresco | 0643–1 kg | |
Chemical compound, drug | Glycerol | EMD Millipore | 55069521 | |
Chemical compound, drug | DMEM medium | Thermo Fisher | 11965–092 | |
Chemical compound, drug | Fetal Bovine Serum | Atlanta Biological | S11150H | |
Chemical compound, drug | dNTP solution mix, 10 mM of each NTP | NEB | N0447S | |
Chemical compound, drug | NTP set (ultra-pure), 100 mM solutions | GE Healthcare | 27-2025-01 | |
Chemical compound, drug | NAD+ | Roche (Sigma-Aldrich) | 10127965001 | |
Chemical compound, drug | NADH | Roche (Sigma-Aldrich) | 10107735001 | |
Chemical compound, drug | Tris base (Amresco) | VWR | 97061–800 | |
Chemical compound, drug | Boric Acid (ACS grade) | VWR | 97061–980 | |
Chemical compound, drug | EDTA disodium salt dyhydrate | VWR | 97061–018 | |
Chemical compound, drug | 0.5 M EDTA pH 8 | ThermoFisher | AM9260G | |
Chemical compound, drug | Dibasic Sodium phosphate | EMD Millipore | SX0715-1 | |
Chemical compound, drug | Sodium Chloride | EMD Millipore | SX0420-3 | |
Chemical compound, drug | Potassium Chloride | EMD Millipore | 7300–500 GM | |
Chemical compound, drug | Sodium Citrate | EMD Millipore | 7810–1 KG | |
Chemical compound, drug | Sodium Acetate, trihydrate | VWR | MK736406 | |
Chemical compound, drug | Ficoll 400 | VWR | AAB22095-18 | |
Chemical compound, drug | Polyvinylpyrrolidone | EMD Millipore | 7220–1 KG | |
Chemical compound, drug | Diethyl Pyrocarbonate (DEPC) | VWR | AAB22753-14 | |
Chemical compound, drug | Formamide, deionized | VWR | EM-4610 | |
Chemical compound, drug | Sodium dodecylsulfate (SDS) | VWR | 97064–470 | |
Chemical compound, drug | Magnesium chloride hexahydrate | VWR | EM-5980 | |
Chemical compound, drug | Magnesium sulfate heptahydrate | VWR | EM-MX0070-1 | |
Chemical compound, drug | Glycerol (ACS grade) | VWR | EMGX0185-5 | |
Chemical compound, drug | Bovine Serum Albumin (BSA) fraction V | VWR | 101174–932 | |
Chemical compound, drug | Bromophenol Blue | VWR | EM-BX1410-7 | |
Chemical compound, drug | Xylene Cyanol | Sigma-Aldrich | X4126-10G | |
Chemical compound, drug | Amaranth Dye | VWR | 200030–400 | |
Chemical compound, drug | Temed (JT Baker) | VWR | JT4098-1 | |
Chemical compound, drug | Ammonium Persulfate | VWR | 97064–594 | |
Chemical compound, drug | Dithiothreitol (DTT) | Gold Bio | DTT50 | |
Chemical compound, drug | Glycogen from Oyster (type II) | Sigma-Aldrich | G8751 | |
Chemical compound, drug | Hydrochloric Acid (ACS plus) | Fisher Scientific | A144-212 | |
Chemical compound, drug | Ethyl Alcohol | Pharmco-AAPER | 111000200 | |
Chemical compound, drug | GeneMate LE Quick Dissolve agarose | BioExpress | E-3119–500 | |
Chemical compound, drug | SequaGel sequencing system | National Diagnostics | EC833 | |
Chemical compound, drug | Nytran SuPerCharge Nylon Membrane | VWR | 10416296 | |
Chemical compound, drug | SigmaSpin G25 cleanup columns | Sigma-Aldrich | S5059 | |
Chemical compound, drug | 32P NAD+ 250 uCi | Perkin Elmer | BLU023X250UC | |
Chemical compound, drug | γ-32P ATP Easy Tide 1 mCi | Perkin Elmer | BLU502Z001MC | |
Chemical compound, drug | α-32P CTP Easy Tide 250 uCi | Perkin Elmer | BLU508H250UC | |
Chemical compound, drug | α-32P GTP Easy Tide 250 uCi | Perkin Elmer | BLU506H250UC | |
Chemical compound, drug | α-32P UTP Easy Tide 250 uCi | Perkin Elmer | BLU507H250UC | |
Chemical compound, drug | Decade Marker | Thermo Fisher | AM7778 | |
Chemical compound, drug | TRI Reagent | Molecular Research Center | TR118 | |
Chemical compound, drug | Acid phenol:chloroform (CHCl3) pH 4.5 | ThermoFisher | AM9720 | |
Chemical compound, drug | FK866 hydrochloride hyrate | Sigma-Aldrich | F8557 | |
Software, algorithm | Excel | Microsoft | 365 | |
Software, algorithm | ImageQuant | GE Healthcare | TL 5.1, TL v8.2 | |
Software, algorithm | SigmaPlot | Systat Software Inc. | Version 10 | |
Software, algorithm | Pymol | Schrodinger, LLC | http://www.pymol.org | |
Software, algorithm | Illustrator | Adobe | Version CS6 | |
Other | Typhoon RBG Imager | GE Healthcare | | |
Other | NanoDrop 2000C spectrophotometer | Thermo Fisher | | |
Other | UV Crosslinker | Fisher Scientific | FB-UVXL-1000 | |
Other | Hybridization oven 5420 | VWR | 97005–252 | |
Other | Sequi-Gen GT sequencing systems (21 × 50) (38 × 30) | Bio-Rad | 1653871 and 1653873 | |