scRNA-Seq reveals distinct stem cell populations that drive hair cell regeneration after loss of Fgf and Notch signaling
- Stowers Institute for Medical Research, United States
- Ciencias Biologicas, Ecuador
- Wellcome Sanger Institute, Wellcome Genome Campus, United Kingdom
- University of Cambridge, United Kingdom
Figures
Figure 1 with 1 supplement
Single cell RNA-Seq reveals support cell heterogeneity.
(A) Et(Gw57a) labels support cells with GFP. (B) Schematic of a cross section through a neuromast. (C) Heatmap showing the expression levels of the top 50 marker genes (y-axis) for each cluster …
Figure 1—video 1
Tg(prox1a:tagRFP;pou4f3:gfp) during regeneration.
A dividing prox1a-positive cell downregulates prox1a:tagRFP and upregulates the hair cell marker pou4f3:gfp.
Figure 2 with 2 supplements
Cycling cells characterize the amplifying and differentiating lineages.
(A) pcna labels all proliferating cells. (B) mcm4 labels cells that are replicating DNA early in the cell cycle. (C) cdk1 labels cells in late stages of the cell cycle. (D) Table of early and late …
Figure 2—figure supplement 1
t-SNE plot, cell cycle genes regressed out.
Cluster 4 (differentiating divisions) and cluster 3 cells (amplifying support cells) now cluster with central and D/V support cells, respectively (dashed lines).
Figure 2—figure supplement 2
Heatmap of human deafness genes that are expressed in homeostatic lateral line scRNA-Seq data.
https://doi.org/10.7554/eLife.44431.006
Figure 3 with 2 supplements
Organizing clusters along a putative path of development reveals amplifying and differentiating lineages.
(A) Dendrogram of cell clusters. Each branch point (node) is labeled. Genes enriched in each branch are shown in Supplementary file 7. (B, C) Genes selected from the node heatmaps show how some …
Figure 3—figure supplement 1
Heatmap of the expression of ribosomal protein genes in homeostatic lateral line cell scRNA-Seq data, reflecting transcriptional activity .
Cluster 13 is set aside because the relationships with cluster 13 cells is unclear. Heat bar shows log2 fold expression changes.
Figure 3—figure supplement 2
Still images of a video of prox1a:tagRFP-positive cells differentiating into pou4f3:gfp-positive hair cells.
https://doi.org/10.7554/eLife.44431.009
Figure 4 with 3 supplements
Dynamics of gene expression during hair cell differentiation.
(A–H) t-SNE plots of selected genes at different stages along the hair cell trajectory. Genes that show similar expression patterns are listed below the respective t-SNE plots. (I) Expression …
Figure 4—figure supplement 1
Cilia gene expression in young (cluster 2) and mature hair cell (cluster 1).
https://doi.org/10.7554/eLife.44431.011
Figure 4—figure supplement 2
Related to Figure 4: GO terms of genes down regulated in Hair Cell clusters 1 and 2.
https://doi.org/10.7554/eLife.44431.012
Figure 4—figure supplement 3
Notch signaling plays an essential role in inhibiting proliferation and maintaining support cell fates.
(A, B) Heatmap and t-SNE plots of Notch receptors, ligands, modulators (lfng, mfng, numb) and downstream targets (e.g. hey1, her4.1). hey1 is a good read out for Notch signal activation and is …
Figure 5 with 1 supplement
scRNA-seq reveals that fgf3 is expressed in central support cells and its downregulation enhances regeneration.
(A–H) Fgf pathway genes are expressed in 5dpf neuromasts. (A’–H’) Fgf pathway genes are downregulated 1 hr after hair cell death (post neo). (I and J) DASPEI staining of sibling (I) and fgf3-/- …
Figure 5—video 1
3D animation of a fgf3:H2B-mturquoise2 and pou4f3:gfp-expressing neuromast.
https://doi.org/10.7554/eLife.44431.015
Figure 6 with 1 supplement
Loss of fgf3-/- causes increased support cell proliferation during homeostasis and regeneration.
(A–B) Spatial analysis of amplifying (red squares), differentiation (green triangles) cell divisions and quiescent mantle cells (blue X’s) in sibling and fgf3-/- neuromasts during homeostasis. …
Figure 6—figure supplement 1
Expression of dnfgr1 also induces neuromast cell proliferation.
(A–B”) Spatial analysis of amplifying and differentiation cell divisions in hs sibling and hs:dnfgfr1 larvae during homeostasis. Clustering was analyzed with a Binomial distribution test, ****p<0.000…
Figure 7 with 1 supplement
scRNA-Seq analysis of fgf3 mutants identifies fgf3 targets.
(A) t-SNE plot depicting the integration of fgf3 mutant and sibling scRNA-Seq data sets. Sibling cells in blue, fgf3-/- cells in red. (B) Graph-based clustering of both fgf3 mutant and sibling data …
Figure 7—figure supplement 1
Selection of genes that are differentially expressed in fgf3 mutants.
(A) RT-qPCR with candidate genes identified in the fgf3-/- scRNA-Seq analysis. Error bar: SD, t-test, **p<0.01, ***p<0.001, and ****p<0.0001. (B) Heatmap of genes upregulated in fgf3 mutant lateral …
Figure 8
Fgf and Notch signaling largely act in parallel to inhibit Wnt-induced proliferation during homeostasis.
(A–D”) Spatial analysis of amplifying and differentiating cell divisions in sibling and fgf3-/- with or without dkk1 expression 24 hrs post neomycin. D/V clustering and directional bias to the …
Figure 9
Schematic of signaling pathway interactions in a homeostatic neuromast (modified after Romero-Carvajal et al., 2015).
Notch and fgf3 inhibit Wnt signaling in parallel in homeostatic neuromasts. The downregulation of Notch and Fgf signaling after hair cell death leads to the upregulation of Wnt signaling and …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. rerio) | ET(krt4:EGFP)SqGw57a | (Kondrychyn et al., 2011) | SqGw57a | |
| Genetic reagent (D. rerio) | Tg(pou4f3:GAP-GFP)s356t | (Xiao et al., 2005) | s356t; RRID:ZFIN_ZDB-GENO-100820-2 | |
| Genetic reagent (D. rerio) | fgf3t26212 | (Herzog et al., 2004) | t26212; RRID:ZFIN_ZDB-ALT-040716-16 | |
| Genetic reagent (D. rerio) | Tg(hsp70l:dkk11b-GFP)w32tg | (Stoick-Cooper et al., 2007) | w32tg; RRID:ZFIN_ZDB-GENO-100420-26 | |
| Genetic reagent (D. rerio) | Tg(hsp70l:MYC-notch1a,cryaa:Cerulean)fb12Tg | (Zhao et al., 2014) | fb12Tg; RRID:ZFIN_ZDB-ALT-140522-5 | |
| Genetic reagent (D. rerio) | Tg(hsp70l:dnfgfr1a-EGFP)pd1tg | (Lee et al., 2005) | pd1tg; RRID:ZFIN_ZDB-ALT-060322-2 | |
| Genetic reagent (D. rerio) | TgBAC(prox1a:KALTA4,4xUAS-ADV.E1b:TagRFP)nim5Tg | (van Impel et al., 2014) | nim5Tg; RRID:ZFIN_ZDB-ALT-140521-3 | |
| Genetic reagent (D. rerio) | Tg(EPV.Tp1-Mmu.Hbb:EGFP)um14 | (Parsons et al., 2009) | um14; RRID: ZFIN_ZDB-GENO-090626-1 | |
| Genetic reagent (D. rerio) | Et(krt4:EGFP)sqet4ET | (Parinov et al., 2004) | sqet4ET; RRID:ZFIN_ZDB-GENO-070702-7 | |
| Genetic reagent (D. rerio) | Et(krt4:EGFP)sqet20ET | (Parinov et al., 2004) | sqet20ET; RRID:ZFIN_ZDB-ALT-070628-20 | |
| Genetic reagent (D. rerio) | Tg(fgf3:H2B-mturquoise2)psi60Tg | This paper | psi60Tg | |
| Genetic reagent (D. rerio) | fgfr1asa38715 | This paper | sa38715; RRID:ZFIN_ZDB-ALT-161003-16150 | |
| Genetic reagent (D. rerio) | fgfr2sa30975 | This paper | sa30975; RRID:ZFIN_ZDB-ALT-160601-753 | |
| Antibody | Mouse monoclonal Anti-BrdU | Sigma Aldritch | 1170376001; RRID:AB_2313622 | IHC (1/200) |
| Antibody | Rabbit polyclonal Anti-GFP | Thermo Fisher Scientific | A11122; RRID: AB_10073917 | IHC (1/400) |
| Antibody | Alexa Fluor 568 Goat anti-mouse monoclonal | Thermo Fisher Scientific | A11004; RRID:AB_141371 | IHC (1/1000) |
| Antibody | Alexa Fluor 488 Goat anti-rabbit polyclonal | Thermo Fisher Scientific | A11034; RRID:AB_2576217 | IHC (1/1000) |
| Sequence based reagent | crRNA | IDT | GGCCATGGAAACTAAATCTG | |
| Peptide, recombinant protein | Cas9 | PNA Bio | CP01 | 1 μM |
| Commercial assay or kit | Chromium Single Cell 3' Library and Gel Bead Kit | 10X Genomics | 120267 | |
| Commercial assay or kit | SMART-Seq v4 Ultra Low Input RNA kit | Takara | 634888 | |
| Chemical compound, drug | BrdU | Sigma Aldritch | B9285 | 10 mM |
| Chemical compound, drug | EdU | Carbosynth | NE08701 | 3.3 mM |
| Chemical compound, drug | Neomycin sulfate | Sigma Aldritch | N6386 | 300 μM |
| Chemical compound, drug | Alexa Fluor-594 Azide | Thermo Fisher Scientific | A10270 | 2.5 μM |
| Chemical compound, drug | LY411575 | Selleckchem | S2714 | 50 μM |
| Software, algorithm | Cell Ranger (v1.3.1 WT data set; v2.1.1 for fgf3 data sets) | 10X Genomics | ||
| Software, algorithm | Seurat (v2.3.4) | (Butler et al., 2018) | ||
| Software, algorithm | Scanpy (v1.3.2) | (Wolf et al., 2018a) | ||
Additional files
-
Supplementary file 1
Related to Figure 1: excel file of genes that are expressed in at least three cells.
- https://doi.org/10.7554/eLife.44431.022
-
Supplementary file 2
Related to Figure 1E: excel file of cluster marker genes.
- https://doi.org/10.7554/eLife.44431.023
-
Supplementary file 3
Related to Figure 1E: t-SNE plots of all cluster marker genes.
- https://doi.org/10.7554/eLife.44431.024
-
Supplementary file 4
Related to Figure 2D: excel file of cell cycle genes.
- https://doi.org/10.7554/eLife.44431.025
-
Supplementary file 5
Related to Figure 2D: t-SNE plots of cell cycle genes.
- https://doi.org/10.7554/eLife.44431.026
-
Supplementary file 6
Related to Figure 2—figure supplement 2: excel file of zebrafish orthologs of human deafness genes.
- https://doi.org/10.7554/eLife.44431.027
-
Supplementary file 7
Related to Figure 3A: excel files of differentially expressed genes between nodes (dendrogram).
- https://doi.org/10.7554/eLife.44431.028
-
Supplementary file 8
Related to Figure 3A: heatmaps of dendrogram node genes.
- https://doi.org/10.7554/eLife.44431.029
-
Supplementary file 9
Related to Figure 4A–H: excel file of hair cell lineage genes.
- https://doi.org/10.7554/eLife.44431.030
-
Supplementary file 10
Related to Figure 4A–H: t-SNE plots of hair cell lineage genes.
- https://doi.org/10.7554/eLife.44431.031
-
Supplementary file 11
Related to Figure 4l: excel file of hair cell genes ordered along pseudotime.
- https://doi.org/10.7554/eLife.44431.032
-
Supplementary file 12
Related to Figure 4—figure supplement 1: excel file of cilia genes.
- https://doi.org/10.7554/eLife.44431.033
-
Supplementary file 13
Related to Figure 7: excel file of cluster markers in fgf3-/- scRNA-Seq.
- https://doi.org/10.7554/eLife.44431.034
-
Supplementary file 14
Related to Figure 7C, S9B: differentially expressed genes in the fgf3-/-.
- https://doi.org/10.7554/eLife.44431.035
-
Supplementary file 15
Primer table for RT-qPCR.
- https://doi.org/10.7554/eLife.44431.036
-
Supplementary file 16
Related to Figures 1, 2, 5, 7 and 8: primers used for in situ probes.
- https://doi.org/10.7554/eLife.44431.037
-
Transparent reporting form
- https://doi.org/10.7554/eLife.44431.038
