1. Neuroscience
Download icon

Brain-wide cellular resolution imaging of Cre transgenic zebrafish lines for functional circuit-mapping

  1. Kathryn M Tabor
  2. Gregory D Marquart
  3. Christopher Hurt
  4. Trevor S Smith
  5. Alexandra K Geoca
  6. Ashwin A Bhandiwad
  7. Abhignya Subedi
  8. Jennifer L Sinclair
  9. Hannah M Rose
  10. Nicholas F Polys
  11. Harold A Burgess  Is a corresponding author
  1. Eunice Kennedy Shriver National Institute of Child Health and Human Development, United States
  2. University of Maryland, United States
  3. Virginia Polytechnic Institute and State University, United States
  4. National Institute of General Medical Sciences, United States
Tools and Resources
Cite this article as: eLife 2019;8:e42687 doi: 10.7554/eLife.42687
6 figures, 2 tables, 1 data set and 6 additional files

Figures

Procedure for imaging and co-registering new Cre lines.

Inset schematics: neuronal-restrictive silencing element (NRSE) sites in the enhancer trap construct are targets for the REST protein, which suppresses Cre expression outside the brain.

https://doi.org/10.7554/eLife.42687.002
Cre enhancer trap lines.

Horizontal maximum projection of 52 new Cre enhancer trap lines, with color indicating depth along the dorsal-ventral dimension (huC counter-label, grey).

https://doi.org/10.7554/eLife.42687.003
Gal4 enhancer trap lines.

Horizontal maximum projection of 45 new Gal4 enhancer trap lines (depth coded; huC counter-label, grey).

https://doi.org/10.7554/eLife.42687.004
Spatial coverage of Cre and Gal4 enhancer trap lines.

(A) Horizontal (left), coronal (top right), sagittal (bottom right) sections showing huC:nls-mCar (cell bodies, red) and huC:Gal4,UAS:syp-RFP (neuropil, cyan) from ZBB (huC counter-label, gray), illustrating the separation of cell bodies and neuropil in six dpf brains. (B–C) Horizontal sections (at the levels indicated in A) of heat-maps showing the number of et-Cre (B) and et-Gal4 (C) lines that label each voxel within the cellular area of the brain (scale bar, right). Voxels that lack coverage indicated in green. Coverage for Cre lines is highest in the pallium (Pa). Gal4 lines conspicuously lack coverage in the anterior optic tectum (TeO) and in a medial zone of the medulla oblongata (MO). (D) Histogram of the cellular-region coverage for et-Cre (red) and et-Gal4 (green) lines.

https://doi.org/10.7554/eLife.42687.006
Spatially restricted reporter expression in Gal4/Cre intersectional domains.

Maximum projections for et-Gal4 and et-Cre lines predicted to show co-expression in small domains of neurons, and of the resulting pattern of expression in a triple transgenic et-Gal4, et-Cre, UAS:KillSwitch larva. Scale bar 100 µm. (A) Horizontal (top) and sagittal (bottom) maximum projections for (left to right): y318-Gal4 expression, y481-Cre expression, predicted reporter distribution in cells that co-express y318 and y481, actual RFP expression in an individual y318, y481, UAS:KillSwitch larva. Closed arrowhead indicates the cerebellar eminentia granularis (Eg), which is labeled in both lines and the intersect. Open arrowhead indicates descending fiber tract from Eg neurons. (B) As for (A) with y393-Gal4 and y528-Cre lines. Closed arrowheads indicate the lateral habenula (black) and trigeminal ganglion (grey). Open arrowhead indicates central projections from the trigeminal ganglion.

https://doi.org/10.7554/eLife.42687.007
Web-browser based edition of the Zebrafish Brain Browser with key functions annotated.

Panel size can be adjusted to best fit screen dimensions with the Settings menu.

https://doi.org/10.7554/eLife.42687.008

Tables

Table 1
Summary of transgenic lines in ZBB2.

Total numbers of enhancer trap lines, and transgenic lines (made using promoter fragments from genes, or through BAC recombination), broken down by type: Gal4, Cre or fluorescent protein (FP). Right columns total the number of lines where genomic information driving the expression pattern is available. This information inherently exists for transgenic lines, and was derived through integration site mapping for enhancer trap lines.

https://doi.org/10.7554/eLife.42687.005
All lines (n = 264)Mapped (n = 171)
Gal4CreFPGal4CreFP
Enhancer trap13865596154
Transgenic2003620036
Total15865411161540
Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Genetic reagent
(D. rerio)
y234PMID:23100441ZFIN:ZDB-ALT-121114–10ZFIN symbol:y234Et; Et(SCP1:Gal4ff)y234
Genetic reagent
(D. rerio)
y236PMID:23293587ZFIN:ZDB-ALT-130214–2ZFIN symbol:y236Et; Et(REx2-cfos:kGal4ff)y236
Genetic reagent
(D. rerio)
y237PMID:23293587ZFIN:ZDB-ALT-130214–3ZFIN symbol:y237Et; Et(REx2-cfos:kGal4ff)y237
Genetic reagent
(D. rerio)
y241PMID:24203884ZFIN:ZDB-ALT-131007–1ZFIN symbol:y241Et; Et(REx2-SCP1:kGal4ff)y241
Genetic reagent
(D. rerio)
y242This paperZFIN:ZDB-ALT-130214–5ZFIN symbol:y242Et; Et(REx2-SCP1:Gal4)y242
Genetic reagent
(D. rerio)
y244PMID:23293587ZFIN:ZDB-ALT-130214–7ZFIN symbol:y244Et; Et(REx2-SCP1:kGal4ff)y244
Genetic reagent
(D. rerio)
y252PMID:25224259ZFIN:ZDB-ALT-151117–1ZFIN symbol:y252Et; Et(REx2-SCP1:kGal4ff)y252
Genetic reagent
(D. rerio)
y264PMID:24848468ZFIN:ZDB-ALT-141111–2ZFIN symbol:y264Et; Et(SCP1:Gal4ff)y264
Genetic reagent
(D. rerio)
y265This paperZFIN:ZDB-ALT-180717–10ZFIN symbol:y265Et; Et(SCP1:Gal4ff)y265
Genetic reagent
(D. rerio)
y269PMID:24848468ZFIN:ZDB-ALT-141111–3ZFIN symbol:y269Et; Et(REx2-cfos:kGal4ff)y269
Genetic reagent
(D. rerio)
y270PMID:24848468ZFIN:ZDB-ALT-141111–4ZFIN symbol:y270Et; Et(REx2-cfos:kGal4ff)y270
Genetic reagent
(D. rerio)
y271PMID:25628360ZFIN:ZDB-ALT-150721–4ZFIN symbol:y271Et; Et(SCP1:kGal4ff)y271
Genetic reagent
(D. rerio)
y274This paperZFIN:ZDB-ALT-180717–11ZFIN symbol:y274Et; Et(SCP1:Gal4ff)y274
Genetic reagent
(D. rerio)
y348This paperZFIN:ZDB-ALT-180717–12ZFIN symbol:y348Et; Et(REx2-SCP1:kGal4ff)y348
Genetic reagent
(D. rerio)
y387This paperZFIN:ZDB-ALT-180717–14ZFIN symbol:y387Et; Et(tph2:Gal4ff)y387
Genetic reagent
(D. rerio)
y394This paperZFIN:ZDB-ALT-180717–16ZFIN symbol:y394Et; Et(cfos:Gal4ff)y394
Genetic reagent
(D. rerio)
y396PMID:26635538ZFIN:ZDB-ALT-170320–13ZFIN symbol:y396Et; Et(SCP1:Gal4ff)y396
Genetic reagent
(D. rerio)
y412This paperZFIN:ZDB-ALT-180717–20ZFIN symbol:y412Et; Et(cfos:Gal4ff)y412
Genetic reagent
(D. rerio)
y416This paperZFIN:ZDB-ALT-180717–21ZFIN symbol:y416Et; Et(cfos:Gal4ff)y416
Genetic reagent
(D. rerio)
y420PMID:26635538ZFIN:ZDB-ALT-180717–23ZFIN symbol:y420Et; Et(REx2-cfos:Gal4ff)y420
Genetic reagent
(D. rerio)
y421This paperZFIN:ZDB-ALT-180717–24ZFIN symbol:y421Et; Et(REx2-cfos:Gal4)y421
Genetic reagent
(D. rerio)
y433This paperZFIN:ZDB-ALT-151125–10ZFIN symbol:y433Et; Et(cfos:kGal4ff)y433
Genetic reagent
(D. rerio)
y436This paperZFIN:ZDB-ALT-151125–13ZFIN symbol:y436Et; Et(cfos:Gal4ff)y436
Genetic reagent
(D. rerio)
y441This paperZFIN:ZDB-ALT-180717–27ZFIN symbol:y441Et;
Et(cfos:Gal4ff)y441
Genetic reagent
(D. rerio)
y444This paperZFIN:ZDB-ALT-180717–28ZFIN symbol:y444Et; Et(SCP1:Gal4ff)y444
Genetic reagent
(D. rerio)
y445This paperZFIN:ZDB-ALT-180717–29ZFIN symbol:y445Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y445
Genetic reagent
(D. rerio)
y456This paperZFIN:ZDB-ALT-180717–30ZFIN symbol:y456Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y456
Genetic reagent
(D. rerio)
y457This paperZFIN:ZDB-ALT-180717–31ZFIN symbol:y457Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y457
Genetic reagent
(D. rerio)
y458This paperZFIN:ZDB-ALT-180717–32ZFIN symbol:y458Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y458
Genetic reagent
(D. rerio)
y459This paperZFIN:ZDB-ALT-180717–33ZFIN symbol:y459Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y459
Genetic reagent
(D. rerio)
y465This paperZFIN:ZDB-ALT-180717–34ZFIN symbol:y465Et; Et(REx2-SCP1:BGi-Cre-2a-Cer)y465
Genetic reagent
(D. rerio)
y467This paperZFIN:ZDB-ALT-180717–35ZFIN symbol:y467Et; Et(tph2:Gal4ff)y467
Genetic reagent
(D. rerio)
y468This paperZFIN:ZDB-ALT-180717–36ZFIN symbol:y468Et; Et(cfos:Gal4ff)y468
Genetic reagent
(D. rerio)
y469This paperZFIN:ZDB-ALT-180717–37ZFIN symbol:y469Et; Et(cfos:Gal4ff)y469
Genetic reagent
(D. rerio)
y470This paperZFIN:ZDB-ALT-180717–38ZFIN symbol:y470Et; Et(REx2-SCP1:Gal4ff)y470
Genetic reagent
(D. rerio)
y471This paperZFIN:ZDB-ALT-180717–39ZFIN symbol:y471Et; Et(REx2-SCP1:Gal4ff)y471
Genetic reagent
(D. rerio)
y472This paperZFIN:ZDB-ALT-180717–40ZFIN symbol:y472Et; Et(REx2-SCP1:Gal4ff)y472
Genetic reagent
(D. rerio)
y473This paperZFIN:ZDB-ALT-180717–41ZFIN symbol:y473Et; Et(cfos:Gal4ff)y473
Genetic reagent
(D. rerio)
y477This paperZFIN:ZDB-ALT-180717–43ZFIN symbol:y477Et; Et(cfos:Gal4ff)y477
Genetic reagent
(D. rerio)
y478This paperZFIN:ZDB-ALT-180717–44ZFIN symbol:y478Et; Et(attP-REx2-SCP1:BGi-Cre-2a-Cer-attP)y478
Genetic reagent
(D. rerio)
y479This paperZFIN:ZDB-ALT-180717–45ZFIN symbol:y479Et; Et(attP-REx2-SCP1:BGi-Cre-2a-Cer-attP)y479
Genetic reagent
(D. rerio)
y480This paperZFIN:ZDB-ALT-180717–46ZFIN symbol:y480Et; Et(attP-REx2-SCP1:BGi-Cre-2a-Cer-attP)y480
Genetic reagent
(D. rerio)
y481This paperZFIN:ZDB-ALT-180717–47ZFIN symbol:y481Et; Et(attP-REx2-SCP1:BGi-Cre-2a-Cer-attP)y481
Genetic reagent
(D. rerio)
y483This paperZFIN:ZDB-ALT-180717–48ZFIN symbol:y483Et; Et(attP-REx2-SCP1:BGi-Cre-2a-Cer-attP)y483
Genetic reagent
(D. rerio)
y484This paperZFIN:ZDB-ALT-180717–49ZFIN symbol:y484Et; Et(REx2-SCP1:BGi-Cre-2a-Cer)y484
Genetic reagent
(D. rerio)
y485This paperZFIN:ZDB-ALT-180717–50ZFIN symbol:y485Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y485
Genetic reagent
(D. rerio)
y486This paperZFIN:ZDB-ALT-180717–51ZFIN symbol:y486Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y486
Genetic reagent
(D. rerio)
y487This paperZFIN:ZDB-ALT-180717–52ZFIN symbol:y487Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y487
Genetic reagent
(D. rerio)
y488This paperZFIN:ZDB-ALT-180717–53ZFIN symbol:y488Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y488
Genetic reagent
(D. rerio)
y489This paperZFIN:ZDB-ALT-180717–54ZFIN symbol:y489Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y489
Genetic reagent
(D. rerio)
y490This paperZFIN:ZDB-ALT-180717–55ZFIN symbol:y490Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y490
Genetic reagent
(D. rerio)
y492This paperZFIN:ZDB-
ALT-180717–56
ZFIN symbol:y492Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y492
Genetic reagent
(D. rerio)
y493This paperZFIN:ZDB-ALT-180717–57ZFIN symbol:y493Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y493
Genetic reagent
(D. rerio)
y494This paperZFIN:ZDB-ALT-180717–58ZFIN symbol:y494Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y494
Genetic reagent
(D. rerio)
y495This paperZFIN:ZDB-ALT-180717–59ZFIN symbol:y495Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y495
Genetic reagent
(D. rerio)
y511This paperZFIN:ZDB-ALT-180717–60ZFIN symbol:y511Et; Et(cfos:Gal4ff)y511
Genetic reagent
(D. rerio)
y512This paperZFIN:ZDB-ALT-180717–61ZFIN symbol:y512Et; Et(SCP1:Gal4)y512
Genetic reagent
(D. rerio)
y514This paperZFIN:ZDB-ALT-180717–63ZFIN symbol:y514Et; Et(REx2-cfos:kGal4ff)y514
Genetic reagent
(D. rerio)
y515This paperZFIN:ZDB-ALT-180717–64ZFIN symbol:y515Et; Et(REx2-cfos:kGal4ff)y515
Genetic reagent
(D. rerio)
y519This paperZFIN:ZDB-ALT-180717–65ZFIN symbol:y519Et; Et(REx2-SCP1:BGi-Cre-2a-Cer)y519
Genetic reagent
(D. rerio)
y520This paperZFIN:ZDB-ALT-180717–66ZFIN symbol:y520Et; Et(REx2-SCP1:BGi-Cre-2a-Cer)y520
Genetic reagent
(D. rerio)
y521This paperZFIN:ZDB-ALT-180717–67ZFIN symbol:y521Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y521
Genetic reagent
(D. rerio)
y523This paperZFIN:ZDB-ALT-180717–68ZFIN symbol:y523Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y523
Genetic reagent
(D. rerio)
y524This paperZFIN:ZDB-ALT-180717–69ZFIN symbol:y524Et; Et(REx2-SCP1:BGi-Cre-2a-Cer)y524
Genetic reagent
(D. rerio)
y526This paperZFIN:ZDB-ALT-180717–70ZFIN symbol:y526Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y526
Genetic reagent
(D. rerio)
y528This paperZFIN:ZDB-ALT-180717–71ZFIN symbol:y528Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y528
Genetic reagent
(D. rerio)
y532This paperZFIN:ZDB-ALT-180717–72ZFIN symbol:y532Et; Et(cfos:Gal4ff)y532
Genetic reagent
(D. rerio)
y533This paperZFIN:ZDB-ALT-180717–73ZFIN symbol:y533Et; Et(SCP1:Gal4ff)y533
Genetic reagent
(D. rerio)
y541This paperZFIN:ZDB-ALT-180717–74ZFIN symbol:y541Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y541
Genetic reagent
(D. rerio)
y542This paperZFIN:ZDB-ALT-180717–75ZFIN symbol:y542Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y542
Genetic reagent
(D. rerio)
y543This paperZFIN:ZDB-ALT-180717–76ZFIN symbol:y543Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y543
Genetic reagent
(D. rerio)
y544This paperZFIN:ZDB-ALT-180717–77ZFIN symbol:y544Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y544
Genetic reagent
(D. rerio)
y545This paperZFIN:ZDB-ALT-180717–78ZFIN symbol:y545Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y545
Genetic reagent
(D. rerio)
y546This paperZFIN:ZDB-ALT-180717–79ZFIN symbol:y546Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y546
Genetic reagent
(D. rerio)
y547This paperZFIN:ZDB-ALT-180717–80ZFIN symbol:y547Et; Et(REx2-SCP1:BGi-Cre)y547
Genetic reagent
(D. rerio)
y548This paperZFIN:ZDB-ALT-180717–81ZFIN symbol:y548Et; Et(REx2-SCP1:BGi-Cre)y548
Genetic reagent
(D. rerio)
y549This paperZFIN:ZDB-ALT-180717–82ZFIN symbol:y549Et; Et(REx2-SCP1:BGi-Cre)y549
Genetic reagent
(D. rerio)
y550This paperZFIN:ZDB-ALT-180717–83ZFIN symbol:y550Et; Et(REx2-SCP1:BGi-Cre)y550
Genetic reagent
(D. rerio)
y551This paperZFIN:ZDB-ALT-180717–84ZFIN symbol:y551Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y551
Genetic reagent
(D. rerio)
y552This paperZFIN:ZDB-ALT-180717–85ZFIN symbol:y552Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y552
Genetic reagent
(D. rerio)
y554This paperZFIN:ZDB-ALT-180717–87ZFIN symbol:y554Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y554
Genetic reagent
(D. rerio)
y555This paperZFIN:ZDB-ALT-180717–88ZFIN symbol:y555Et; Et(REx2-SCP1:BGi-Cre)y555
Genetic reagent
(D. rerio)
y556This paperZFIN:ZDB-ALT-180717–89ZFIN symbol:y556Et; Et(REx2-SCP1:BGi-Cre)y556
Genetic reagent
(D. rerio)
y557This paperZFIN:ZDB-ALT-180717–90ZFIN symbol:y557Et; Et(REx2-SCP1:BGi-Cre)y557
Genetic reagent
(D. rerio)
y558This paperZFIN:ZDB-ALT-180717–91ZFIN symbol:y558Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y558
Genetic reagent
(D. rerio)
y559This paperZFIN:ZDB-ALT-180717–92ZFIN symbol:y559Et; Et(REx2-SCP1:BGi-Cre)y559
Genetic reagent
(D. rerio)
y564This paperZFIN:ZDB-ALT-180717–93ZFIN symbol:y564Et; Et(SCP1:Gal4ff)y564
Genetic reagent
(D. rerio)
y565This paperZFIN:ZDB-ALT-180717–94ZFIN symbol:y565Et; Et(REx2-SCP1:Gal4ff)y565
Genetic reagent
(D. rerio)
y566This paperZFIN:ZDB-ALT-180717–95ZFIN symbol:y566Et; Et(REx2-cfos:Gal4ff)y566
Genetic reagent
(D. rerio)
y567This paperZFIN:ZDB-ALT-180717–96ZFIN symbol:y567Et; Et(REx2-cfos:Gal4ff)y567
Genetic reagent
(D. rerio)
y568This paperZFIN:ZDB-ALT-180717–97ZFIN symbol:y568Et; Et(REx2-SCP1:BGi-Cre-2a-Cer.zf3)y568
Genetic reagent
(D. rerio)
y569This paperZFIN:ZDB-ALT-180717–98ZFIN symbol:y569Et; Et(REx2-SCP1:BGi-Cre)y569
Genetic reagent
(D. rerio)
y570This paperZFIN:ZDB-ALT-180717–99ZFIN symbol:y570Et; Et(REx2-SCP1:BGi-Cre)y570
Genetic reagent
(D. rerio)
y571This paperZFIN:ZDB-ALT-180717–100ZFIN symbol:y571Et; Et(R2R6-hoxa2-CNE-SCP1:BGi-Cre-2a-Cer)y571
Genetic reagent
(D. rerio)
y574This paperZFIN:ZDB-ALT-180717–101ZFIN symbol:y574Et; Et(REx2-SCP1:BGi-Cre)y574
Genetic reagent
(D. rerio)
y575This paperZFIN:ZDB-ALT-180717–102ZFIN symbol:y575Et; Et(cfos:Gal4)y575
Genetic reagent
(D. rerio)
y576This paperZFIN:ZDB-ALT-180717–103ZFIN symbol:y576Et; Et(cfos:Gal4)y576
Genetic reagent
(D. rerio)
βactin:Switch; y272PMID:25628360ZFIN:ZDB-ALT-150721–8
Genetic reagent
(D. rerio)
vglut2a:DsRed; nns14PMID:22302816ZFIN:ZDB-ALT-110413–5
Genetic reagent
(D. rerio)
UAS:KillSwitch; y518PMID:30078569ZFIN:ZDB-ALT-181218–5
Genetic reagent
(D. rerio)
UAS:Kaede; s1999tPMID:17335798ZFIN:ZDB-ALT-070314–1
Genetic reagent
(D. rerio)
elavl3:h2b-GCaMP6; jf5PMID:25068735ZFIN:ZDB-ALT-141023–2
Recombinant
DNA reagent
REx2-SCP1:BGi-Cre-2a-Cer (plasmid)PMID:26635538ZFIN:ZDB-ETCONSTRCT-151102–1
Recombinant
DNA reagent
REx2-SCP1:BGi-CreThis paperZFIN:ZDB-ETCONSTRCT-180514–2Progenitors:REx2-SCP1:BGi-Cre-2a-Cer (plasmid)
Recombinant
DNA reagent
REx2-SCP1:BGi-Cre-2a-Cer.zf3 (plasmid)This paperZFIN:ZDB-ETCONSTRCT-180518–1Progenitors:REx2-SCP1:BGi-Cre-2a-Cer (plasmid)
Recombinant
DNA reagent
attP-REx2-SCP1:BGi-Cre-2a-Cer-attPThis paperZFIN:ZDB-ETCONSTRCT-151102–2Progenitors:REx2-SCP1:BGi-Cre-2a-Cer (plasmid)
Recombinant
DNA reagent
R2R6-hoxa2-CNE-SCP1:BGi-Cre-2a-CerThis paperZFIN:ZDB-ETCONSTRCT-180514–1Progenitors:REx2-SCP1:BGi-Cre-2a-Cer (plasmid)
Sequence-based
reagent
tol2-arrm pulldown oligonucleotideThis paper5-CTCAAGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGTAAAAGTATCTGGCTAGAATCTTACTTGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTTGAGTATT
Sequence-based
reagent
tol2-arrm pulldown oligonucleotideThis paper5-TGTAATTAAGTAAAAGTAAAAGTATTGATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACAGTAATCAAGTAAAATTACTCAAGTACTTTACACCTCTG
SoftwareAdvanced Normalization ToolsPMID:17659998
SoftwareZebrafish Brain Browser (desktop)PMID:26635538Download at https://science.nichd.nih.gov/confluence/display/burgess/Brain+Browser
SoftwareZebrafish Brain Browser (online)This paperGitHub:BurgessLab/ZebrafishBrainBrowserzbbrowser.com; Githhub hosts javascript code using X3DOM to render image files
SoftwareImageJPMID:22930834
OtherConfocal images for ZBB2 linesThis paperDryad:doi:10.5061/dryad.tk467n8Compressed archives containing 16-bit NIFTI format scans of individual larvae

Data availability

Registered individual confocal brain scans have been deposited in Dryad https://doi.org/10.5061/dryad.tk467n8. Brain browser javascript code can be downloaded from https://github.com/BurgessLab/ZebrafishBrainBrowser; copy archived at https://github.com/elifesciences-publications/ZebrafishBrainBrowser.

The following data sets were generated
  1. 1
    Dryad Digital Repository
    1. KM Tabor
    2. GD Marquart
    3. TS Smith
    4. A Geoca
    5. A Bhandiwad
    6. M Rose Hannah
    7. L Sinclair Jennifer
    (2018)
    Brain-wide cellular resolution imaging of Cre transgenic zebrafish lines for functional circuit-mapping.
    https://doi.org/10.5061/dryad.tk467n8

Additional files

Supplementary file 1

Summary of Cre lines generated by our lab, available in ZBB2.

Integration site given in zv10 coordinates, transgene orientation indicated in brackets.

Integration sites inside genes are annotated, or nearest Refseq gene within ~50 kb indicated.

https://doi.org/10.7554/eLife.42687.009
Supplementary file 2

Summary of all Gal4 lines generated by our lab, available in ZBB2.

Coordinate system for mapped lines is either zv9 or zv10 as indicated.

https://doi.org/10.7554/eLife.42687.010
Supplementary file 3

Transgene expression intensity in small volumes within the brain.

First three columns provide central coordinates of 20 × 20 × 20 µm volumes in the ZBB reference volume (Horizontal plane: distance in microns from the dorsal surface of the volume; Transverse plane: distance from the anterior edge of the volume; Sagittal plane: distance from the left side of the volume). Additional columns indicate the mean expression per bin of each transgene after scaling voxels from 0 to 1.0.

https://doi.org/10.7554/eLife.42687.011
Supplementary file 4

Cell-type expression levels in neuroanatomical regions.

Mean expression levels of transgenic markers in neuroanatomical regions defined by Z-Brain. Cell type markers: Glutamatergic (vglut2a:DsRed), GABAergic (gad1b:GFP), Glycinergic (glyt2:GFP), Catecholaminergic (vmat2:GFP), Serotonergic, (pet1:GFP), Cholinergic (chata:Gal4), Dopaminergic (th:Gal4), Hypocretin (hcrt:RFP), and glia (gfap:GFP).

https://doi.org/10.7554/eLife.42687.012
Supplementary file 5

Cell-type expression levels in neuroanatomical regions.

Mean expression levels of transgenic markers in computationally defined neuroanatomical regions.

https://doi.org/10.7554/eLife.42687.013
Transparent reporting form
https://doi.org/10.7554/eLife.42687.014

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)