1. Cell Biology
Download icon

Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility

  1. Wondwossen M Yeshaw
  2. Marianne van der Zwaag
  3. Francesco Pinto
  4. Liza L Lahaye
  5. Anita IE Faber
  6. Rubén Gómez-Sánchez
  7. Amalia M Dolga
  8. Conor Poland
  9. Anthony P Monaco
  10. Sven CD van IJzendoorn
  11. Nicola A Grzeschik
  12. Antonio Velayos-Baeza
  13. Ody CM Sibon  Is a corresponding author
  1. University of Groningen, University Medical Center Groningen, The Netherlands
  2. Groningen Research Institute of Pharmacy (GRIP), Faculty of Science and Engineering, University of Groningen, The Netherlands
  3. Wellcome Trust Centre for Human Genetics, United Kingdom
  4. Tufts University, United States
Research Article
  • Cited 6
  • Views 2,624
  • Annotations
Cite this article as: eLife 2019;8:e43561 doi: 10.7554/eLife.43561

Abstract

The VPS13A gene is associated with the neurodegenerative disorder Chorea Acanthocytosis. It is unknown what the consequences are of impaired function of VPS13A at the subcellular level. We demonstrate that VPS13A is a peripheral membrane protein, associated with mitochondria, the endoplasmic reticulum and lipid droplets. VPS13A is localized at sites where the endoplasmic reticulum and mitochondria are in close contact. VPS13A interacts with the ER residing protein VAP-A via its FFAT domain. Interaction with mitochondria is mediated via its C-terminal domain. In VPS13A-depleted cells, ER-mitochondria contact sites are decreased, mitochondria are fragmented and mitophagy is decreased. VPS13A also localizes to lipid droplets and affects lipid droplet motility. In VPS13A-depleted mammalian cells lipid droplet numbers are increased. Our data, together with recently published data from others, indicate that VPS13A is required for establishing membrane contact sites between various organelles to enable lipid transfer required for mitochondria and lipid droplet related processes.

https://doi.org/10.7554/eLife.43561.001

Introduction

The vertebrate VPS13 protein family consists of four closely related proteins, VPS13A, VPS13B, VPS13C and VPS13D (Velayos-Baeza et al., 2004). Mutations in VPS13B, VPS13C and VPS13D are associated with the onset of neurological and developmental disorders (Kolehmainen et al., 2003; Seifert et al., 2009; Lesage et al., 2016; Gauthier et al., 2018; Seong et al., 2018). Mutations in the VPS13A gene are causative for a specific autosomal recessive neurological disorder, Chorea Acanthocytosis (ChAc) (Rampoldi et al., 2001; Ueno et al., 2001). Most reported VPS13A mutations in ChAc patients result in low levels or absence of the protein (Dobson-Stone et al., 2004). ChAc patients display gradual onset of hyperkinetic movements and cognitive abnormalities (Hermann and Walker, 2015). The function of VPS13A may not be restricted to the brain but also to other tissues since VPS13A is ubiquitously expressed in human tissues (Velayos-Baeza et al., 2004; Rampoldi et al., 2001).

The molecular and cellular function of VPS13 proteins only recently start to emerge. The current knowledge is largely derived from studies about the only Vps13 gene in Saccharomyces cerevisiae. In yeast, Vps13 is a peripheral membrane protein localized at membrane contact sites including nucleus-vacuole, endoplasmic reticulum (ER)-vacuole and endosome-mitochondria contact sites (Park et al., 2016; Lang et al., 2015; John Peter et al., 2017). Vps13 mutants are synthetically lethal with mutations in genes required to form the ER-mitochondria encounter structure (ERMES) complex (Park et al., 2016; Lang et al., 2015), suggesting a redundant role of Vps13 at membrane contact sites. In addition, Vps13 is involved in the transport of membrane bound proteins between the trans-Golgi network and prevacuolar compartment (PVC) (Redding et al., 1996; Brickner and Fuller, 1997) and from endosome to vacuole (Luo and Chang, 1997). Vps13 is also required for prospore expansion, cytokinesis, mitochondria integrity, membrane contacts and homotypic fusion and the influential role of Vps13 in these processes is postulated to be dependent on the availability of phosphatidylinositides (Park et al., 2016; Lang et al., 2015; John Peter et al., 2017; Park and Neiman, 2012; Nakanishi et al., 2007; De et al., 2017; Rzepnikowska et al., 2017).

The VPS13A gene is located at chromosome 9q21 and encodes a high molecular weight protein of 3174 amino acids (Velayos-Baeza et al., 2004; Rampoldi et al., 2001; Ueno et al., 2001). In various model systems, loss of VPS13A is associated with diverse phenotypes, such as impaired autophagic degradation, defective protein homeostasis (Muñoz-Braceras et al., 2015; Lupo et al., 2016; Vonk et al., 2017), delayed endocytic and phagocytic processing (Korolchuk et al., 2007; Samaranayake et al., 2011), actin polymerization defects (Föller et al., 2012; Alesutan et al., 2013; Schmidt et al., 2013; Honisch et al., 2015) and abnormal calcium homeostasis (Yu et al., 2016; Pelzl et al., 2017). Proteomic studies revealed that VPS13A is associated with multiple cellular organelles (Huttlin et al., 2015; Zhang et al., 2011; Hung et al., 2017) suggesting that VPS13A probably plays a role in a multitude of cellular functions and its loss of function could be associated with a wide range of cellular defects in eukaryotes. Here, to understand the versatile role of VPS13A at the molecular level, the subcellular localization, binding partners and the role of the domains of VPS13A were studied in mammalian cells. We used biochemical and sub-cellular localization studies and demonstrated that VPS13A is associated to multiple cellular organelles including at areas where mitochondria and ER are in close proximity and at lipid droplets. By using CRISPR/Cas9 a VPS13A knock-out cell-line was generated to investigate these organelles under VPS13A-depleted conditions. Part of the observed phenotype is also present in a Drosophila melanogaster Vps13 mutant, a phenotype rescued by overexpression of human VPS13A in the mutant background, indicating a conserved function of this protein. We discuss how our findings, in combination with other recently published VPS13A-related manuscripts, are consistent with an ERMES-like role for VPS13A at membrane contact sites in mammalian cells.

Results

Human VPS13A is a peripheral membrane protein

To determine the subcellular localization of endogenous human VPS13A, we first used a biochemical approach and the membrane and cytosolic fractions of HeLa cells were separated by high-speed centrifugation. VPS13A was enriched in the pellet, which contained the transmembrane epidermal growth factor receptor (EGFR) and relatively little of α-tubulin, a cytosolic marker protein (Figure 1A, Figure 1—figure supplement 1). To further investigate the membrane association of VPS13A, a detergent based subcellular fractionation was performed in HEK293T cells (Holden and Horton, 2009). Following digitonin treatment and centrifugation, more than 80% of VPS13A, remained in the fraction containing membrane associated proteins such as EGFR and the ER integral protein- VAMP-associated protein A (VAP-A), and little VPS13A was detected in the cytosolic non-membrane bound and GAPDH containing fraction (Figure 1B and B’). The type of membrane association of VPS13A was further investigated by assessing its dissociation from lipid bilayers after treatment with different chemical agents. Similarly to ATP5A, a peripheral membrane associated protein of mitochondria, part of VPS13A was solubilized by alkaline and urea-containing solutions. In contrast, the integral membrane protein EGFR was not solubilized by alkaline containing solutions and was, as expected, only partly removed by urea containing solutions (Figure 1C,C’). Altogether, these analyses suggest that VPS13A is a peripheral membrane-associated protein.

Figure 1 with 1 supplement see all
VPS13A is enriched in membrane fractions and is peripherally associated to membranes.

(A) Light membrane fractions from HeLa cell homogenates were separated by centrifugation in a cytosolic and a membrane fraction. Equal amounts of proteins were processed for immunoblot analysis of VPS13A, EGFR and α-tubulin. (B) Digitonin extraction of cytosolic proteins in HEK293T cells were immunoblotted for the indicated proteins. The amount of protein was quantified using ImageJ and presented as a percentage of the total (B’). (C) Membrane fractions of HeLa cells were prepared as in A and subjected to different chemical agents to extract proteins from membranes. Equal amount of proteins were processed for immunoblotting using antibodies against VPS13A, EGFR and ATP5A. The amount of protein was quantified using ImageJ and presented as a percentage of the total (C’) (D) Sucrose gradient fractionation from HeLa cells. HeLa cells were lysed in detergent free buffer and separated in 5–55% sucrose gradients by high speed centrifugation. After TCA precipitation, fractions were processed for immunoblotting using antibodies against VPS13A, VAP-A, RAB7 and ATP5A. Quantification of protein band intensities in D was performed using ImageJ and plotted as percentage of the total (D’). In B’, C’, D’, error bars, mean ±s.e.m (n = 3).

https://doi.org/10.7554/eLife.43561.002

To determine to which intracellular membranes endogenous VPS13A is associated, we performed subcellular fractionation experiments on a sucrose gradient. These experiments showed that VPS13A was predominantly detected in fractions containing VAP-A, Rab7 and ATP5A, which are marker proteins of the ER, endosomes and mitochondria respectively (Figure 1D,D’).

VPS13A localization to mitochondria is mediated via the C-terminal end

To characterize the subcellular localization of VPS13A in more detail, GFP- and Myc-tagged VPS13A were expressed in HEK293T cells. This yielded a high molecular weight band, corresponding to full-length tagged VPS13A (Figure 2—figure supplement 1). Under normal growth conditions, VPS13A-GFP showed two main subcellular distribution patterns. In most cells, VPS13A-positive filamentous structures (Figure 2A,A’) and/or punctated or vesicular-like structures (Figure 2B’, B’) were observed. To identify these compartments, we co-localized VPS13A with a variety of organelle marker proteins. Although not co-localizing with the endosomal/lysosomal marker proteins Rab5, Rab7, LAMP1 and FYCO1 (Figure 2—figure supplements 12), VPS13A-GFP strongly decorated the periphery of nearly all mitochondria stained with Mitotracker (Figure 2C,C’, C” and Video 1).

Figure 2 with 2 supplements see all
VPS13A is localized at mitochondria via its C-terminal domain.

(A,B) HEK293T cells were transfected with VPS13A-GFP and the GFP signal was visualized using confocal microscopy. White arrowheads show reticular structures (A, A’) and magenta arrowheads show vesicular structures (B, B’). Cell borders are marked by white dashed lines and the nucleus is marked by magenta dashed lines. (C) Single stack image from a time-lapse recording of HEK293T cells expressing VPS13A-GFP for 48 hr (Video 1). Mitochondria were labeled using Mitotracker orange. C’, C’ Line scan analysis of VPS13A-GFP and Mitotracker orange indicates the peri-mitochondrial localization of VPS13A. (D) Schematic representations of full length VPS13A and N-terminally GFP tagged VPS13A fragments. Numbers denote the first and last amino acid positions. (E) GFP-VPS13A (green) constructs represented in D were overexpressed in U2OS cells for 24 hr. Cells were stained for TOMM20 (red) and DAPI (blue). Line scan co-localization analysis was done for all channels. Scale bars = 10 µm (A–C) and 25 µm (E).

https://doi.org/10.7554/eLife.43561.004
Video 1
HEK 293 T cells overexpressing VPS13-GFP were incubated with mitotracker orange for 20 min.

Time lapse images were taken every 500 milliseconds and the video is played at 10 frames per second.

https://doi.org/10.7554/eLife.43561.007

To determine whether endogenous VPS13A is a mitochondrial membrane protein, crude mitochondria fractions isolated by centrifugation were analyzed by immunoblotting. VPS13A was highly enriched in the mitochondria fraction and slightly in the microsomal (pellet) fraction (Figure 3—figure supplements 12). For the alkaline treatment, crude mitochondria fractions were incubated with 0.1 M Na2CO3 (pH = 11.5). In this experiment, TOMM20 and ATP5A, which are integral and peripheral mitochondria membrane proteins respectively, served as markers. While TOMM20 was mostly retained in the insoluble membrane fraction following Na2CO3 treatment, VPS13A was now also found in the soluble supernatant in a similar way as ATP5A (Figure 3—figure supplements 12). Moreover, when crude mitochondria fractions were treated with proteinase K (PK), both TOMM20 and VPS13A were stripped off, suggesting that VPS13A is exposed to the cytosol (Figure 3—figure supplements 12).

This interesting VPS13A localization to the mitochondria surface prompted us to determine the VPS13A domain that mediates this localization. To do so, GFP-tagged truncated forms of VPS13A (Figure 2D and Figure 3—figure supplements 34) were expressed in U2OS cells, which are more stretched out and possess less rounded and more elongated mitochondria, as compared to HEK293T, and would therefore be better suitable for these imaging studies. Most of these constructs showed an apparently cytosolic distribution pattern except, the C-terminal region of VPS13A (aa 2615–3174) which showed a localization pattern similar to that of the mitochondrial outer membrane marker TOMM20 (Figure 2E). Note that, although mitochondria of U2OS possess a different shape, compared to HEK293T cells, VPS13A (aa 2615–3174) localizes in both cell lines in close vicinity to mitochondria (Figure 3—figure supplement 3) Analysis of co-localization studies using Mitotracker and VPS13A (aa 2615–3174) showed that the VPS13A signal is localized at the periphery rather than within mitochondria (Figure 3—figure supplement 3). This strongly suggests that the C-terminal region of VPS13A is involved in targeting the protein to close vicinity of the outer mitochondrial membrane.

VPS13A localizes to the ER-mitochondria interface

Furthermore, the VPS13A localization pattern partly overlapped with the ER markers VAP-A and BFP-Sec61B (yellow signal in Figure 3A, white arrowheads in Figure 3B,C). Note that in areas where VPS13A and Sec61B or VAP-A are in close contact, a Mitotracker or TOMM20-positive signal is present as well (white arrowheads in Figure 3B,C), in contrast to locations positive for an ER marker and negative for VPS13A (magenta arrows in Figure 3B). To further investigate the localization pattern of VPS13A in relation to the ER, we conducted time-lapse imaging of live cells expressing VPS13A-GFP and mCherry-VAP-A. This analysis showed that VPS13A-GFP was closely associated to VAP-A positive regions of the ER, the signals partially overlapped, and the dynamics of the VPS13A positive regions are similar to the ER dynamics (Figure 3D and Video 2). Given the peripheral-membrane protein characteristics of VPS13A, the decoration of mitochondria with VPS13A-GFP, its enrichment in the outer mitochondria membrane and its close association with VAP-A positive ER regions, these results suggest that VPS13A was enriched at the interface between these two organelles, rather than being localized in the interior of both mitochondria and ER.

Figure 3 with 4 supplements see all
VPS13A is localized at the ER-mitochondria interface.

(A) HEK293T cells were co-transfected with VPS13A-Myc and the ER marker GFP-VAP-A. Cells were stained with anti-Myc (red) and DAPI (blue). A’ shows higher magnification of the inserts in A. (B) Representative single stack image of HEK293T cells expressing the ER marker BFP-Sec61B and VPS13A-GFP. Mitochondria were labeled using Mitotracker red. White arrowheads indicate the enrichment of VPS13A at the ER-mitochondria interface. Magenta arrows indicate BFP-Sec61B positive ER tubules, negative for VPS13A-GFP and not in close association with mitochondria. (C) Representative single stack image of HEK293T cells expressing mCherry-VAP-A (ER marker) and VPS13A-GFP. Mitochondria were labeled using TOMM20 antibody. White arrowheads indicate the enrichment of VPS13A at areas positive for ER and mitochondria markers. C’ shows higher magnification of the insert in C. (D) Representative time-lapse images of HEK293T cells expressing VPS13A-GFP and mCherry-VAP-A for 48 hr (Video 2). White arrowheads points to continuous dynamic associations of VPS13A-GFP and mCherry VAP-A. Scale bars = 10 μm (A, C, D), and 2 μm (B).

https://doi.org/10.7554/eLife.43561.008
Video 2
HEK 293 T cells overexpressing VPS13-GFP and mCherry-VAP-A were imaged lapse images were taken every 5 s.

The video is played at five frames per second.

https://doi.org/10.7554/eLife.43561.013

VPS13A directly binds VAP-A through its FFAT motif

We then asked what mediated the VPS13A association to the ER. Several membrane-associated proteins bind to the ER resident protein VAP-A through a seven amino acids FFAT motif (Loewen et al., 2003; Loewen and Levine, 2005; Murphy and Levine, 2016). Interestingly, VPS13A also contains a putative FFAT motif (Murphy and Levine, 2016), which is located between amino acids 842–848 (Figure 4A). To test whether VPS13A indeed interacts with VAP-A, we performed co-immunoprecipitation experiments with endogenous proteins. In line with this hypothesis, VAP-A was enriched in immunoprecipitates of endogenous VPS13A (Figure 4B, Figure 4—figure supplements 12). Conversely, VPS13A was present in the VAP-A immunoprecipitates (Figure 4B’).

Figure 4 with 4 supplements see all
Direct interaction of VPS13A and VAP-A.

(A) Amino acid sequence alignment of VPS13A-FFAT and four other FFAT containing proteins. The FFAT containing region (gray box) of each protein was selected and aligned using ClustalW multiple alignment tool. (B) Endogenous VPS13A was immunoprecipitated from HeLa cells using an anti-VPS13A antibody. Rabbit IgG was used as a control. (B’) Endogenous VAP-A was immunoprecipitated from HeLa cells using an anti-VAP-A antibody. Goat IgG was used as a control. Indicated proteins were detected by immunoblotting. (C) Schematic representations of bacterially expressed GST tagged VPS13A fragments used for the in vitro binding assays in D. (D) In vitro binding assay using 6xHis-VAP-A and GST-fusions of VPS13A fragments (depicted in C) expressed in E.Coli. GST-fusion proteins were enriched on Sepharose beads and incubated with equal amounts of bacterial lysate containing 6xHis-VAP-A. GST alone used as a control. Samples were immunoblotted against VAP-A, GST and N-terminal VPS13A (H-102). (E) Representative single stack image of HEK293T cells expressing mCherry-VAP-A (red) and VPS13A-GFP (E) or VPS13A-GFP ΔFFAT (E’). A yellow signal in the overlay indicates a close association between VPS13A-GFP and VAP-A (E) and the absence of a yellow signal indicates the absence of a close association between VPS13A-GFP ΔFFAT and VAP-A (E’). (F) GFP tagged full length VPS13A and VPS13A ΔFFAT were transiently expressed in HEK293T cells. Cell lysates were immunoprecipitated using a GFP-trap assay. GFP alone was used as a control. Indicated proteins were detected by immunoblotting. Arrowhead indicates the VPS13A-GFP band and arrow indicates free GFP band. (G) GFP-VAP-A was immunoprecipitated from HeLa cells treated with different concentrations of Thapsigargin (TG) for 6 hr. DMSO was used as control. Indicated proteins were detected by immunoblotting. (H) Densitometric quantification of protein bands in G. The ratio of immunoprecipitated VPS13A was normalized to the respective amount of GFP-VAP-A. Cells treated with DMSO were used as controls. Data above (B, D, F) represents (n = 3), in H, error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used (*p≤0.05, **p≤0.01). Scale bars = 10 μm (E, E’).

https://doi.org/10.7554/eLife.43561.014

To test whether VPS13A and VAP-A interact via the putative VPS13A FFAT motif, we conducted a set of in vitro pull-down experiments. We generated GST-tagged recombinant VPS13A fragments (Figure 4C) that were incubated with bacterially expressed 6x-His tagged VAP-A. We found that all the constructs containing the VPS13A FFAT motif were efficiently binding VAP-A (Figure 4D), including the FFAT motif itself (Figure 4D, Lane 3). Importantly, the introduction of the D845A point mutation in this motif, which is known to affect VAP-A binding in other FFAT-containing proteins (Loewen et al., 2003; Saita et al., 2009), reduced its association to VAP-A (Figure 4D, Lane 6). Similar results were obtained when these GST-tagged recombinant VPS13A fragments were incubated with HeLa cell lysates. Following GST pull down, endogenous VAP-A from HeLa cells was found to be enriched together with GST-VPS13A fragments in a FFAT-dependent manner (Figure 4—figure supplements 34). These results indicate that VPS13A interacts with VAP-A via its FFAT domain.

To investigate whether the FFAT motif is required for the localization of VPS13A to the ER, we generated a VPS13A FFAT-deletion mutant (VPS13A∆FFAT) tagged with GFP. Analysis of confocal images showed that VPS13A∆FFAT still presented co-localization to mitochondria comparable to the full length (Figure 4—figure supplement 3, yellow signal in the overlay images) but no co-localization was observed between ER-marker VAP-A and VPS13A∆FFAT (absence of yellow signal in the overlay image of VPS13A∆FFAT and VAP-A, (Figure 4E’, Figure 4—figure supplement 3), indicating that the FFAT domain is the main hub for ER targeting of VPS13A. The FFAT domain appeared not to be sufficient for an in vivo association with the ER, since FFAT containing VPS13A fragments appeared to remain cytosolic and did not show a reticular pattern (Figure 2D,E). To further investigate the requirement of the FFAT domain in the interaction with VAP-A, we expressed VPS13A-GFPΔFFAT and found no immunoprecipitation with endogenous VAP-A, whereas the full length construct did (Figure 4F).

The assembly of membrane contact sites is regulated by cellular calcium levels (Giordano et al., 2013; Idevall-Hagren et al., 2015). Calcium levels are mainly regulated through the activity of sarcoendoplasmic reticulum calcium ATPase (SERCA), which can be pharmacologically inhibited with thapsigargin (TG), leading to an increase in cytosolic calcium. In order to understand the effect of cellular calcium on VPS13A-VAP-A interaction, we treated cells with different concentrations of TG. GFP-VAP-A was expressed in HeLa cells and after TG treatment GFP-trap assays were used to immunoprecipitate GFP-VAP-A and an increased amount of endogenous VPS13A bound to GFP-VAP-A was observed (Figure 4G,H). The increase was proportional to the concentration of TG applied. The calcium mediated VPS13A-VAP-A interaction suggests that VPS13A plays a role in ER-mitochondria contact sites.

In conclusion, our data support a model where VPS13A can associate simultaneously with mitochondria and ER via its C-terminus and FFAT domain, respectively.

Depletion of VPS13A is associated with decreased areas of proximity between ER and mitochondria

Our results so far indicate that VPS13A is localized, among others, at areas were the ER and mitochondria are in close proximity. We aimed to investigate a possible role for VPS13A in influencing ER-mitochondria contact sites. We used a split-GFP-based contact site sensor (SPLICS) engineered to fluoresce when organelles are in proximity (Cieri et al., 2018). This assay consists of co-expression of two constructs, one encoding a non-fluorescent portion of GFP fused to an ER-targeting signal, and another one encoding a complementing non-fluorescent portion of GFP fused to an OMM moiety targeting it to the cytoplasmic side of the outer mitochondrial membrane. When in close contact, the two non-fluorescent portions of GFP fold and a fluorescent GFP is obtained. We used two variants, named SPLICSS and SPLICSL, detecting narrow (≈8–10 nm) and wide (≈40–50 nm) distances between ER and mitochondria respectively. Contact sites between ER and mitochondria result in bright spots (Cieri et al., 2018). In order to investigate a possible role of VPS13A in ER-mitochondria contact sites, we used a MCR5 VPS13A KO cell line, obtained via a CRISPR/Cas9 approach, with no detectable levels of VPS13A protein while its closest homologous protein VPS13C appears normal (Figure 5—figure supplements 12). In these cells using the SPLICS sensor, contact sites could be visualized (Figure 5A,B) as previously reported (Cieri et al., 2018). Both signals from the SPLICS assay, for narrow and wide distances, are significantly decreased in VPS13A depleted cells compared to the parental cell line (Figure 5A’’–B”). Together our results not only indicate that VPS13A is present at areas were mitochondria and ER are in close proximity, but also that VPS13A is involved in the formation or stabilization of ER-mitochondria contact sites.

Figure 5 with 3 supplements see all
Depletetion of VPS13A results in less elongated mitochondria and impaired mitophagy.

(A–B) Representative images of control MRC5 cells (WT) (A, B) and VPS13 KO MRC5 cells (A’, B’) transfected with SPLICSS (A, A’) or SPLICSL (B, B’) to detect narrow (~8–10 nm) or long (~40–50 nm) distance ER-mitochondria contact sites respectively. A’, B’. Quantification of narrow and long distance contact sites in WT and VPS13A KO MRC5 cells. Error bars, mean ±s.e.m (n = 3 (A”) and n = 5 (B”)), two-tailed unpaired Student’s t-test was used (*p≤0.05, **p≤0.01). (C) Quantification of the mitochondria morphology of cells cultured under normal conditions (control) or under starved conditions (HBSS). WT and VPS13A KO MRC5 cells, were stained for the mitochondria marker TOMM20 (red) and DAPI (blue). For the quantification three cell-types with different mitochondrial appearances were pre-defined, type 1 cells with short, fragmented, densely packed mitochondria, type 2 cells with a mixture of round densely packed and more tubulated and less densely packed mitochondria and type 3 cells with tubulated dispersed and long mitochondria. Typical images and schematics are provided(C’). Error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used (*p≤0.05). (D) Mitophagy assay of control MRC5 (WT) and VPSA13 KO cells. The cells were transfected with FLAG-Parkin, which allows for the removal of damaged mitochondria and were treated with DMSO (control) or 20 µM CCCP (inducing mitochondria damage). After the transfection/treatment the cells were stained for the mitochondria marker TOMM20 and the mean fluorescence TOMM20 intensity was measured exclusively in FLAG-Parkin positive cells. The decrease in TOMM20 fluorescence after CCCP represents mitophagy. Error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used (**p≤0.01, ***p≤0.001). (E,F) In control and starved (HBSS) MRC5 WT and VPS13A KO cells levels of pDRP1 and total DRP1 were determined by immunoblotting using GAPDH as a loading control (E). Quantification of protein band intensities in F was performed using ImageJ and plotted as a ratio of pDRP to GAPDH (F). Error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used (*p≤0.05, **p≤0.01, ***p≤0.001). Scale bars = 10 μm (A, A’, B, B’, C’).

https://doi.org/10.7554/eLife.43561.019

Mitochondria elongation is impaired in VPS13A depleted cells

ER-mitochondria contact sites are required for the transfer of lipids between the ER (where majority of lipid synthesis occurs) and mitochondria (Gatta and Levine, 2017) and, therefore, a decrease in ER-mitochondria contact sites may have consequences for mitochondria processes such as fission, fusion and mitophagy which are all influenced by the lipid composition of mitochondria membranes (Böckler and Westermann, 2014; Lahiri et al., 2015). We used the VPS13A KO cell line to investigate the consequences of VPS13A depletion in these processes. Upon morphological examination we found that VPS13A depleted cells contained less elongated mitochondria compared to control cells when cultured under standard conditions (Figure 5C,C’).Upon starvation, a process which induces the formation of elongated mitochondria (Rambold et al., 2011), an increased amount of VPS13A KO cells with elongated mitochondria was observed, however, not to the extent as observed in control cells (Figure 5C,C’). Finally, a reduced capacity to eliminate damaged mitochondria by mitophagy was observed in the KO cell line, after inducing mitophagy with CCCP and overexpression of Parkin (Narendra et al., 2008) (Figure 5D) together with an increase in S616 phosphorylation of Drp1, a phosphorylation associated with decreased fusion and increased fission (Figure 5E–F, Figure 5—figure supplement 3) (Rambold et al., 2011; Kashatus et al., 2015). Together our results demonstrate that VPS13A depleted cells show an apparent mitochondria phenotype consistent with decreased fusion, increased fission and impairment of mitophagy.

VPS13A is associated with lipid droplets

In addition to a localization at areas were mitochondria and the ER are in close proximity, we observed that VPS13A is also appeared in a punctate and vesicular-shaped pattern. These vesicular-like structures did not represent mitochondria (Video 1). Using confocal microscopy with lipid droplets (LDs) specific dyes, BODIPY-FA or LipidTox red, we showed that the VPS13A positive structures co-localized with these dyes, indicating that these VPS13A positive vesicular-like structures were LDs (Figure 6A).

Figure 6 with 1 supplement see all
VPS13A decorates Lipid droplets.

(A) HEK293T cells were transfected with VPS13A-GFP for 24 hr and Lipidtox red was used as a marker for LDs. (B) HEK293T cells transfected with VPS13A-GFP for 48 hr were pulsed with 1 μM BODIPY-FA (red) at 37°C for 30 min followed by a chase in medium containing 500 uM OA for 2 hr at 37°C. (C) A close-up image of a LD in a cell taken from B in vivo is shown. Line profile analysis across the LD showed the enrichment of the VPS13A-GFP signal on the periphery of the LD (C’). Scale bar = 1 μm. Scale bars = 10 μm (A, B) and 1 μm (C).

https://doi.org/10.7554/eLife.43561.023

In order to elaborate further on this observation, cells were cultured under conditions that elicit LD biogenesis and oleic acid (OA), a fatty acid known to induce intracellular LD formation (Wilfling et al., 2013; Thiel et al., 2013; Kassan et al., 2013) was added to the cells. Cells expressing VPS13A-GFP were visualized at different times after OA induction. Before the addition of OA and under normal culturing conditions, a small amount of LDs were observed which were positive for VPS13A-GFP, in addition to the VPS13A-GFP signal present in the reticular pattern reflecting its distribution at the mitochondria-ER contact sites (Figure 6B, left panel). After 2 hr of exposure to OA, numerous LDs were formed and VPS13A-GFP was found at BODIPY-FA-positive LDs. Line scan analysis of individual large LDs at a high magnification revealed that VPS13A-GFP uniformly encircled them (Figure 6C,C’), indicating enrichment of VPS13A at the membrane and not at the interior of LDs, the ring-like VPS13A positive signal is most obvious at the periphery of larger LDs (such as after 120’ OA, Figure 6B).

To corroborate these observations, we next investigated whether endogenous VPS13A was also enriched in fractions enriched with LDs. We thus analyzed the subcellular distribution of endogenous VPS13A by sucrose gradient fractionation of cells grown under normal conditions, starved for serum or exposed to OA for 24 hr (Figure 6—figure supplement 1). Western blot analysis of sucrose gradient fractions revealed that VPS13A was mainly enriched in the heavier fractions under starvation (Figure 7A,A’ and A”) and normal (Figure 7—figure supplements 14) growth conditions, and only a small portion (~4%) appeared in fraction 1, corresponding to LDs that floated on top of the sucrose gradient, which was identified using the Perilipin2 (PLIN2) as a specific LD marker protein. Part of PLIN2 was sequestered in the fractions with high density organelles that contained marker proteins such as VAP-A, EGFR and ATP-5A (Figure 7A,A’ and A”, Figure 7—figure supplement 14), consistent with previous work showing that very minimal amount of LDs are formed under starvation conditions (Kassan et al., 2013). Induction of LD formation after incubation of cells with OA for 24 hr resulted in a shift in the distribution of endogenous VPS13A towards the LD fraction. As expected, PLIN2 was enriched in the top fraction consistent with the fact that LDs are formed in response to OA induction (Figure 7B,B’ and B”, Figure 7—figure supplements 14). The distribution of the plasma membrane protein EGFR and the lysosomal protein LAMP1 was not affected upon OA induction or serum starvation (Figure 7A–B”, Figure 7—figure supplements 14). In addition, comparison of the amount of VPS13A in the LD fraction showed that VPS13A was partly concentrated in the LD fractions of OA fed cells. Addition of OA to starved cells increased the amount of VPS13A in the LD fraction (Figure 7C, Figure 7—figure supplements 14). Taken together, these data confirmed our observation that VPS13A is associated with LDs.

Figure 7 with 4 supplements see all
Endogenous VPS13A is enriched in LDs containing fractions.

(A) FBS starved HeLa cells were processed as described in Figure 6—figure supplement 1. Fractions with equal amounts of proteins were processed for Western blot analysis and specific protein levels were detected using antibodies for VPS13A, LAMP1, EGFR, PLIN2, VAP-A and ATP5A. Quantification of protein band intensities in A was performed using ImageJ and plotted as percentage of the total (A’). A’ shows a close-up of values of the top three light sucrose density fractions of A. In A’and A’, error bars, mean ±s.e.m (n = 3). (B) FBS starved Hela cells were incubated with 500 μM OA and processed as described under A and as in Figure 6—figure supplement 1. Quantification of protein band intensities in B was performed using ImageJ and plotted as percentage of the total (B’). B’ shows a close-up of values of the top three lowest sucrose density fractions. In B’and B’, error bars, mean ±s.e.m (n = 3). (C) HeLa cells were either grown in complete medium (Control), FBS starved (Stv, as in A) or further incubated with 500 μM OA and processed as described in Figure 6—figure supplement 1. LDs were isolated from the top fraction. Equal amounts of proteins were resolved by Western Blot and detected using antibodies for VPS13A, LAMP1, EGFR, PLIN2, VAP-A, ATP5A and α-Tubulin. Specific bands are indicated with an asterisks D) Representative single stack image of HEK293T cells expressing VPS13A-GFP (D) or VPS13A-GFP Δ FFAT (D’). Cells were incubated with 500 μM OA for 3 hr. LDs stained with LipidTox red. Scale bar = 10 μm (D).

https://doi.org/10.7554/eLife.43561.025

We then questioned whether the ER localization through VAP-A binding was important for the LDs localization of VPS13A. To do so, we expressed VPS13A-GFP∆FFAT in OA fed cells and showed that it was recruited to LDs similarly as WT VPS13A-GFP (Figure 7D,D’). This indicates that the FFAT motif of VPS13A is not required for its recruitment to LDs.

VPS13A negatively affects lipid droplet size and motility

We investigated the role of VPS13A on LDs biology by studying the number of LDs in the presence and absence of VPS13A, and we compared the motility of VPS13A-positive and VPS13A-negative LDs. Under normal culturing conditions, VPS13A KO cells showed increased numbers of LDs (Figure 8A–B) compared to the parental control line. In addition, fluorescent activated cell sorting (FACS) quantification of the total Nile red intensity showed a significantly increased intensity in the absence of VPS13A (Figure 8C). VPS13A is not required for LD formation, because VPS13KO cells do contain LDs and OA induction in VPS13A KO cells resulted in an increase in LDs comparable to control cells (Figure 8D).

VPS13A negatively regulates LD mobility.

(A) WT (A) and VPS13A KO MRC5 cells (A’) were stained with LipidTox green for LDs (green) and the nuclear marker DAPI (blue) and imaged by confocal microscopy. (B) Quantification of LD numbers in A. Error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used (*p≤0.05, **p≤0.01). (C) WT and VPS13A KO MRC5 cells were stained with Nile red and intensity was measured using FACS. Error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used (*p≤0.05, **p≤0.01). (D) WT and VPS13A KO MRC5 cells were exposed to 500 µM OA for 16 hr. Afterwards cells were stained with LipidTox green to visualize LDs and LD numbers were quantified. Error bars, mean ±s.e.m (n = 3), two-tailed unpaired Student’s t-test was used. (E) HEK293T cells were transfected with VPS13A-GFP and stained with LipidTox red to visualize LDs in vivo. Images with a time interval of 6 s were recorded of VPS13-GFP positive (cell 1) and adjacent VPS13-GFP negative (cell 2) cells. The locations of LDs at t = 0 are indicated in green, the locations of the same LDs at t = 6 s are indicated in magenta (E). If the LD did not move between time frames, the overlapping signal (green and magenta) is white. The VPS13A signal is shown in E’: Cell one is transfected with VPS13A-GFP; Cell two is a non-transfected cell. (F) Quantification of the fraction of non-moving (white) LDs compared to the total number of LDs in VPS13A-GFP positive or VPS13A-GFP negative cells. Error bars, mean ±s.e.m, two tailed unpaired Student’s t-test was used (*p≤0.05). Scale bars = 10 µm (A, A’, E,).

https://doi.org/10.7554/eLife.43561.030

Live cell analysis was used to track individual LDs in VPS13A-GFP expressing cells. Visual examination showed that VPS13A-GFP positive LDs slowly and randomly oscillated. When these LDs were briefly dissociated from VPS13A-GFP, they directionally traveled faster and such motility was interrupted when VPS13A-GFP was again associated with the LD (Video 3). To further substantiate this, we recorded LDs in adjacent control (Figure 8E,E’ cell 2) and VPS13A-GFP overexpressing (Figure E, E’ cell 1) HEK293T cells, at two different times and quantified the LDs that did not move at this time interval. In VPS13A-GFP overexpressing cells, a larger fraction of the LDs showed an overlapping pattern compared to the non-transfected cells (Figure 8E–F), further suggesting that VPS13A overexpression reduces LD motility.

Video 3
HEK 293 T cells overexpressing VPS13-GFP were incubated with 500 uM for 3 hr.

LDs were stained with LipidTox red to visualize and time lapse images were taken every 600 milliseconds. The video is played at 10 frames per second.

https://doi.org/10.7554/eLife.43561.031

In summary, the presence of VPS13A on LDs negatively influenced their motility and when LDs temporarily did not contain VPS13A, they showed faster directional motility. In the absence of VPS13A increased LD numbers are present, strongly indicating a role of VPS13A in LD related processes.

Eyes of Drosophila Vps13 mutants show an increase in LDs

Previously it has been demonstrated that in pigment cells (glia cells) of Drosophila eyes LDs can be formed in response to various stressors occurring in neuronal cells (Liu et al., 2015). In order to investigate the role of VPS13A in LD related processes in a multicellular organism, we investigated LDs in eyes of the available and established Drosophila Vps13 mutant (Vonk et al., 2017). Drosophila Vps13 is most similar to human VPS13A and VPS13C (Velayos-Baeza et al., 2004). Homozygous mutants show a decreased life span, impaired locomotor function upon ageing, impaired protein homeostasis and large brain vacuoles (Vonk et al., 2017). Examination of the eyes using Nile red to visualize LDs showed that 5 day old Vps13 mutants have increased numbers of LDs compared to wildtype (Figure 9A–C’). Overexpression of human VPS13A in the mutant background (Figure 9D–E, Figure 9—figure supplement 1) rescued the phenotype back to normal. These data indicate that Drosophila Vps13 and human VPS13A share functional properties.

Figure 9 with 1 supplement see all
Vps13A mutants show a lipid droplet phenotype in the Drosophila adult eye, which can be rescued by ectopic expression of the human VPS13A.

(A) Optical section (A) and schematic (A’) of a Drosophila adult ommatidium, taken at the height of the cone cells (Ready, 1989). Cone cells (c), pigment cells (1°, 2°, 3°) and bristles (b) are indicated in different colors. Naturally occurring or (in mutants) ectopically accumulating LDs (red circles) are found in the pigment cells (Liu et al., 2015; Liu et al., 2017). (B,C) Optical cross-section and longitudinal section through the adult eye of Drosophila control (B/B’) and Vps13 homozygous mutant flies (C/C’) at day 5 past eclosion. Nile Red was used to reveal the presence of LDs (red arrow heads) in the pigment cells. (D) Optical cross-sections through the adult eye of Vps13 homozygous mutant flies, control flies and Vps13 homozygous mutant flies expressing human VPS13A at day 3 after eclosion. Nile Red was used to detect LDs. D:Vps13/Vps13, (=Vps13 homozygous mutant). D’: Vps13/Vps13;hVPS13A/Act-Gal4 (=Vps13 homozygous mutant expressing human VPS13A). D’: Vps13/+;UAS-hVPS13A/Act-Gal4 (heterozygous for Vps13 expressing human VPS13A). (E) Western blot to demonstrate the absence of Drosophila Vps13 in mutant flies and the expression of human VPS13A in the rescued Drosophila Vps13 mutant background. Samples marked with a red asterisk were used for the Nile Red staining in the rescue experiment (D–D’’). Scale bars = 10 μm (B–D).

https://doi.org/10.7554/eLife.43561.032

Discussion

Our biochemical and localization studies show that human VPS13A is a peripheral membrane protein present, at least, at two distinct subcellular localizations: at sites where mitochondria and the ER are in close proximity and VPS13A is localized at the surface of LDs. These results confirm early observations obtained from overexpression of human VPS13A in mammalian cells and identify the characteristic ‘vesicular-like’ structures as LDs (Velayos-Baeza et al., 2008). The peripheral membrane characteristics of VPS13A are shared by the other human VPS13 proteins (B, C and D), the yeast and the Drosophila Vps13 protein (Lesage et al., 2016; Brickner and Fuller, 1997; Vonk et al., 2017; Velayos-Baeza et al., 2008; Seifert et al., 2011), suggesting a common feature of VPS13 proteins.

VPS13A is localized at ER-mitochondria contact sites

The association of VPS13A with the ER is established via its FFAT domain which binds to the ER residing protein VAP-A. VAP-A/B proteins have been extensively characterized as a hub when the ER establishes membrane contacts with other organelles including endosomes, mitochondria, peroxisomes, plasma membrane and Golgi (Alpy et al., 2013; Eden et al., 2016; Costello et al., 2017; Hua et al., 2017; Stoica et al., 2014; Gomez-Suaga et al., 2017; Mesmin et al., 2013; Stefan et al., 2011; Rocha et al., 2009; Dong et al., 2016). Our results showed that VPS13A also interacts with VAP-B in a FFAT dependent manner (Figure 4—figure supplements 23), consistent with the fact that VAP-A and VAP-B functions are often redundant (Dong et al., 2016).

The association of VPS13A with mitochondria is mediated via the C-terminal domain. In addition, fractionation studies show that VPS13A co-fractionates with TOMM20, a protein localized at the outer membrane of mitochondria. Our observed interaction between VPS13A and VAP-A in a FFAT-dependent manner and our reported localization at the ER-mitochondria contact sites is consistent with localization studies recently reported by Kumar et al (Kumar et al., 2018).

VPS13A depleted cells show mitochondria abnormalities

We further show that ER-mitochondria contact sites are decreased in VPS13A depleted cells, consistent with results by Kumar et al, which demonstrate that upon overexpression of VPS13A an increase in ER-mitochondria contact sites is observed. Our data and the data by Kumar et al are in line with studies in yeast demonstrating that Vps13 is present at various organelle contact sites and is required for ER-mitochondria contact sites, all pointing to a conserved function of VPS13A at these sites. Our reported mitochondria phenotypes (less elongated and a decreased mitophagy capacity) in the VPS13A depleted cells could all be explained by abnormal lipid composition of mitochondria membranes. A possible defect in lipid transfer between ER and mitochondria due to VPS13A depletion is in line with results from Kumar et al., who demonstrated in vitro that the N-terminal part of yeast Vps13, which is highly similar to human VPS13A, is able to transfer lipids between two membranes. Together, these data favor a model in which human VPS13A plays a role in tethering ER to the outer membrane of mitochondria to create areas of close proximity and to enable transfer of lipids between these membranes via the VPS13A N-terminal domain (Figure 10A,C).

Proposed model for VPS13A function.

(A) Under normal growth conditions VPS13A is localized at the ER-mitochondria contact sites where it is anchored to VAP-A through its FFAT domain and via its C-terminal region it is associated with mitochondria, most likely via mitochondria specific adaptor proteins. VPS13A at this location may facilitate the transfer of lipids between ER and mitochondria and mitochondria fusion and mitophagy occur normally. (B) Under normal conditions VPS13A is also associated to LD, an association mediated via LD specific adaptor proteins. Via VPS13A LD are associated to the ER and VPS13A facilitate the transfer of lipids between ER and LDs. The VPS13A mediated ER-lipid connection halts LD movement. (C) Depletion of VPS13A leads to impaired lipid transfer between ER and mitochondria, leading to abnormal function of mitochondria which become less elongated. (D) Depletion of VPS13A also leads to disconnection of LD and the ER, leading to increased movement and reduced degradation of LD, resulting in increased LD numbers.

https://doi.org/10.7554/eLife.43561.034

VPS13A is localized at the surface of lipid droplets

In addition to the localization at ER-mitochondria contact sites, VPS13A localizes to the periphery of LDs in a FFAT-independent manner, consistent with the recent report from Kumar et al (Kumar et al., 2018). Under circumstances of increased fatty acid uptake, more LDs accumulate in cells and thereby more VPS13A positive LDs are observed. The origin of LD-associated VPS13A could be either newly synthesized VPS13A or protein relocated from the already available VPS13A pool, mainly at the ER-mitochodria contact sites, more in depth studies are required to address this point. Bean et al. (Bean et al., 2018) have recently shown in yeast that different adaptor proteins present at specific subcellular locations compete for binding to Vps13. Organelle-specific VPS13A adaptor proteins may be present as well in mammalian cells; LD specific adaptor proteins would increase in conditions when LDs are increased, resulting in enhanced competition for VPS13A which could possibly be relocated to LDs from other sub-cellular locations. This explanation (Figure 10B,D) is in line with our observation of increased levels of VPS13A in fractions containing LDs in cells with an increased amount of LDs. Different VPS13 members may have their own specific adaptor proteins which would explain their different reported localizations, such as VPS13B at the Golgi (Seifert et al., 2011) or VPS13C at endosomes (Kumar et al., 2018). Conversely, since different VPS13 proteins can localize at the same organelles, such as VPS13A and VPS13C in LDs and mitochondria (Lesage et al., 2016; Kumar et al., 2018; Yang et al., 2016; this report), it is also possible that the same adaptor protein could bind several VPS13 proteins.

VPS13A influences lipid droplet motility

LDs have long been considered as inert lipid inclusions and studies of their biology were constrained (Gluchowski et al., 2017). Evidence is now accumulating that LDs are far from being only fat depots as they are decorated by a large number of proteins that regulate their formation, destruction and communication with other organelles (Kassan et al., 2013; Thiam and Forêt, 2016; Salo et al., 2016; Wang et al., 2016; Bi et al., 2014; Krahmer et al., 2011; Kory et al., 2015; Cermelli et al., 2006). Given the described functions of VPS13A in tethering ER-mitochondria membranes and transferring lipids, it could be expected that VPS13A at LDs is probably performing a comparable function. Kumar et al demonstrated that LDs decorated with VPS13A are surrounded by ER and, therefore, most likely VPS13A could be at contact sites between LDs and ER (Figure 10B,D). VPS13A influences the motility of LDs, a feature reminiscent of identified proteins regulating dynamics of endosomal vesicles. Endosomal movement is halted when endosomes make contacts with the ER (Raiborg et al., 2015) and movement of peroxisomes is increased upon loss of the VAP-ACBD5 tethering complex (Costello et al., 2017; Hua et al., 2017). Consistent with this, we show that VPS13A negatively influences LD motility and LDs are more fixed under conditions of VPS13A overexpression.

VPS13A depleted cells and Drosophila Vps13 mutants show increased amount of lipid droplets

Increased numbers of LDs in VPS13A depleted cells can be explained because in the absence of VPS13A the association with the ER may be reduced and lipid transfer decreased. This in turn could lead to disruption of LD turnover processes such as lipophagy and release of LD content to other organelles (Rambold et al., 2015; Kaushik and Cuervo, 2015). Homozygous Drosophila Vps13 mutants also show an increase in LDs, which could be explained by a combination of impaired mitochondria function and abnormal LD turnover capacity. It has been reported that, in response to impaired mitochondria function in neuronal cells of the Drosophila eye, ROS levels increase and lipids are transferred from neurons to glia cells where LDs transiently form (Liu et al., 2015; Liu et al., 2017). An increase in LDs in glia cells in response to impaired mitochondria functioning is also observed in neurodegenerative mouse models (Liu et al., 2015; Liu et al., 2017). Thus, it is possible that the increased numbers of LDs in glia cells of the fly Vps13 mutant eyes could be caused by an initial impairment in mitochondrial function.

VPS13A and ChAc

The question remains why loss of VPS13A leads to ChAc, a movement disorder mostly presenting in the third decade of the patient’s life. Impairment of mitochondria processes such as fusion and mitophagy could explain the neurodegeneration observed in ChAc patients, since impairment of these processes has been largely linked to neurodegeneration (Ryan et al., 2015). In addition, impairment of LD related processes could explain neurodegeneration as well since LD abnormalities are associated with several neurodegenerative diseases such as hereditary spastic paraplegias (Inloes et al., 2014), Huntington’s disease (Martinez-Vicente et al., 2010), and Parkinson’s disease (Outeiro and Lindquist, 2003). The role of LD in the adult central nervous system is largely unknown. It may be possible that in ageing ChAc patients oxidative stress builds up due to impaired mitochondria functions and LDs form and accumulate because of a compromised turnover due to decreased contact sites with their target organelles. Gradually increasing numbers of large LDs in an aging organism may form physical obstructions that could eventually hamper cellular functions of glia and their neighboring neuronal cells. It is also well possible that overall lipid homeostasis and other metabolic pathways are imbalanced in ChAc, leading to neurodegeneration in an ageing organism. Since LDs have not been studied in ChAc models or in material derived from ChAc patients, these possible ‘disease mechanisms’ are only hypotheses which would require further experimental data to be properly tested, leaving this field largely open for future research.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
AntibodyFlag (rabbit polyclonal)SigmaF7425IF (1:500)
AntibodyMyc (mouse monoclonal)Enzo Life ScienceADI-MSA-110-FIF (1:500) WB (1:1000)
AntibodyTOMM20 (mous monoclonal)BD biosciences612278IF (1:200) WB (1:1000)
AntibodyNormal Goat IgG (goat polyclonal)Santacruzsc-2028IP (1:200)
AntibodyNormal rabbit IgG (rabbit polyclonal)Santacruzsc-2027IP (1:200)
AntibodyVAP-A (goat polyclonal)Santacruzsc-48698IP (1:100) WB (1:1000)
AntibodyVAP-B (rabbit polyclonal)SigmaHPA013144IP (1:100) WB (1:1000)
AntibodyVPS13A (rabbit polyclonal)SigmaHPA021652IP (1:100) WB (1:1000)
AntibodyATP5A (mouse monoclonal)Abcamab14748WB (1:5000)
Antibodya-Tubulin (mouse monoclonal)SigmaT5168WB (1:5000)
AntibodyEGFR (rabbit polyclonal)SantacruzSC-03-GWB (1:1000)
AntibodyGAPDH (mouse monoclonal)Fitzgerald10R-G109AWB (1:10000)
AntibodyGFP (mouse monoclonal)Clontech632381WB (1:5000)
AntibodyGST (mouse monoclonal)Santacruzsc-138WB (1:1000)
AntibodyLAMP1 (mouse monoclonal)Abcamab25630WB (1:1000)
AntibodyDRP1 (rabbit monoclonal)cell signaling8570 sWB (1:500) D6C7
AntibodypDRP1 (rabbit polyclonal)cell signaling3455 sWB (1:1000) ser616
AntibodyPLIN2 (rabbit polyclonal)Abcamab78920WB (1:1000)
AntibodyRAB7 (mouse monoclonal)Abcamab50533WB (1:1000)
AntibodyVps13 #62 (rabbit polyclonal)PMID:28107480WB (1:1000)
AntibodyVPS13A (rabbit polyclonal)SigmaHPA021662WB (1:1000)
AntibodyVPS13A (H-102) (rabbit polyclonal)Santacruzsc-367262WB (1:1000)
AntibodyVPS13C (rabbit polyclonal)SigmaHPA043507WB (1:1000)
OtherNile RedThermo Fisher ScientificN1142FACS (1:500)
OtherBODIPY-FAThermo
Fisher Scientific
D3835IF 1 µM
OtherLipidTox-greenThermo Fisher ScientificH34475IF (1:200)
OtherLipidTox-redThermo Fisher ScientificH34476IF (1:200)
OtherMitotracker OrangeThermo Fisher ScientificM-7510100 nM (live) and 200 nM (fixed)
OtherMitotracker RedThermo Fisher ScientificM-7512100 nM (live) and 200 nM (fixed)
OtherNile RedThermo Fisher ScientificN1142IF (1:1000)
OtherDAPIThermo Fisher Scientific622470.2 µg/ml
Recombinant DNA reagentLamp1-GFPAddgene34831
Recombinant DNA reagentmCherry-FYCO1PMID:25855459
Recombinant DNA reagentGFP-Rab5 Q79LAddgene28046
Recombinant DNA reagentGFP-Rab7 Q67LAddgene28049
Recombinant DNA reagentBFP-Sec61BAddgene49154
Recombinant DNA reagentmCherry-Sec61BAddgene49155
Recombinant DNA reagentpeGFP-C1Clontechdiscontinued
Recombinant DNA reagentpeGFP-N1Clontech6085–1
Recombinant DNA reagentVPS13-GFP (FL)this paperProgentiors:PCR VPS13-myc and pEGFP-N1; VPS13-myc
Recombinant DNA reagentVPS13-Myc (FL)PMID:28107480
Recombinant DNA reagentVPS13-GFP- DFFATthis papermutagenesis on VPS13-GFP
Recombinant DNA reagentVPS13-GFP2–854this paperProgentiors: PCR VPS13-GFP; pEGFP-C1
Recombinant DNA reagentVPS13-GFP835–1700this paperProgentiors: PCR VPS13-GFP; pEGFP-C1
Recombinant DNA reagentVPS13-GFP
855–1700
this paperProgentiors: PCR VPS13-GFP; pEGFP-C1
Recombinant DNA reagentVPS13-GFP
2003–2606
this paperProgentiors: PCR VPS13-GFP; pEGFP-C1
Recombinant DNA reagentVPS13-GFP2615–3174this paperProgentiors: PCR VPS13-GFP; pEGFP-C1
Recombinant DNA reagentpGEX5×2GE Healthcare28954554
Recombinant DNA reagentGST-FFATthis paperProgentiors: oligo FFAT domain;pGEX5×2
Recombinant DNA reagentGST-VPS13A (2-834)this paperProgentiors: PCR VPS13-GFP; pGEX5×2
Recombinant DNA reagentGST-VPS13A (2-854)this paperProgentiors: PCR VPS13-GFP; pGEX5×2
Recombinant DNA reagentGST-VPS13A (2–854/D845A)this papermutagensis on GST-VPS13 (2-854)
Recombinant DNA reagentGST-VPS13A (835–1700)this paperProgentiors: PCR, VPS13-GFP; pGEX5×2
Recombinant DNA reagentpET28aEMD Biosciences69864–3
Recombinant DNA reagentGFP-VAP-Athis paperProgentiors: PCR pET28a-VAP-A; pEGFP-C1
Recombinant
DNA reagent
mCherry-VAP-Athis paperProgentiors:PCR pET28a-VAP-A; mCherry-tubuline
Recombinant DNA reagentpET28a-VAPAthis paperProgentiors: PCR cDNA Hek293T; pET28a
Recombinant DNA reagentSPLICSsPMID: 29229997
Recombinant DNA reagentSPLICSLPMID: 29229997
Recombinant DNA reagentOMM-GFP1-10PMID: 29229997
Recombinant DNA reagentFLAG-ParkinPMID: 12937272
Recombinant DNA reagentpSpCas9(BB)
−2A-Puro (PX459)
Addgene48139
Recombinant DNA reagentmCherry-tubulinePMID: 15558047
Cells (human)Hek293TATCCCRL-3216
Cells (human)HeLa S3ATCCCCL-2.2
Cells (human)U2OSATCCHTB-96
Cells (human)MRC5 WT(MRC-5 SV2) ECACC 84100401
PMID: 6313714
Cells (human)MRC5 Clone 4
MRC5-SV2_A01-01t_A2b
A. Velayos-Baeza
Chemical compound, drugOleic acidSigmaO3008
Chemical compound, drugThapsigarginMerck Millipore586005
Chemical compound, drugCarbonyl cyanide 3-chlorophenylhydrazone (CCCP)SigmaC2759
Chemical compound, drugProteinase K (recombinant), PCR gradeFermentasEO0491
Commercial assay or kitGibson assembly master mixNEBE2611
Chemical compound, drugHBSS, calcium magnesiumThermo Fisher Scientific14025092
Commercial assay or kitQuickChange Site Directed Mutagenesis KitAgilent200519
Commercial assay or kitGlutathione Sepharose 4B (10 ml)GE healthcare17-0756-01
Commercial assay or kitGFP-Trap_MAChromotekgtma-20
 chemical compound, drugpolyethylenimine (PEI)Polysciences23966
Commercial assay or kitprotein A/G plus agarose beadsSanta Cruzsc-2003
Genetic reagent (D. melanogaster)w1118Bloomington Drosophila Stock Center3605FlyBase symbol: w[1118]
Genetic reagent (D. melanogaster)VPS13 (c03628)Harvardc03628FlyBase symbol: PBac{PB}Vps13c03628/CyO
Genetic reagent (D. melanogaster)hVPS13PMID:28107480
Genetic reagent (D. melanogaster)Act-Gal4Bloomington Drosophila Stock Center3954y1w*;P{w[+mC]=Act5 C-GAL4}17bFO1/TM6B, Tb

Cell culture and transfection

Request a detailed protocol

HeLa, U2OS and HEK293T cells (all cell lines were obtained from ATCC, see Key Resources table) and are mycoplasma negative (GATC Biotech GA, Konstanz, Germany). MRC-5 SV2 cells (SV40-immortalized human male fetal lung fibroblasts), here referred to as MRC5, were initially obtained from ECACC (# 84100401), and were tested negative for mycoplasma. Cells were cultured in Dulbecco’s modified eagle medium (DMEM, Gibco or Sigma) containing 10% Fetal Bovine Serum (FBS, Greiner Bio-one) and Penicillin/Streptomycin (Gibco) in 5% CO2 at 37°C. Plasmid transfections of HeLa and U2OS cells were done using polyethylenimine 1 µg/ml(PEI, Polysciences) in 1:1 concentration. For procedures that required overexpression of full length VPS13A-GFP or VPS13A-Myc, HEK293T cells were transfected using the Calcium Phosphate precipitation method. In both cases cells were analyzed 24 or 48 hr after transfection and medium was refreshed 24 hr after transfection.

Oleic acid (OA, Sigma) was added at indicated concentrations for different time points. Thapsigargin (Merck Millipore) was added in indicated concentrations for 6 hr. Prior to HBSS (Thermo Fischer scientific) treatment, cells were washed 1x with HBSS and then incubated for 5 hr (pDRP1 determination) or for 16 hr (to assay mitochondria morphology) at 37°C in 5% CO2.

Plasmids and constructs

Request a detailed protocol

The full-length cDNA of the human VPS13A gene, variant 1A, was obtained as previously described (Velayos-Baeza et al., 2004; Vonk et al., 2017) and sub-cloned into pcDNA4-TO-mycHis (Invitrogen) to generate pcD13A-1A-mH, for expression in mammalian cells of VPS13A with a C-terminal myc +His tag (here referred to as VPS13A-Myc). A XhoI-PciI fragment of this plasmid, containing the myc-His tags and the zeocin selection marker, was replaced by a XhoI-EcoO109I fragment from pEGFP-N1 vector (Clontech), including EGFP and the kanamycin/neomycin selection marker, to generate pcD13A-1A-EGFP for expression of VPS13A with a C-terminal EGFP tag (here referred to as VPS13A-GFP). To generate the GFP-VPS13A constructs 2–854, 835–1700 and 855–1700, the correspond fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to pEGFP-C1 (Clontech) via BamHI and XhoI restriction sites. To generate the GFP-VPS13A constructs 2003–2606 and 2615–3174, the corresponding fragments were amplified by PCR from the full length VPS13A plasmid and inserted in to the BamHI/KpnI site pEGFP-C1 with the Gibson assembly kit (NEB) according to the manufactures instructions. To generate the GST-VPS13A constructs 2–835, 2–854 and 835–1700, the fragments were amplified by PCR from the full length VPS13A plasmid and inserted into pGEX5×2 (GE Healthcare) via SalI and NotI restriction sites. To generate the GST-VPS13A (2–854/D845A) and VPS13A-GFPΔFFAT, a mutagenesis was performed on GST-VPS13A (2-854) or VPS13-GFP respectively, with the QuickChange Site Directed mutagenesis kit (Agilent) according to the manufacturer’s protocol. To obtain GST-FFAT, oligonucleotides encoding the FFAT domain in human VPS13A (AA 842–848), flanked with SalI and 3’ NotI sites, were synthesized, annealed and inserted into pGex5×2 via SalI and NotI restriction sites. To generate His-VAP-A, human VAP-A was amplified by PCR from HEK293 cDNA and inserted into pET28a (EMD Biosciences) via NdeI and BamHI restriction sites. To obtain GFP-VAP-A, VAP-A was amplified by PCR from the His-VAP-A plasmid and inserted into pEGFP-C1 (Clontech) via EcoRI and BamHI restriction sites. To obtain mCherry-VAP-A, tubulin in pcDNA3.1-mCherry-Tubulin (kind gift from B. Giepmans, (Shaner et al., 2004) was replaced by a VAP-A PCR fragment via BspEI and XhoI restriction sites. All restriction enzymes used where purchased from New England BioLabs (NEB). BFP-Sec61B (Addgene plasmid #49154) and mCherry-Sec61B (Addgene plasmid #49155) were kind gifts from Gia Voeltz (Zurek et al., 2011). GFP-Rab5 Q79L (Addgene plasmid #28046) and GFP-Rab7 Q67L (Addgene plasmid #28049) were kind gifts from Qing Zhong (Sun et al., 2010). LAMP1-mGFP (Addgene plasmid # 34831) was a kind gift from Esteban Dell’Angelica (Falcón-Pérez et al., 2005). (Raiborg et al., 2015). Plasmid pSpCas9(BB)−2A-Puro (PX459) (Addgene plasmid #48139) was a gift from Feng Zhang (Ran et al., 2013). mCherry FYCO1 was a kind gift from Harald Stenmark (Raiborg et al., 2015). OMM-GFP1-10, SPLICSs and SPLICSL were a kind gift from Tito Cali (Cieri et al., 2018) FLAG-Parkin was a kind gift from Helen Ardley (Ardley et al., 2003).

PrimersSequence 5'−3'
GFP-VPS13A (2-854)FWAATTGCTCGAGAAGGCGGCGTTTTCGAGTCGGTGGTCGTGGAC
RevGGCCAAGGATCCAGGTTCTTCCAAGGGACTACAT
GFP-VPS13A (835–1700)FWGATCTCTCGAGGGGGCGGCTCTGAAGATGATTCAGAGGAG
RevGGCCGGGATCCAAGAAACCACATTTTTAAAGTCTTTG
GFP-VPS13A (855–1700)FWATGAGCTCGAGGGGGCGGCCTTCAGTTTCCAACTGGAGTTAAA
RevGGCCGGGATCCAAGAAACCACATTTTTAAAGTCTTTG
GFP-VPS13A (2003–2606)FWTTCTGCAGTCGACGGTACTTCAGTCCCACTGTCTGTTTACG
RevTCAGTTATCTAGATCCGGTGGGTTAGGCGAACCGGAACATTAGTGTCC
GFP-VPS13A (2615–3174)FWTTCTGCAGTCGACGGTACTCTGCAGCCGCATGTAATAGC
RevTCAGTTATCTAGATCCGGTGTCAGAGGCTCGGAGAAGGTTCTCTTG
VPS13A-GFP ΔFFATFWAAGATGATTCAGAGGAGAGTCCCTTGGAAGAACCTC
RevGAGGTTCTTCCAAGGGACTCTCCTCTGAATCATCTT
GST-VPS13A (2–854/D845A)FWTCAGAGGAGGAATTTTTTGCTGCACCATGTAGTCCCTTG
RevCAAGGGACTACATGGTGCAGCAAAAAATTCCTCCTCTGA
his VAP-AFWCCAGCCACATATGATGGCGTCCGCCTCAGGGGCCATG
RevGGCAGGAGCGGATCCCTACAAGATGAATTTCCCTAGAAAGAATCC
GST-VPS13A (2-835)FWATGCTAGTCGACTGTTTTCGAGTCGGTGGTCGTG
RevGGTATAGCGGCCGCACAGATGGAAGTTCCAAGAGAGG
GST-VPS13A (2-854)FWATGCTAGTCGACTGTTTTCGAGTCGGTGGTCGTG
RevATTTAAGCGGCCGCAGGTTCTTCCAAGGGACTACATG
GST-VPS13A (835–1700)FWGCACTGGAGTCGACTTCTGAAGATGATTCAGAGGAG
RevCCGGAAGCGGCCGCAAGAAACCACATTTTTAAAGTC
FFAT domain onlyFWTCGACTGAATTTTTTGATGCACCATGTGC
RevGGCCGCACATGGTGCATCAAAAAATTCAG
GFP VAP-AFWAGGCCGGAATTCTCAAAATATGATGGCGTCCGCCTCAG
RevGCTTCCTTTCGGGCTTTG
mCherry VAP-AFWATTGGCTCCGGATATATGATGGCGTCCGCCTCAG
RevATTCCGCTCGAGGCTTCCTTTCGGGCTTTG

Generation of VPS13A KO cell line

Request a detailed protocol

Human VPS13A gene was targeted via a CRISPR/Cas9 approach (Ran et al., 2013) using guide sequence GACGTGTTGAACCGGTTCTT in exon 1, positions + 25 to+44 of VPS13A cDNA. Oligonucleotides HsA01-01t-F (5’-CACCGACGTGTTGAACCGGTTCTT-3’) and HsA01-01t-R (5’-AAACAAGAACCGGTTCAACACGTC-3’) were annealed and used to replace the BbsI 22nt-fragment in the single-guide RNA (sgRNA) sequence of plasmid pSpCas9(BB)−2A-Puro (PX459), also expressing the Streptococcus pyogenes Cas9 nuclease and the puromycin resistance gene, to obtain the targeting plasmid 48139-HsA01-01t. MRC5 cells (150,000 per well in 6-well plate) were grown in complete medium as described above and transfected with the targeting plasmid (2.5 µg per well) using TurboFect transfection reagent (Fermentas) (2 µl per µg DNA) according to manufacturer’s instructions. Puromycin selection (3 µg / ml) was applied for two days, starting one day after transfection. The remaining cells were then washed, collected by trypsinization, diluted and seeded in 15 cm culture dishes with complete medium without puromycin. Colonies were picked after two weeks and cells were expanded in normal growing conditions. To detect VPS13A knock-out clones, these cells were characterized by Western blotting (see Figure 5—figure supplement 12) to analyse the expression levels of endogenous VPS13A protein. Clone #4, (full name: MRC5-SV2_A01-01t_A2b), with no detectable VPS13A signal, was selected for further experiments.

Immunoblotting

Request a detailed protocol

Fly heads were processed as described before (Vonk et al., 2017). Cells were homogenized by sonication in 2x Laemmli buffer containing urea (Sigma) and DTT (Sigma) to a final concentration of 0.8M and 50 mM respectively. Afterwards the homogenates were boiled at 99°C for 5 min. The indicated proteins were separated with 8% polyacrylamide gels and overnight wet transfer, or on 10% or 12% mini protean TGX stain-free gels (Bio-Rad). Stain-free gels were activated and imaged with the ChemiDoc imager (Bio-Rad) before transfer to PVDF membranes using the Trans Blot Turbo System (Bio-Rad). The membranes were blocked in 5% fat free milk for 1 hr at room temperature and rinsed in PBS-Tween 20. Incubations with primary antibodies were done overnight at 4°C followed by incubations with secondary antibodies for 1.5 hr at room temperature. The following primary antibodies were used: anti-ATP5A (Abcam, 1:1000), anti-DRP1 (to detect total DRP) Cell Signaling 1:500), anti-p(hospho)DRP1 ser616 (Cell signaling, 1:1000), anti-GAPDH (Fitzgerald 1:10,000), anti-GFP (Clontech 1:1000), anti-GST (Santacruz Biotechnology, 1:1000), anti-EGFR (Santacruz Biotechnology, 1:1000), anti-LAMP1 (Abcam, 1:1000), anti-Myc (Enzo Life Sciences, 1:1000), anti-PLIN2 (Abcam, 1:1000), anti-Rab7 (Abcam, 1:1000), anti-TOMM20 (BD biosciences 1:1000), anti-α tubulin (Sigma, 1:5000), anti-VAP-A (Santa Cruz Biotechnology, 1:1000), anti-VAP-B (Sigma, 1:1000), anti-VPS13A (Sigma,1:1000), anti-VPS13A (H-102) (Santa Cruz Biotechnology, 1:500), Drosophila VPS13A #62 (Vonk et al., 2017), VPS13C (Sigma). Membranes were developed using ECL reagent (Thermo Fisher Scientific) and the signal was visualized using the ChemiDoc imager (Biorad), images exported as. tiff files and densitometric analysis of band intensities was performed using ImageJ software.

Immunofluorescence

Request a detailed protocol

For fixed samples, cell were seeded in Poly-L-Lysine coated (Sigma-Aldrich) cover slips and allowed to settle for 24 hr. Afterwards the cells were fixed with 3.7% formaldehyde or 4% paraformaldehyde (Sigma Aldrich) for 20 min, washed briefly with phosphate-buffered saline (PBS) + 0.1% Triton-X-100 (Sigma Aldrich) and permeabilized with PBS + 0.2% Triton-X-100. The slides with cells were then incubated with primary antibody (anti-TOMM20, 1:200; anti-Myc, 1:500; anti-FLAG, 1:500) at 4°C overnight and after an additional washing step in PBS + 0.1% Triton-X-100 probed with matching secondary antibodies (Molecular Probes) for two hours at room temperature (RT). The cell nucleus was detected by DAPI staining (0.2 µg/ml) (Thermo Fischer Scientific). Finally the samples were mounted in 80% glycerol and analysed with one of the confocal microscopes listed below.

For LipidTox staining, cells were fixed as described above, then quenched for 10 min in 50 mM NH4Cl in PBS, permeabilized for 5 min with 0.1% Triton x-100 in PBS followed by incubation with LipidTox dye (Thermo Fischer Scientific 1:200) for 30 min at room temperature. Cells were mounted using citifluor mounting medium (Agar Scientific) and imaged immediately. Mitotracker (Thermo Fischer Scientific) was added for 20 min in serum free medium at a concentration of 100 nM (for live) and 200 nM (for fixed) cells, after which the cells were fixed and co-stained as described above.

For Live imaging procedures, cells were seeded in 35 mm glass bottom dishes coated with poly-D-lysine (Mat Tek). BODIPY-FA (Thermo Fischer Scientific) 1 µM was added for 30 min (live). Live cell recordings (600 ms/frame) were made using a DeltaVision confocal microscope. Prior to imaging, the cage was allowed to reach 37°C and cells were supplemented with 5% CO2 throughout the entire recording. Images were deconvoluted by the SoftwoRx software and stored as movies.

Cytosol and membrane fractionation

Request a detailed protocol

Around 4–5, 90% confluent, T75 flasks of HeLa cells were scraped in ice cold PBS and resuspended in 1 ml homogenization buffer HB (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, Protease inhibitor cocktail (Roche)). The cell suspension was lysed through 2 freeze-thaw cycles and 20 strokes using a 27 gauge needle. The nuclei and intact cells were pelleted by centrifugation for 5 min at 800 g, and the resulting postnuclear supernatant (PNS) was applied to ultracentrifugation at 100,000 x g, for 1 hr, using a TLA 100.3 rotor in a Beckman Coulter, to generate the cytosol and the membrane fraction. The membrane fraction was washed in 1 ml of HB and centrifuged 1 hr at 100,000 x g. All centrifuge steps were carried out at 4 degrees. Laemmli sample buffer was added to the cytosol and membrane fractions, samples were quantified and 20 µg of proteins of each sample were loaded on SDS-gel and processed for Western blot analysis.

Digitonin based subcelullar fractionation

Request a detailed protocol

Digitonin extraction of cytosolic proteins was performed according to (Holden and Horton, 2009). Briefly, HEK293T cells were cultured in 5 cm dishes. When about 70% confluent, cells were collected by trypsinization, washed with ice cold PBS and resuspended in 5 ml of digitonin buffer (150 mM NaCl, 50 mM HEPES PH = 7.4, 25 ug/ml digitonin, protease inhibitor cocktail (Roche)). After rolling the suspension for 10 min at 4 degrees, the tube was centrifuged at 2000 x g for 5 min. The supernatant was collected as cytosolic fraction. The pellet was washed once with cold PBS and resuspended in 5 ml of NP-40 buffer (150 mM NaCl, 50 mM HEPES PH = 7.4, 1% NP-40, protease inhibitor cocktail (Roche)). After rolling the suspension for 30 min at 4 degrees, the tube was centrifuged at 7000 x g for 5 min. The supernatant was collected as membrane fraction. All centrifuge steps were carried out at 4 degrees. Both the cytosolic and membrane fractions underwent TCA precipitation and equal amounts of proteins were processed for immunoblotting as described above.

Membrane extraction

Request a detailed protocol

The membrane fractions (after digitonin extraction) were resuspended in HB (control), 1M KCl, 0.2M sodium carbonate (pH 11) or 6M urea for 45 min shaking on ice, and then centrifuged at 4 degrees, 100,000 x g for 1 hr, using a TLA 100.3 rotor in a Beckman Coulter, obtaining soluble (supernatant) and insoluble (pellet) fractions. Laemmli sample buffer was added to the insoluble and soluble fractions, samples were quantified and 20 µg of proteins of each sample were loaded on SDS-gel and processed for Western blot analysis.

Subcellular fractionation

Request a detailed protocol

For subcellular fractionation around 5–6, 90% confluent, T75 flasks of HeLa cells were scraped in ice cold PBS and resuspended in 1 ml of homogenization buffer HB1 (50 mM Tris HCl pH 7,5, 150 mM NaCl, 1 mM EDTA, Protease inhibitor, 0.25 M sucrose). The cell suspension was homogenized as previously described (see cytosol and membrane fractionation) to obtain PNS. The PNS was then loaded onto a 10 ml continuous sucrose gradient containing 5–55% (w/v) in HB1, and was spun at 4 degrees at 274, 000 x g for 4 hr using a swinging bucket SW41 rotor in a Sorvall Discovery 90se. Gradient fractions of 0.5 ml were collected from top to bottom. The proteins in each fraction were concentrated using trichloroacetic acid (TCA) precipitation and resuspended in 75–100 μl of sample buffer. All the procedures were performed on ice. Equal volume of each fraction was loaded onto SDS-gel and processed for Western blot analysis.

Immunoprecipitation

Request a detailed protocol

HeLa cells were washed once with ice cold PBS and then scrapped into ice cold PBS. After centrifugation the cells were resuspended in immunoprecipitation buffer (IB) (50 mM Tris HCl, 150 mM NaCl, 1 mM EDTA, 1.5 mM MgCl2, 10 mM KCl, 1% Triton X-100, pH 7.6) supplemented with protease inhibitor cocktail (Roche). Cells were then snap frozen in liquid nitrogen twice and in between passed through a 26 gauge needle, 10 strokes. The resulting homogenate was spun down at 10,000 x g for 10 min, the supernatant was recovered and subjected to overnight immunoprecipitation using indicated antibodies or control IgG of the same host. Immunoprecipitates were enriched on agarose beads (Santa Cruz) at 4 degrees for 1.5 hr. Protein A/G plus agarose beads (Santa Cruz) were gently washed with IB and resuspended in 2x Laemmli buffer containing DTT and urea and processed for immunoblotting as described above. Co-immunoprecipitation using GFP-Trap beads (Chromo Tek) was done according to manufactures instructions.

In vitro protein-protein interaction

Request a detailed protocol

GST-tagged protein coding plasmids were transformed in E.coli BL21 and bacteria was grown overnight in 1 liter Luria Broth (LB) medium. When the bacteria suspension reach the OD600 of 0.6 protein expression was induced using IPTG 1 mM for 4 hr. Cells were pelleted by centrifugation at 5000 x g for 15 min and lysed by sonication in 40 ml lysis buffer (LB) (50 mM Tris HCl, PH +7.5, 150 mM NaCl, 5% glycerol, 0.1% Triton S-100, 1 mM PSMF, protease inhibitor cocktail (Roche)). Debris was removed by centrifugation at 4000 x g for 15 min and the clean supernatant was mixed with 1 ml glutathione beads (GE healthcare), incubated for 2 hr at 4 degrees. Beads were washed with LB 3 times. For protein-protein interaction assays, a bacterial lysate that contains His-VAP-A or HeLa cell lysate was added to the GST-VPS13A enriched beads and incubated at 4 degrees overnight. Beads were gently washed with LB and resuspended in 2x laemmli buffer containing DTT and urea, incubated for 5 min at 99°C and processed for immunoblotting as decribed above.

Splics

Request a detailed protocol

Cells were transfected as described (Cieri et al., 2018). Briefly, 48 hr after transfection cells were fixed as described above and stained with DAPI. A z-stack covering the cell was acquired using a Leica SP8 confocal microscope. Z-stacks were processed using ImageJ with the VolumeJ plugin (http://bij.isi.uu.nl/vr.htm). The image was then used to count ER-mitochondria contact sites.

Mitochondria morphology

Request a detailed protocol

Mitochondria were scored according to (Rambold et al., 2011). Briefly, 80% confluent cells were washed once with HBSS and incubated for 16 hr in HBSS or normal medium at 37°C + 5% CO2. The cells were stained with TOMM20 as describe above and mitochondrial morphology was scored in three types as follows and partly based on (Rambold et al., 2011) : type 1; fragmented, mainly small and round mitochondria, mainly localized and densely packed at one site of the nucleus; type 2; intermediate, mixture of round densely packed and shorter tubulated mitochondria more surrounding the nucleus; and type 3; tubulated dispersed and long mitochondria..

Mitophagy

Request a detailed protocol

Mitophagy was performed as previously described (Narendra et al., 2008). Briefly, MRC5 control and clone 4 cells were transfected with FLAG-parkin. 24 hr post transfection the cells were treated with 20 µM CCCP (Sigma) or DMSO for 48 hr. Cells were labelled with anti-TOMM20, anti-FLAG and stained with DAPI. To correct for transfection efficiency, the TOMM20 mean value was measured exclusively in Parkin-positive cells using ImageJ.

LD fractionation

Request a detailed protocol

HeLa cells were collected by trypsinization and washed once with PBS. After centrifugation, cell pellets were resuspended in detergent free homogenizing buffer (50 mM Tris HCl, 150 mM NaCl, 1 mM EDTA, 1.5 mM MgCl2, 10 mM KCl, PH 7.6) supplemented with protease inhibitor cocktail. Cells were snap frozen in liquid nitrogen 3 times and in between passed through a 26 gauge needle 20 strokes. Nucleus and unbroken cells were removed by spinning down at 1600 x g for 5 min. The supernatant was recovered and mixed with equal volumes of 0.25M sucrose in homogenizing buffer. After saving an input, the sample was loaded on top of a discontinuous sucrose gradient prepared by layering 1 ml of 30%, 20%, 10% and 5% sucrose in SW55 ultracentrifuge tube. The gradient was centrifuged at 4 degrees for 3 hr at 194,000 x g, using an ultracentrifuge in a Sorvall discovery 90se. The tubes were carefully removed and 8 fractions of 600 µl were collected from top to bottom. 600 µl of the top fraction containing LDs were collected using a 20 µl pipette with a tip cut off. The refractive index of each fraction was measured and correlated to the linearity of the sucrose concentration throughout the tube. The bottom part containing the pellet was resuspended with buffer to a final volume of 600 µl and was neither included in the refractive index measurement nor in the quantification of protein distribution among gradients. Proteins from each fraction were precipitated using the TCA precipitation method. Equal amounts of proteins were processed for immunoblotting as described above. The amount of protein in each fraction was calculated as a ratio of the densitometric signal in each fraction to the sum of the total protein in fractions 1–8 (Protein per fraction (%)=densitometric signal of a fraction/sum of total densitometric signal (1-8) x 100)

FACS analysis

Request a detailed protocol

Cells were collected by trypsinization, centrifuged and washed and resuspended in 200 µL PBS with Nile Red stock solution diluted to 1:500. Cells were incubated at room temperature for 15 min. After incubation the cells were washed with PBS and resuspended in 300 µl PBS. Finally, the cells were measured on a FACScalibur (BD) and analyzed with FlowJO V10. For this experiment the mean fluorescence intensity of ~10,000 cells was analyzed.

Fly stocks and genetics

Request a detailed protocol

Fly stocks were maintained and experiments were done at 25°C on standard agar food unless indicated otherwise. The Vps13{PB}c03628 stock (here referred to as Vps13) was acquired from the Exelixis stock centre and isogenized to the w1118 stock (Vonk et al., 2017). The UAS-hVPS13A expressing Drosophila line in the Vps13 mutant background has previously been described in Vonk et al., 2017. For the rescue experiment two stocks were created, Vps13/CyO; Act-Gal4/TM6B and Vps13/CyO, UAS-hVPS13A, and mated to produce the offspring listed in Figure 9 (homozygous or heterozygous Vps13 mutant flies expressing or not expressing UAS-hVps13A ubiquitously under the control of Act-Gal4).

Whole mount staining of fly retinas

Request a detailed protocol

LD staining of adult fly retinas was performed as described previously (Liu et al., 2015). Images of male flies are shown (Figure 9), female flies were also stained and showed a comparable phenotype.

Mitochondria membrane fractionation

Request a detailed protocol

Fractionation studies were performed as described previously (Sugiura et al., 2017; Mattie et al., 2018). Briefly, cells were seeded in 10 × 14,5 cm dishes and when 90% confluent, were scraped into ice cold PBS after a wash step with PBS. After centrifugation they were resuspended in 5 ml homogenization buffer HB2 (30 mM Tris-HCL pH 7.4, 225 mM mannitol, 75 mM sucrose). The cell suspension was then lysed using a 27 gauge needle (20 strokes). Afterwards it was centrifuged at 1000 x g for 10 min, transferred to a new tube an spun again at 1000 x g for 5 min. The postnuclear supernatant (PNS) was transferred and spun for 15 min at 8000 x g, the cytosolic and membrane fraction at 100,000 x g for 30 min, using a TLA 100.3 rotor in a Beckman Coulter Centrifuge, to separate the two fractions. The membrane fraction was then washed with HB2 and centrifuge 100,000 x g for 30 min.

After centrifugation the pellet for the PNS was resuspended in mitochondria resuspending buffer MRB (250 mM mannitol, 5 mM HEPES pH 7.4, 0,5 mM EGTA) and passed through a 27 gauge needle once. It was centrifuged for 15 min at 8000 x g then the mitochondria resuspended in 1 ml MRB. Half of the sample was usedfor proteinase K treatment and the other half for the alkaline carbonate extraction (see below).

For Proteinase K treatment different concentrations (as indicated in Fig X) of proteinase K (Fermentas) were added to the mitochondria either with or without 2% Triton X-100 and incubated on ice for 30 min.

For Alkaline carbonate extraction the mitochondria were centrifuged at 8000 x g for 5 min, resuspended in 0,1 M Na2CO3. They were then incubated for 30 min on ice, vortexed every 10 min and finally centrifuged at 100,000 x g for 30 min. All centrifuges steps were done at 4 degrees. Proteins from each fraction were precipitated using the TCA precipitation method. Equal amounts of proteins were processed for immunoblotting as described above.

Hardware/software used for imaging/image work

Request a detailed protocol

Confocal images were collected by

  • DeltaVision confocal microscope (Applied Precision) fitted with 60x or 100x oil immersion objective. Images from the Delta Vision microscope were deconvolved by the SoftwoRx software (Applied Precision) and saved as movies or exported as. tiff files using ImageJ (NIH). The Delta Vision was used for: Figure 2 (A-C/E), 3 (D), 4 (E/E’), 6 (A-C), 7 (D/D’), 8 (E/E’), S3 (D), S4 (B/B’).

  • Leica SP8 confocal laser scanning microscope fitted with a 63x oil immersion objective and images were exported as. tiff files using the Leica software. The Leica SP8 was used for: Figure 3 (A/B), 5 (A/B/C’), 8 (A/A’), S1 (C-F’), S3 (B-C).

  • Zeiss 780 NLO confocal microscope fitted with a 40x oil immersion objective +optical zoom. Zeiss Zen software was used to capture the images and export them as. tiff files. The Zeiss 780 was used for: Figures 3 (C) and 9 (A-D’’’).

ImageJ (NIH) was used for quantifying LDs (Figure 8B and D), mean gray intensity (Figure 5D), line scan (Figure 2C”, E and 6C’), SPLICS with volumeJ plugin (Figure 5A’, B’), lipid movement (Figure 8F,H) and colocalization with JACoP plugin (Figure 4—figure supplement 3).

Adobe Photoshop and Illustrator (Adobe Systems Incorporated, San Jose, California, USA) were used for image manipulation (changing intensity and cropping of images) and image assembly as well as creating the schematics.

Statistical analysis

Request a detailed protocol

All experiments are presented as mean of at least three independent experiments ± SEM, unless stated otherwise in the legends. Statistical significance was determined by a two-tailed unpaired Student’s t test where applicable. Statistical P values ≤ 0.05 were considered significant (*p≤0.05, **p≤0.01, ***p≤0.001). Data were analysed using GraphPad Prism (GraphPad Software, San Diego, CA, USA)

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
    Recessive mutations in >VPS13D cause childhood onset movement disorders
    1. J Gauthier
    2. IA Meijer
    3. D Lessel
    4. NE Mencacci
    5. D Krainc
    6. M Hempel
    7. K Tsiakas
    8. H Prokisch
    9. E Rossignol
    10. MH Helm
    11. LH Rodan
    12. J Karamchandani
    13. M Carecchio
    14. SJ Lubbe
    15. A Telegrafi
    16. LB Henderson
    17. K Lorenzo
    18. SE Wallace
    19. IA Glass
    20. FF Hamdan
    21. JL Michaud
    22. GA Rouleau
    23. PM Campeau
    (2018)
    Annals of Neurology, 83, 10.1002/ana.25204, 29518281.
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
    The physics of lipid droplet nucleation, growth and budding
    1. AR Thiam
    2. L Forêt
    (2016)
    Biochimica Et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 1861:715–722.
    https://doi.org/10.1016/j.bbalip.2016.04.018
  82. 82
  83. 83
  84. 84
  85. 85
    In Neuroacanthocytosis Syndromes II
    1. A Velayos-Baeza
    2. C Lévecque
    3. C Dobson-Stone
    4. AP Monaco
    (2008)
    Springer Berlin Heidelberg.
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92

Decision letter

  1. Agnieszka Chacinska
    Reviewing Editor; University of Warsaw, Poland
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands
  3. Hugo J Bellen
    Reviewer; Baylor College of Medicine, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.]

Thank you for submitting your work entitled "Human VPS13A is associated with multiple organelles and required for lipid droplet homeostasis" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Hugo J Bellen (Reviewer #1). The other reviewers remain anonymous.

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

As you will see from the original reviews, the reviewers found your findings interesting but not fully developed in terms of mechanisms and not fully convincing. One of the reviewers was more enthusiastic about this work, especially the part focused on cell biology, that seems to be closer to be worked out than the organismal part. Overall, there is a good agreement that in the current version the story is not ready to be revised for eLife.

Reviewer #1:

In this manuscript, Yeshaw et al., explore the subcellular localization and function of VPS13A in vivo and in vitro using mammalian cells. They show that VPS13A is a membrane associated protein that also associates with VAPA via its FFAT domain and that it responds to metabolic stimuli by altering its localization from mitochondria to lipid droplets. Loss of VPS13 also induces LD formation. They also present data that indicate LD accumulation in glial cells in flies in which the sole VPS13 gene is knocked down. Though the findings presented here are interesting they do not rise to a paper for eLife. The data raise numerous questions that remain unanswered and the authors do not try to tackle the molecular mechanisms that may underlie LD accumulations

1) Why are glia affected and not neurons or other cells in flies whereas the authors study show LD accumulations/increase in non glial cells in mammalian cells when Vps 13 is decreased? How do they tie these observations? Also, how do they know that the cells that accumulate LD are glia? Are they reminiscent of glia, as stated? The TEM quality does not seem to establish that these are glia. They can look in the eye where the glial cells are easy to identify (pigment cells). Why is LD production enhanced when Vps 13 is lost? What pathway is affected? JNK? Is ROS elevated?

2) What is the interplay between the ER, Vps13 and LD formation?

3) What happens when Vap A is lost? To my knowledge LD have never been documented when VapA or B or both are lost or overexpressed. Has this been missed in the past? How does this tie in with their observations? Is VapB not involved? VapA and B are typically redundant.

4) What are the proposed molecular mechanisms that underlie the observed degeneration? Is the demise of neurons related to the LD accumulation in glia or is it independent? Is this a primary or secondary defect? Is there elevated ROS that causes the production of peroxidated lipids and LD formation when Vps 13 is lost? Is mitochondrial function impaired? Complex 1/complex 3?

I understand that the authors cannot answer all these questions but there is no attempt to explore any of these avenues and much of the data remain therefore descriptive.

Specific comments:

The switching back and forth between two metabolically different cell lines makes the data difficult to interpret and the images are not on par with other publications that examine ER mitochondria contact sites.

In the Introduction, the authors noted that "the cellular localization and function of VPS13A is largely unknown". However, VPS13A has been identified via mass spec to be localized and associated with the mitochondria (https://www.ncbi.nlm.nih.gov/pubmed/28441135), lipid droplets (https://www.ncbi.nlm.nih.gov/pubmed/21870882) and ER in mammalian cells (human and others).

In Figure 2D, no portion of the VAP13A protein is shown to overlap with sec61B. However, in Figure 3B, full length VPS13A colocalizes with sec61B. Can the authors speculate ?

Figures 3 B and C are not of publication quality and it is impossible to tell whether VPS13A is at the ER-mitochondrial contact sites or just present in both organelles. Also, another panel showing the overlap of BFP-sec61B and mitotracker is necessary to show that these two do not colocalize.

Colocalization analysis (as done in Figure 2B') would be useful for all of these subsequent images where only a single image is shown. Moreover, a quantification of colocalization based on many cells would further support the author's claim.

In comparing Figure 5A and 5B, VPS13A is larger in 5B – are these images taken at the same magnifications? Moreover, Nile Red is fluorescent in both the red and green channels and should not be used in conjunction with any imaging in the 488 channel. The authors should use BODIPY495 instead.

In Figure 5A and 5B, 100% of VPS13A is not found as a ring (as in Figure 2B) but shown to be colocalized with lipid droplet markers. Are these images taken as a stack as opposed to a single slice? What accounts for this difference? Moreover, what percentage is a small percentage ? and are these cells undergoing cell death?

In comparing Figure 6G and 7A, where two different cell types are used to study the relationship between VPS13A and lipid droplets, supplementing HEK cells with oleate leads to less LD compared to un-supplemented U20S cells with a mock transfection. This metabolic difference between these cells raises the question whether conclusions can be drawn about VPS13A localization and function in relation to metabolic changes.

For all quantifications, please provide the number of cells quantified and number of biological replicates.

Is there a loss of mitochondria-ER contact sites in the VPS13A mutant fly brains?

The authors argue that VPS13A is translocating from the mitochondria to LD upon oleate induction. However, since the authors show that VPS13A is also on the ER membrane and LDs originate from the ER membrane, what arguments can the authors provide against an ER origin of VPS13A present on LD?

Finally, an ER association of VPS13A would also explain how LDs are "stabilized" when associated with VPS13A – LDs associated with VPS13A may still be tethered to the ER membrane.

Reviewer #2:

This manuscript by Yeshaw et al. reports the investigation of VPS13A. The authors main claims are that this protein localizes to a contact between mitochondria and ER that is modulated by Ca++. Furthermore, they report localization to cytoplasmic lipid droplets (LDs), especially when cells are incubated in medium containing fatty acids. Consistent with this localization the authors claim a phenotype on LDs in cells and Drosophila brain.

Despite increasing interest, the molecular functions of the very large Vps13 proteins are still somewhat enigmatic and progress in this area is in principle interesting, also because mutations in different family members are associated with human disease.

In my assessment however, the experimental data presented in this manuscript are not conclusive and ultimately there is very limited solid progress. In particularly, while the authors claim an important function in LD homeostasis, the data presented in the paper suggest a very minor role at best. For these reasons, I do not believe this work is suitable for publication in eLife. The most important points upon which this conclusion is based are listed below:

1) Localization by microscopy is entirely based on overexpressed proteins. While it is possible that these experiments report the localization of the endogenous proteins, this is not sufficient as it is easy to see how overexpression would lead to a pool of protein that is mis-localized. The authors provide some fractionation data, but those data are not very clear in terms of the subcellular organelle where Vps13A localizes and by itself would not be sufficient to conclude on the localization of the protein.

2) The argument for regulation of ER-Mitochondrial localization is really based on one experiment of thapsigargin treatment, in which alternative explanations, e.g. due to indirect effects of the treatment, are equally likely as a Ca++ effect.

3) While I believe it’s likely that Vps13A interacts with VAP, the data presented is minimal and most experiments have next to no controls.

4) The authors claim the protein's localization can switch to LDs. How these two different localizatios are achieved and or regulated is unclear.

5) The authors claim VPS13A is important for LD homeostasis. However, the phenotype observed is mild at best and the characterization lacks even the most basic analyses (e.g. lipid content of the cells, localization of other LD proteins). In addition some of the measurements have problems (some of the values for LD sizes seem to be below the resolution of the light microscope). Moreover, in these experiments, the other Vps13 isoforms are not considered; overall this is a very preliminary analyses, and if anything, suggests a minor role in LD function at best.

6) The phenotype in Drosophila is interesting but also not comprehensively analyzed; only some EMs are shown. The authors would have to provide at least TG and other lipid measurements, and some evidence (e.g. by IF and light microscopy) that the structures observed are LDs.

Reviewer #3:

Yeshaw and colleagues have explored the potential role of VPS13A a member of a small family of 4 related proteins and which is mutated in the neurological disorder Chorea Acanthocytosis. The gene encodes a very large cytosolic/membrane associated protein with conserved Chorein, DUF and ATG domains. Like for other family members, little is known about the exact role of VPS13A. Most knowledge is gathered through KD or KO strategies in different model systems, leading to the conclusion that VPS13A has a multitude of cellular functions. The authors explored here in more detail the localization and subcellular functional dynamics in cellular models. They demonstrate that VPS13A is involved in (and localizes to) membrane contacts between the ER and mitochondria; this interaction is calcium dependent and mediated through interaction of the FFAT domain with VAP-A, which they explored using mutational analysis. They further show that upon fatty acid addition, VPS13A is released from the ER and associates, in a FFAT-domain independent way, with lipid droplets. Functionally, VPS13A appears to affect LD size and its association with LDs slows their motility. The effects of VPS3 deficiency on LD appearance were finally validated in a mutant fly model using EM. Overall, the cell and molecular biology is of high quality and the authors make a major contribution to the potential role(s) of this VPS13 member, albeit the full mechanism and physiological importance with respect to the clinical phenotype in ChAc is not strongly revealed. A major concern remains the validation of the cellular data in mutant flies. The fly has only one VPS13 orthologue while in mammals, four variants are known, all with different functions (for instance the VPS13C has opposite effects on LDs compared to VPS13A) and links to very distinct diseases. It follows that the phenotype of the mutant fly cannot be correlated to the function of a specific variant, while the authors actually do that. A possible way to address this is to rescue the mutant fly with each human VPS13 variant and test to what extent they all rescue the phenotype or only certain features. In the best case, the common function among all VPS13 forms could be identified in this way. After all, to what extent is the observed cellular phenotype (smaller, more mobile LDs) correlated with the mutant fly phenotype (larger LDs)?

Specific comments that should be addressed:

Figure 1C-D: the authors explore the membrane association of VPS13A using chemical agents. It suprises me why they don't use 'golden standard' approaches using bicarbonate, or detergents like TX114-phase partitioning or other that more selectively extract associated proteins.

Figure 2 and Figure 2—figure supplement 1: Truncated forms of VPS13A are used to show that the C-terminus is required for mitochondrial association. The authors refer to Figure 2—figure supplement 1 to state that the C-terminal region localized to the mitochondria in different cell lines: this is an overassumption as Figure 2D and Figure 2—figure supplement 1 only shows a co-staining of an ER marker with truncated VPS13A, not with a mitochondrial marker. Also the localization of the C-terminus is very different between different cell lines (compare A with C for instance: can the authors exclude that in A-B these structures are not other compartments like LDs?). The only evidence is in fact Figure 2B and 2E (triple staining). Small remark: the yellow arrow is not on the right position in panel A, merged inset.

Figure 4E: same remark. Since only a co-staining with an ER-marker, VAP-A, is shown, one cannot conclude from these panels that VPS13AdeltaFFAT is shifted from ER to mitochondrial localization. Given that VPS13A can also locate to LDs, a triple staining or dual staining with a mitotracker and higher resolution (zoomed insets) is needed.

Figure 5C: these data show the relocation of GFP-VPS13A to LDs upon addition of OA. However these seem to be snapshots at different time points from different regions of the coverslip. Hence, the last sentence of this paragraph, 'Live-cell imaging showed that newly formed LDs… gradually acquired VPS13A…', is an overstatement as not the same LD is followed in time. Furthermore, one cannot deduce from these panels nor from the video that GFP-VPS13A goes to newly formed LDs, but instead associates/dissociates from existing LDs. Data in Figure 7E and Video 3 are also not really supporting this. To experimentally test this, probes like LiveDrop should be used as these mark the earliest stages of LD formation from the ER. Furthermore, is GFP-VPS13A recruited to LDs from nearby ER-mito contacts as this would suggest a more intricate association of ER-mito contacts with LD formation?

Figure 6: Using cell fractionation, the authors show that OA induces a shift of VPS13A to the floating LD fraction. The quantification shows clearly a trend but are these increases statistically significant (B-B' and D-D')? This is important since VAP-A also increases indicating at least some contamination? Some antibodies also give multiple bands: specific bands to PLIN2 and LAMP1 should be more clearly indicated to interpret the data. The authors have also used two concentrations of OA (250 and 500µM). While panel 6F shows the dose-dependent increase in VPS13A with LDs (using imaging), this is less obvious for the biochemical (flotation gradients) data. In fact, there is little difference when looking at the relative shifts of VPS13A and PLIN2 between 250 and 500µM.

Figure 7: In some cases, like in this figure the authors switch to U2OS cells. Why? I would also include a zoomed inset for panel D: the shifts in frame 1 vs frame 2 are difficult to discern. Also these images do not really allow to distinguish large from small LDs (they seem in both wt and siRNA to be overall small). Better images are needed that clearly demonstrate the point the authors are making. In addition, instead of measuring% overlap, it might be better to measure 'distance travelled' as a readout for mobility (and thus to show differences). The conclusion of this paragraph is also overstated: 'In the absence of VPS13A' should be 'When VPS13A is downregulated'. Did the authors generate CRISPR/Cas9 KO cells of VPS13A and if so, are the phenotypes worse?

In some of the panels with confocal data, the images seem to be moved or shifted. For instance in Figure 2—figure supplement 1C, the Rab5QL enlarged endosomes have a suspicious double membrane and the Rab7QL endosomes look fuzzy. Another example is Figure 7A where each dot is a little stripe as this is a timelapse (or like a picture of the night sky with long opening time).

In the Discussion section the authors refer to the work of the Bellen lab to state that LDs are formed in glia cells in response to oxidative stress. In the meantime, they published a follow-up paper on a non-cell autonomous mechanism which should be included (Liu et al., 2017) and may help to explain (the differences with) the observed phenotype.

[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]

Thank you for resubmitting your work entitled "Human VPS13A is associated with multiple organelles and influences mitochondrial morphology and lipid droplet motility." for further consideration at eLife. Your revised article has been favorably evaluated by Anna Akhmanova (Senior Editor), a Reviewing Editor, and three reviewers.

The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:

Overall, the reviewers are satisfied and they note the value of the paper, also in the light of currently emerging publications on Vps13. However, they agree that some of the aspects still need strengthening. Specifically and most importantly, the reviewers are not yet fully convinced by the data concerning a putative switch from ER-mito to ER-LDs. There is a general agreement that this switch is not sufficiently substantiated. The authors could still address this with their current data by quantifications and providing controls.

Furthermore, in the light of recent publications please make sure to avoid the statements concerning an "unknown function" of Vps13, such as the one in the Introduction.

https://doi.org/10.7554/eLife.43561.037

Author response

[Editors’ note: the author responses to the first round of peer review follow.]

We are happy to resubmit our thoroughly revised manuscript. We have performed all the experiments requested by the reviewers and added new ones to further strengthen the message of our study.

In the final stage of this experimental work (August 2018), we noticed that the Journal of Cell Biology published a manuscript by Kumar et al., “VPS13A and VPS13C are lipid transport proteins differentially localized at ER contact sites”. Although partly overlapping with our present manuscript, this JCB paper confirms exactly the VPS13A localization we presented in our original submission in January 2018, and therefore strengthens it. Furthermore, our original biochemical studies we presented to validate VSP13A subcellular localization are not presented in the JBC manuscript.

In addition, we now also report a clear mitochondrial phenotype observed in a VPS13 knock- out cell line that we have generated by the CRISPR/CAS9 system (as suggested by reviewer 3) and we report a lipid droplet phenotype in the Drosophila Vps13 mutant eye (as suggested by reviewer 1 and 2). This phenotype is rescued by expression of human VPS13A in the Drosophila mutant background (as suggested by reviewer 3).

Taken together, as mentioned above, there is overlap between the two manuscripts (immunofluorescence localization of VPS13A) and the parts that overlap are perfectly in agreement. Please note that there are also large non-overlapping parts.

Moreover, the manuscript by Kumat et al. and our work together, reveal an emerging role for VPS13A in lipid transfer at membrane contact sites that when defective leads to a mitochondrial and lipid droplet phenotype.

We addressed all comments raised by the reviewers in the revised version.

As reviewer 1 proposed, we used the fly eye, in which glia cells can easily be identified, to investigate a lipid droplet phenotype observed upon Vps13 loss of function. We now demonstrate that in these cells lipid droplet numbers are increased, consistent with our observations in mammalian cells. Following the suggestion of reviewer 3, we now show that this fly phenotype is rescued by overexpression of human VPS13A. This demonstrates a functional conservation of VPS13A in lipid droplet biology between humans and flies. As suggested by reviewer 1, we discuss these findings in light of the VPS13A- associated neurodegenerative disease. Last, because we agree that the electron microscopy data need more investigation, we have removed them from the revised manuscript.

Using SPLICS assays (to determine contact sites between ER and mitochondria) we now show that the VPS13A KO cells, that we generated, show a significant decrease in ER-mitochondria contact sites. This therefore further suggests a role for VPS13A in maintaining these contact sites.

Using the VPS13A KO cells, we now show evidence for impairment of mitophagy and increased mitochondria fragmentation when compared to control cells.

We also show that VPS13A is needed for the mitochondria elongation that normally occurs upon starvation. In VPS13A KO cells mitochondria fail to elongate, and we demonstrate that phosphorylation on Ser616 of Drp1 is increased in VPS13A KO cells, indicating an increased mitochondria fission in line with the phenotype previously mentioned.

Last, we present a model merging our new data with those of the recent JCB manuscript.

Reviewer #1:

In this manuscript, Yeshaw et al., explore the subcellular localization and function of VPS13A in vivo and in vitro using mammalian cells. They show that VPS13A is a membrane associated protein that also associates with VAPA via its FFAT domain and that it responds to metabolic stimuli by altering its localization from mitochondria to lipid droplets. Loss of VPS13 also induces LD formation. They also present data that indicate LD accumulation in glial cells in flies in which the sole VPS13 gene is knocked down. Though the findings presented here are interesting they do not rise to a paper for eLife. The data raise numerous questions that remain unanswered and the authors do not try to tackle the molecular mechanisms that may underlie LD accumulations

In the revised version we were able to answer more questions. This is possible because of the critical questions and comments raised by the reviewers, because of additional experiments we performed and because of two recently published manuscripts in JCB (Kumar et al., 2018 and Bean et al., 2018) while our manuscript was under revision. All together the molecular mechanism of VPS13A is tackled substantially. In addition increased understanding is obtained about the phenotype caused by absence of VPS13A protein from results obtained from a newly generated VPS13A knock-out cell line. We have rewritten our manuscript now in such a manner to make this clear. The changes are visible via track changes.

1) Why are glia affected and not neurons or other cells in flies whereas the authors study show LD accumulations/increase in non glial cells in mammalian cells when Vps 13 is decreased? How do they tie these observations? Also, how do they know that the cells that accumulate LD are glia? Are they reminiscent of glia, as stated? The TEM quality does not seem to establish that these are glia. They can look in the eye where the glial cells are easy to identify (pigment cells).

We agree with this reviewer that the TEM experiments are not explored to its full extend. As suggested, we have now examined a possible phenotype of lipid droplets in Drosophila eyes using fluorescent imaging of lipid droplets, visualized by Nile red and imaged with light microscopy as suggested by reviewer 2. For this we used a validated Drosophila homozygous Vps13 mutant. Drosophila Vps13 is a gene orthologous to human Vps13A and to Vps13C (Velayos-Baeza, A. et al., 2004). In the pigment (glia) cells of the eye an increase in lipid droplets is observed in homozygous Vps13 mutants, which are absent in control flies and in mutant flies upon overexpression of human VPS13A (as reviewer 3 suggested). These results are provided as well as a Western blot showing the expression of human VPS13A and the absence of Drosophila Vps13 in Drosophila Vps13 mutants. These data are provided in the revised version as Figure 9.

Why is LD production enhanced when Vps 13 is lost? What pathway is affected? JNK? Is ROS elevated?

2) What is the interplay between the ER, Vps13 and LD formation?

4) What are the proposed molecular mechanisms that underlie the observed degeneration? Is the demise of neurons related to the LD accumulation in glia or is it independent? Is this a primary or secondary defect? Is there elevated ROS that causes the production of peroxidated lipids and LD formation when Vps 13 is lost? Is mitochondrial function impaired? Complex 1/complex 3?

I understand that the authors cannot answer all these questions but there is no attempt to explore any of these avenues and much of the data remain therefore descriptive.

In the revised version we provide possible answers to most of these questions in the discussion. The answers came from our newly added data further underscoring a lipid droplet phenotype and demonstrating a mitochondrial phenotype in VPS13A depleted cells. We combine our new data with data presented in two recently published manuscripts about human VPS13A (Kumar et al., 2018) and yeast Vps13 (Bean et al., 2018). We have combined our findings and the findings of the two JCB manuscripts in a model, presented in Figure 10 of the revised version.

We have changed the discussion thoroughly to make this all more clear in a comprehensive manner.

3) What happens when Vap A is lost? To my knowledge LD have never been documented when VapA or B or both are lost or overexpressed. Has this been missed in the past? How does this tie in with their observations? Is VapB not involved? VapA and B are typically redundant.

We are not sure but we assume that reviewer 1 means that it would be of interest to show the link between VAPA/B and lipid droplets? We agree with this, however, we like to stress that we do not show or claim a link between lipid droplets and VAP-A. We present two different observations 1) VPS13A is localized at ER-Mito contact points and 2) VPS13A is localized at lipid droplets. The FFAT domain of VPS13A binds to VAP-A and we now also demonstrate that VPS13A binds to VAP-B as well (Figure 4—figure supplement 3C). This underscores the statement of reviewer 1 that indeed VapA and B are most likely redundant in VPS13A mediated functions. In case the reviewer means that it is of interest to see what happens with the localization of VPS13A in the absence of VAP-A, we would like to refer to one of the results by Kumar et al., 2018 in which the localization of VPS13A was investigated when VPS13A is overexpressed in VAP-A KO cells,. Under these conditions the localization of VPS13A shifts from an ER localization to a more mitochondrial localization pattern. This result is in agreement with our results demonstrating that VPS13A binds to VAP-A and thereby creates a localization in close association with the ER. We refer to these results in the discussion.

Specific comments:

The switching back and forth between two metabolically different cell lines makes the data difficult to interpret and the images are not on par with other publications that examine ER mitochondria contact sites.

We used HeLa cells and HEK293 cells for the biochemical studies. We initiated our work with HeLa cells and later also used HEK293 cells. For the biochemical studies we did not see a difference between the two cell lines in the experiments in which we compared the two. For a subtype of localization studies we used HEK293 cells, because in our hands they gave better transfection efficiency compared to HeLa cells. We now left out all siRNA experiments with the U2OS cells and we added instead data with a MCR5 parental cell line (control) and a newly generated MCR5 VPS13A KO cell line. We used U2OS cells for some of the imaging studies, especially for co-localization studies, because in these cells the morphology of the ER and the mitochondria results in clearer pictures. We now clearly indicate in the Materials and methods section, main text and figure legends which cell types were used for which experiments. In addition, we improved all images of all the figures of the main text, except, Figure 7G (lipid droplets association with VPS13A) and Figure 8F (stills from in vivo imaging of lipid droplet movement).

In the Introduction, the authors noted that "the cellular localization and function of VPS13A is largely unknown". However, VPS13A has been identified via mass spec to be localized and associated with the mitochondria (https://www.ncbi.nlm.nih.gov/pubmed/28441135), lipid droplets (https://www.ncbi.nlm.nih.gov/pubmed/21870882) and ER in mammalian cells (human and others).

Our point was that VPS13A was never localized using immunofluorescence. When our manuscript was submitted in 2017 this was the case. Now the situation is different (Kumar et al., 2018). We have rephrased our text to make this clear, we have included these references and we mention that our results are in agreement with the JBC manuscript.

In Figure 2D, no portion of the VAP13A protein is shown to overlap with sec61B. However, in Figure 3B, full length VPS13A colocalizes with sec61B. Can the authors speculate ?

This observation can be explained because overexpression of the full length VPS13A induces increased ER-mitochondria interaction (as demonstrated by Kumar at al., 2018) and as a result an overlap with sec61B can be observed. We now mention in the discussion this result of Kumar et al. The FFAT motif is required, but not enough, for interaction with VAP-A and ER localization (Figure 4E in the revised version). Thus, it seems that full length VPS13A, or at least fragments bigger than those analyzed here (shown in Figure 2), may be required for ER localization (overlapping signal with sec61B).

Figures 3 B and C are not of publication quality and it is impossible to tell whether VPS13A is at the ER-mitochondrial contact sites or just present in both organelles. Also, another panel showing the overlap of BFP-sec61B and mitotracker is necessary to show that these two do not colocalize.

Colocalization analysis (as done in Figure 2B') would be useful for all of these subsequent images where only a single image is shown. Moreover, a quantification of colocalization based on many cells would further support the author's claim.

We now have provided better quality images and have indicated more clearly what is co-localizing and what is not co-localizing and what is in close association. In the revised version in Figure 3A we now demonstrate that the VPS13A and VAP-A signal is similar and overlaps, as indicated by the yellow signal in the overlay image. In Figure 3B we show that VPS13A does not 100% co-localize with mitochondria, but the VPS13A signal is closely associated with the boundaries of the mitochondrial marker mitotracker. Figure 3B shows that VPS13A is not present in mitochondria, but localized to the periphery of mitochondria. in vivo imaging results (Video 2 and Figure 3D) show that VPS13A is not present in the ER but is localized in close association with the ER. Our localization studies are verified by the newly added mitochondrial fractionation data (Supplementary Figure 2). VPS13A also partly co-localizes with BFP-Sec61B, the overlapping signal is indicated with white arrowheads in Figure 3B. We now also show, as the reviewer requests, that BFP-Sec61B does not co-localize with Mitotracker Red, but is detected at some spots in close association with Mitotracker Red. Those localizations are positive for VPS13A as well, indicated with white arrowheads in Figure 3B. Our localization studies are in agreement with Kumar et al., 2018.

In comparing Figure 5A and 5B, VPS13A is larger in 5B – are these images taken at the same magnifications? Moreover, Nile Red is fluorescent in both the red and green channels and should not be used in conjunction with any imaging in the 488 channel. The authors should use BODIPY495 instead.

The Nile red image is removed and LipidTox is now used for all the LD stainings, except for FACS analysis.

In Figure 5A and 5B, 100% of VPS13A is not found as a ring (as in Figure 2B) but shown to be colocalized with lipid droplet markers. Are these images taken as a stack as opposed to a single slice? What accounts for this difference? Moreover, what percentage is a small percentage ? and are these cells undergoing cell death?

This difference is due to a difference in magnification used and the size of the lipid droplets under investigation. We would like to note that the original Figure 2 is a still from a live cell while 5A and 5B (now removed) were fixed preps. We have made this now clearer in the revised manuscript. When lipid droplets are small, the VPS13A ring-like structure is not visible, appearing more like dots, but when lipid droplets are large the VPS13A positive ring-like structure can be visualized. This can be seen in Figure 6B at 120’ after OA addition. Some lipid droplets are large and show a ring-like positive VPS13A signal. This can be visualized upon zooming in our original images (although maybe not in the merged pdf file created after submission). This is now better explained in the text. The small percentage has been rephrased now as follows:” In addition to a localization at areas were mitochondria and the ER are in close proximity we observed that VPS13A is also observed in a punctate and vesicular-shaped pattern.

These vesicular-like structures did not represent mitochondria (Video 1).” Upon close examination, most cells seem to contain small numbers of lipid droplets which, upon expression of full length VPS13A-GFP, are positive for GFP as well. Under control culturing conditions, HEK293 cells seem to only contain a few (1-2) lipid droplets per cell and these are not visible in every focal plane of the images. Therefore the reticular structure (mitochondria-ER contact sites) is usually always captured in an image when full length VPS13A-GFP is visualized, but the same is not true for the ring-like structures (lipid droplets).

In comparing Figure 6G and 7A, where two different cell types are used to study the relationship between VPS13A and lipid droplets, supplementing HEK cells with oleate leads to less LD compared to un-supplemented U20S cells with a mock transfection. This metabolic difference between these cells raises the question whether conclusions can be drawn about VPS13A localization and function in relation to metabolic changes.

For all quantifications, please provide the number of cells quantified and number of biological replicates.

The U2OS cells are replaced with MRC5 cells, which we also used as the parental cell line to create a VPS13A KO by CRISPR/Cas9. Now, we do not compare different cell lines in the revised version. We have the numbers of cells for this quantification and will include in the legend. We have removed the quantification of the amount of lipid droplets after oleic acid (OA) in the various cells. We only compare the amount of lipid droplets under normal conditions in control MCR5 cells and in the MCR5 VPS13A KO cells and we found an increase in lipid droplets in the KO. We use OA to induce lipid droplet formation and we demonstrate that, under those conditions of increased lipid droplet formation, VPS13A is more enriched in the lipid droplet fraction. In a separate file we added for each experiment the number of cells quantified and the biological replicates. Upon request we can add these data to the Figure legends.

Is there a loss of mitochondria-ER contact sites in the VPS13A mutant fly brains?

The authors argue that VPS13A is translocating from the mitochondria to LD upon oleate induction. However, since the authors show that VPS13A is also on the ER membrane and LDs originate from the ER membrane, what arguments can the authors provide against an ER origin of VPS13A present on LD?

We have now rephrased this argument. We observe in cells that the VPS13A is localized in a reticular pattern and is residing at places where mitochondria and ER are in close contact. VPS13A is also localized at the surface of the scarcely found lipid droplets under control culturing conditions. When OA is added to the medium, lipid droplets are present in increasing amounts and we observed that VPS13A is localized pronouncedly at the surface of these lipid droplets. Biochemical experiments under these altered conditions demonstrate that VPS13A is getting enriched in the lipid droplet fraction. We do not state in the revised version that relocation of VPS13A from ER-mitochondria to lipid droplets does occur, but in the discussion we argue that this may occur. In combination now with the manuscripts in JCB by Kumar et al. and by Bean et al., we favor an adjusted model consistent with the observations of our data and these 2 recently published VPS13-related manuscripts. This is explained and discussed extensively in the discussion.

Finally, an ER association of VPS13A would also explain how LDs are "stabilized" when associated with VPS13A – LDs associated with VPS13A may still be tethered to the ER membrane.

This is indeed possible and demonstrated by the recent report by Kumar et al., where VPS13A is shown to be present at the ER-LD contact sites. This indeed may explain our observation that LDs move less when VPS13A is present because of their attachment via VPS13A to the ER. All this is now combined in the discussion and in our revised model (Figure 10).

Reviewer #2:

This manuscript by Yeshaw et al. reports the investigation of VPS13A. The authors main claims are that this protein localizes to a contact between mitochondria and ER that is modulated by Ca++. Furthermore, they report localization to cytoplasmic lipid droplets (LDs), especially when cells are incubated in medium containing fatty acids. Consistent with this localization the authors claim a phenotype on LDs in cells and Drosophila brain.

Despite increasing interest, the molecular functions of the very large Vps13 proteins are still somewhat enigmatic and progress in this area is in principle interesting, also because mutations in different family members are associated with human disease.

In my assessment however, the experimental data presented in this manuscript are not conclusive and ultimately there is very limited solid progress. In particularly, while the authors claim an important function in LD homeostasis, the data presented in the paper suggest a very minor role at best. For these reasons, I do not believe this work is suitable for publication in eLife. The most important points upon which this conclusion is based are listed below:

1) Localization by microscopy is entirely based on overexpressed proteins. While it is possible that these experiments report the localization of the endogenous proteins, this is not sufficient as it is easy to see how overexpression would lead to a pool of protein that is mis-localized. The authors provide some fractionation data, but those data are not very clear in terms of the subcellular organelle where Vps13A localizes and by itself would not be sufficient to conclude on the localization of the protein.

In the revised version new data is included to show endogenous VPS13A under control culturing conditions is peripherally attached to mitochondria (Figure 2, Figure 3—figure supplement 3). We do believe that the binding of VPS13A via its FFAT domain to VAP-A and VAP-B is convincing. We also now include experiments with a VPS13AΔFFAT construct, which does not co-immunoprecipitate VAP-A and VAP-B (Figure 4F, Supplementary Figure 4C). In addition the SPLICS data (Figure 5) show an involvement of VPS13A in contact sites between ER and mitochondria. Our data are in agreement with the recent manuscript by Kumar et al. in which also overexpression studies were used as well as endogenous- tagged VPS13A for localization studies. Together with our localization data and our biochemical experiments we feel there is now substantial evidence for our reported subcellular localization of VPS13A at ER-mitochondria contact sites and at lipid droplets.

2) The argument for regulation of ER-Mitochondrial localization is really based on one experiment of thapsigargin treatment, in which alternative explanations, e.g. due to indirect effects of the treatment, are equally likely as a Ca++ effect.

We also now have added experiments in which VPS13A depletion is inducing a decrease in ER- mitochondria contact sites by using split-GFP-based contact site sensor (SPLICS) engineered to fluoresce when organelles are in proximity (Figure 5). Kumar et al., 2018 demonstrated that overexpression of VPS13A induces an increase in ER-mitochondria contact sites. Together these data suggest that VPS13A is indeed able to influence ER-mitochondria contact sites.”

3) While I believe it’s likely that Vps13A interacts with VAP, the data presented is minimal and most experiments have next to no controls.

To further support our claims, we included co-immunoprecipitation data that shows VPS13A interacts with both VAP-A and VAP-B in an FFAT dependent manner (Figure 4F, supplementary Figure 4C). FFAT-dependent interaction between VPS13A and VAP-A was also demonstrated by Kumar et al., using immunolocalization studies overexpressing constructs harboring mutations in the FFAT domain and by using VAP-A-KO cells and investigate the localization of VPS13A overexpression in these cells.

4) The authors claim the protein's localization can switch to LDs. How these two different localizatios are achieved and or regulated is unclear.

We have now modified the manuscript and mention that there are two VPS13A localization patterns: VPS13A localizes at ER-Mitochondria contact sites and at the lipid droplets. Whether and how these two patterns interact is not clear. Under control conditions there are only a few lipid droplets present in the cells, so the lipid droplet vesicular pattern is only observed in some cells and a few VPS13A-positive circular structures are visible. When cells contain more lipid droplets, VPS13A is decorating the majority of them. Based on our data we cannot conclude whether this enrichment of VPS13A at lipid droplets is due to protein relocation or to a de novo synthesis. We can conclude that there is an enrichment of VPS13A associated with lipid droplets because there are more lipid droplets. This is confirmed by the fractionation studies (Figure 7) demonstrating that the lipid droplet fraction is enriched in VPS13A protein after addition of oleic acid (OA). The mechanism behind this enrichment could be explained by the presence of adaptor proteins at the surface of lipid droplets which compete for binding to VPS13A. Organelle membrane specific VPS13 adaptors competing for VPS13 binding have been found in yeast (Bean et., 2018). It could therefore be possible that human lipid droplets contain a VPS13A specific adaptor protein recruiting VPS13A to lipid droplets when they have been formed. We now combine all this information in our new model explained in the discussion and presented in Figure 10.

5) The authors claim VPS13A is important for LD homeostasis. However, the phenotype observed is mild at best and the characterization lacks even the most basic analyses (e.g. lipid content of the cells, localization of other LD proteins). In addition some of the measurements have problems (some of the values for LD sizes seem to be below the resolution of the light microscope). Moreover, in these experiments, the other Vps13 isoforms are not considered; overall this is a very preliminary analyses, and if anything, suggests a minor role in LD function at best.

To show differences in LD numbers, we have now replaced the data with LD number quantifications from VPS13A KO cells and their parental control cells. We also added data obtained in Drosophila eyes as suggested by reviewer 1, a phenotype rescued by overexpression of VPS13A in the mutant background. The increase in lipid droplets in human VPS13A KO cells is consistent with the increase in the Drosophila Vps13 mutant. We have removed the lipid droplet size measurements. We changed our text in such a way that we do not claim differences in lipid droplet homeostasis/metabolism. We do conclude that the number of lipid droplets is increased and that lipid droplet motility is negatively influenced by VPS13A. We discuss that the increase in lipid droplet numbers could be explained by decreased lipid droplet turnover.

6) The phenotype in Drosophila is interesting but also not comprehensively analyzed; only some EMs are shown. The authors would have to provide at least TG and other lipid measurements, and some evidence (e.g. by IF and light microscopy) that the structures observed are LDs.

We now have removed the EM data and have included instead IF and light microscopy analysis of Drosophila mutant eye in which lipid droplets are visualized using Nile red (Figure 9), as suggested by reviewer 1.

Reviewer #3:

Yeshaw and colleagues have explored the potential role of VPS13A a member of a small family of 4 related proteins and which is mutated in the neurological disorder Chorea Acanthocytosis. The gene encodes a very large cytosolic/membrane associated protein with conserved Chorein, DUF and ATG domains. Like for other family members, little is known about the exact role of VPS13A. Most knowledge is gathered through KD or KO strategies in different model systems, leading to the conclusion that VPS13A has a multitude of cellular functions. The authors explored here in more detail the localization and subcellular functional dynamics in cellular models. They demonstrate that VPS13A is involved in (and localizes to) membrane contacts between the ER and mitochondria; this interaction is calcium dependent and mediated through interaction of the FFAT domain with VAP-A, which they explored using mutational analysis. They further show that upon fatty acid addition, VPS13A is released from the ER and associates, in a FFAT-domain independent way, with lipid droplets. Functionally, VPS13A appears to affect LD size and its association with LDs slows their motility. The effects of VPS3 deficiency on LD appearance were finally validated in a mutant fly model using EM. Overall, the cell and molecular biology is of high quality and the authors make a major contribution to the potential role(s) of this VPS13 member, albeit the full mechanism and physiological importance with respect to the clinical phenotype in ChAc is not strongly revealed. A major concern remains the validation of the cellular data in mutant flies. The fly has only one VPS13 orthologue while in mammals, four variants are known, all with different functions (for instance the VPS13C has opposite effects on LDs compared to VPS13A) and links to very distinct diseases. It follows that the phenotype of the mutant fly cannot be correlated to the function of a specific variant, while the authors actually do that. A possible way to address this is to rescue the mutant fly with each human VPS13 variant and test to what extent they all rescue the phenotype or only certain features. In the best case, the common function among all VPS13 forms could be identified in this way. After all, to what extent is the observed cellular phenotype (smaller, more mobile LDs) correlated with the mutant fly phenotype (larger LDs)?

As explained above, we now provide explanations for the observed lipid droplet phenotypes in the discussion and discuss how this could link to the VPS13A-associated disease. For this we use our added data in combination with the two recent VPS13-related manuscripts in JCB.

As suggested by reviewer 1 we have now analyzed Drosophila eyes and showed that Drosophila Vps13 mutants have increased amount of lipid droplets in pigment cells of the eye. This phenotype is rescued by overexpression of human VPS13A in the Drosophila mutant background, suggesting a conserved function of human VPS13A in regulation of numbers of lipid droplets. The fly data are consistent with the phenotype observed in the now added analysis of VPS13A KO cells which also show an increase in lipid droplet numbers. In flies, we did not analyze the motility of lipid droplets compared to control because hardly any lipid droplets were observed in Drosophila wild type eyes. The decreased lipid droplet motility when decorated with VPS13A in the human cells as presented in Figure 8E-H can be explained by the results recently obtained in Kumar et al., 2018, showing that the VPS13A signal and lipid droplets are in close association with the ER, it could be possible as we now propose in our model that the reduced motility is because there is more attachment to the ER. This explanation was already proposed by reviewer 1 and in the Kumar et al. manuscript evidence for this is presented.

Specific comments that should be addressed:

Figure 1C-D: the authors explore the membrane association of VPS13A using chemical agents. It surprises me why they don't use 'golden standard' approaches using bicarbonate, or detergents like TX114-phase partitioning or other that more selectively extract associated proteins.

For our membrane association studies we used slightly modified versions of published approaches (Holden and Horton, 2009; Mattie et al., 2018, Sugiura et al., 2017 and Vonk et al., 2017). We have now made this clearer in Materials and methods. We also include data that shows that VPS13A can be extracted with bicarbonate or can be cleaved with proteases from the mitochondrial surface (Figure 3—figure supplement 1).

Figure 2 and Figure 2—figure supplement 1: Truncated forms of VPS13A are used to show that the C-terminus is required for mitochondrial association. The authors refer to Figure 2—figure supplement 1 to state that the C-terminal region localized to the mitochondria in different cell lines: this is an overassumption as Figure 2D and Figure 2—figure supplement 1 only shows a co-staining of an ER marker with truncated VPS13A, not with a mitochondrial marker. Also the localization of the C-terminus is very different between different cell lines (compare A with C for instance: can the authors exclude that in A-B these structures are not other compartments like LDs?). The only evidence is in fact Figure 2B and 2E (triple staining). Small remark: the yellow arrow is not on the right position in panel A, merged inset.

Figure 2D is now replaced with new data to show the localization of VPS13A fragments to the mitochondria using the various constructs in combination with a mitochondrial marker in U2OS cells for optimal morphology (Figure 2E of the revised version). In addition, line scan co-localization analysis is also included for each set of GFP-VPS13A fragment and mitochondria.

We apologize for the confusion regarding the yellow arrow, this arrow is to indicate the direction and the position of the line scan, this is now indicated more clearly.

In different cell lines the morphology of the mitochondria is different, explaining the different localization patterns of the C-terminus construct in our original Figure 3—figure supplement 3. We agree that this is confusing and we now explain this better in the main text and in Figure 3—figure supplement 3B.

Figure 4E: same remark. Since only a co-staining with an ER-marker, VAP-A, is shown, one cannot conclude from these panels that VPS13AdeltaFFAT is shifted from ER to mitochondrial localization. Given that VPS13A can also locate to LDs, a triple staining or dual staining with a mitotracker and higher resolution (zoomed insets) is needed.

We like to note that mitochondria in HEK293 cells are not as filamentous as in other cell lines. In addition, VPS13A localization to lipid droplets is usually distinctively round (Video 1) unlike what is depicted in our original Figure 4E. We agree that this is confusing and we now explain this more clearly in the main text. We also have included new immunoprecipitation experiments that support the observation that VPS13AdeltaFFAT does not associate with the ER protein VAP-A. In addition, we now have added the requested localization studies comparing the expression of full length VPS13A with VPS13AdeltaFFAT in combination with a mitochondrial marker. This information is provided in Figure 4E and Figure 4—figure supplement 4B.

Figure 5C: these data show the relocation of GFP-VPS13A to LDs upon addition of OA. However these seem to be snapshots at different time points from different regions of the coverslip. Hence, the last sentence of this paragraph, 'Live-cell imaging showed that newly formed LDs… gradually acquired VPS13A…', is an overstatement as not the same LD is followed in time. Furthermore, one cannot deduce from these panels nor from the video that GFP-VPS13A goes to newly formed LDs, but instead associates/dissociates from existing LDs. Data in Figure 7E and Video 3 are also not really supporting this. To experimentally test this, probes like LiveDrop should be used as these mark the earliest stages of LD formation from the ER. Furthermore, is GFP-VPS13A recruited to LDs from nearby ER-mito contacts as this would suggest a more intricate association of ER-mito contacts with LD formation?

We have rephrased some statements and conclude that, under conditions of OA, VPS13A is enriched in the fraction containing lipid droplets; please see also our answer to reviewer 2 (for your convenience our answer is provided again below).

We have now modified the manuscript and mention that there are two VPS13A localization patterns: VPS13A localizes at ER-Mitochondria contact sites and at the lipid droplets. Whether and how these two patterns interact is not clear. Under control conditions there are only a few lipid droplets present in the cells, so the lipid droplet vesicular pattern is only observed in some cells and a few VPS13A-positive circular structures are visible. When cells contain more lipid droplets, VPS13A is decorating the majority of them. Based on our data we cannot conclude whether this enrichment of VPS13A at lipid droplets is due to protein relocation or to a de novo synthesis. We can conclude that there is an enrichment of VPS13A associated with lipid droplets because there are more lipid droplets. This is confirmed by the fractionation studies (Figure 7, Figure 7—figure supplement 2) demonstrating that the lipid droplet fraction is enriched in VPS13A protein after addition of oleic acid (OA). The mechanism behind this enrichment could be explained by the presence of adaptor proteins at the surface of lipid droplets which compete for binding to VPS13A. Organelle membrane specific VPS13 adaptors competing for VPS13 binding have been found in yeast (Bean et al., 2018). It could therefore be possible that human lipid droplets contain a VPS13A specific adaptor protein recruiting VPS13A to lipid droplets when they have been formed. We now combine all this information in our new model explained in the discussion and presented in Figure 10. (see also our answer to reviewer 1)

Figure 6: Using cell fractionation, the authors show that OA induces a shift of VPS13A to the floating LD fraction. The quantification shows clearly a trend but are these increases statistically significant (B-B' and D-D')? This is important since VAP-A also increases indicating at least some contamination? Some antibodies also give multiple bands: specific bands to PLIN2 and LAMP1 should be more clearly indicated to interpret the data. The authors have also used two concentrations of OA (250 and 500µM). While panel 6F shows the dose-dependent increase in VPS13A with LDs (using imaging), this is less obvious for the biochemical (flotation gradients) data. In fact, there is little difference when looking at the relative shifts of VPS13A and PLIN2 between 250 and 500µM.

VAP was also found to be present in lipid droplet fractions in proteomic studies (Cermelli et al., 2006), nonetheless, it is unclear whether this is a contamination or not. The enrichment of PLIN2 is indicative that indeed lipid droplet fractions were obtained, together with the knowledge that lipid droplets are present in the floating and lighter fractions and that lipid droplet numbers are strongly decreased under starvation conditions. We have indicated the specific PLIN2 band with an asterisk. The LAMP1 signal obtained with the antibody is visible as a smear in the higher fractions, but not in the lighter fractions; we do not have an explanation for this, it could be explained by post translational modifications of LAMP1.

Figure 7: In some cases, like in this figure the authors switch to U2OS cells. Why? I would also include a zoomed inset for panel D: the shifts in frame 1 vs frame 2 are difficult to discern. Also these images do not really allow to distinguish large from small LDs (they seem in both wt and siRNA to be overall small). Better images are needed that clearly demonstrate the point the authors are making. In addition, instead of measuring% overlap, it might be better to measure 'distance travelled' as a readout for mobility (and thus to show differences). The conclusion of this paragraph is also overstated: 'In the absence of VPS13A' should be 'When VPS13A is downregulated'. Did the authors generate CRISPR/Cas9 KO cells of VPS13A and if so, are the phenotypes worse?

The data in Figure 7A-C is now replaced with data obtained in VPS13A KO cells and presented in Figure 5 and Figure 8.

We like to note that we did not include the quantification of large lipid droplets versus small lipid droplets in the revised version, we focused now on the amount of lipid droplets in VPS13A depleted and VPS13A containing cells cultured under control conditions. The numbers of lipid droplets are increased in control culturing conditions in the newly generated VPS13A KO cells compared to the parental line. The phenotype is indeed stronger as compared to the results obtained with RNAi. An increase in the amount of lipid droplets in VPS13A KO cells is consistent with data obtained in the Drosophila Vps13 mutant eye (Figure 9). We provide an additional assay (Figure 8G and H) to visualize how VPS13A is influencing motility and a different read-out was used.

In some of the panels with confocal data, the images seem to be moved or shifted. For instance in Figure 1—figure supplement 1C, the Rab5QL enlarged endosomes have a suspicious double membrane and the Rab7QL endosomes look fuzzy. Another example is Figure 7A where each dot is a little stripe as this is a timelapse (or like a picture of the night sky with long opening time).

We have now adjusted these figures and provide better quality images.

In the Discussion section the authors refer to the work of the Bellen lab to state that LDs are formed in glia cells in response to oxidative stress. In the meantime, they published a follow-up paper on a non-cell autonomous mechanism which should be included (Liu et al., 2017) and may help to explain (the differences with) the observed phenotype.

We have adjusted the discussion dramatically, we included the Liu et al. Cell Met manuscript and believe a clearer picture is arising about what the role of VPS13A is and how VPS13A-associated neurodegeneration could arise.

[Editors' note: the author responses to the re-review follow.]

The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:

Overall, the reviewers are satisfied and they note the value of the paper, also in the light of currently emerging publications on Vps13. However, they agree that some of the aspects still need strengthening. Specifically and most importantly, the reviewers are not yet fully convinced by the data concerning a putative switch from ER-mito to ER-LDs. There is a general agreement that this switch is not sufficiently substantiated. The authors could still address this with their current data by quantifications and providing controls.

We agree that a putative switch from ER-mito to lipid droplets is not sufficiently substantiated. Therefore in contrast to our initial manuscript we do not claim this in the revised version, we discuss this possibility instead. We have now made more clear in the discussion that more experiments would be required to demonstrate a possible relocation of VPS13A from ER-mito to lipid droplets. We believe that quantification of our current data may not be enough to convincingly demonstrate this.

Furthermore, in the light of recent publications please make sure to avoid the statements concerning an "unknown function" of Vps13, such as the one in the Introduction.

We have changed this accordingly.

https://doi.org/10.7554/eLife.43561.038

Article and author information

Author details

  1. Wondwossen M Yeshaw

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3134-3458
  2. Marianne van der Zwaag

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  3. Francesco Pinto

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  4. Liza L Lahaye

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  5. Anita IE Faber

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Data curation, Investigation, Methodology
    Competing interests
    No competing interests declared
  6. Rubén Gómez-Sánchez

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Data curation, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8274-3259
  7. Amalia M Dolga

    Department of Molecular Pharmacology, Groningen Research Institute of Pharmacy (GRIP), Faculty of Science and Engineering, University of Groningen, Groningen, The Netherlands
    Contribution
    Data curation, Investigation, Methodology
    Competing interests
    No competing interests declared
  8. Conor Poland

    Wellcome Trust Centre for Human Genetics, Oxford, United Kingdom
    Contribution
    Conceptualization, Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  9. Anthony P Monaco

    1. Wellcome Trust Centre for Human Genetics, Oxford, United Kingdom
    2. Office of the President, Tufts University, Medford, United States
    Contribution
    Conceptualization, Data curation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  10. Sven CD van IJzendoorn

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Conceptualization, Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  11. Nicola A Grzeschik

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Conceptualization, Data curation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  12. Antonio Velayos-Baeza

    Wellcome Trust Centre for Human Genetics, Oxford, United Kingdom
    Contribution
    Conceptualization, Data curation, Funding acquisition, Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7717-4477
  13. Ody CM Sibon

    Department of Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
    Contribution
    Conceptualization, Data curation, Funding acquisition, Investigation, Writing—original draft, Writing—review and editing
    For correspondence
    o.c.m.sibon@umcg.nl
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6836-6063

Funding

Advocacy for Neuroacanthocytosis Patients

  • Anthony P Monaco
  • Antonio Velayos-Baeza

Wellcome (090532/Z/09/Z)

  • Antonio Velayos-Baeza

Nederlandse Organisatie voor Wetenschappelijk Onderzoek (865.10.012)

  • Ody CM Sibon

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We are grateful to F Reggiori and C Rabouille for their critical reading and helpful discussions. The authors acknowledge support from Wellcome Trust (090532/Z/09/Z) and Advocacy for Neuroacanthocytosis Patients to AV-B and APM, support from NWO (VICI 865.10.012) to OCMS.

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Agnieszka Chacinska, University of Warsaw, Poland

Reviewer

  1. Hugo J Bellen, Baylor College of Medicine, United States

Publication history

  1. Received: November 12, 2018
  2. Accepted: February 10, 2019
  3. Accepted Manuscript published: February 11, 2019 (version 1)
  4. Version of Record published: February 25, 2019 (version 2)

Copyright

© 2019, Yeshaw et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 2,624
    Page views
  • 597
    Downloads
  • 6
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    2. Genetics and Genomics
    Maja Kneissig et al.
    Research Article Updated
    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Adriana E Golding et al.
    Research Article Updated