1. Neuroscience
Download icon

Light-at-night exposure affects brain development through pineal allopregnanolone-dependent mechanisms

  1. Shogo Haraguchi  Is a corresponding author
  2. Masaki Kamata
  3. Takuma Tokita
  4. Kei-ichiro Tashiro
  5. Miku Sato
  6. Mitsuki Nozaki
  7. Mayumi Okamoto-Katsuyama
  8. Isao Shimizu
  9. Guofeng Han
  10. Vishwajit Sur Chowdhury
  11. Xiao-Feng Lei
  12. Takuro Miyazaki
  13. Joo-ri Kim-Kaneyama
  14. Tomoya Nakamachi
  15. Kouhei Matsuda
  16. Hirokazu Ohtaki
  17. Toshinobu Tokumoto
  18. Tetsuya Tachibana
  19. Akira Miyazaki
  20. Kazuyoshi Tsutsui  Is a corresponding author
  1. Waseda University, Japan
  2. Showa University School of Medicine, Japan
  3. Kyushu University, Japan
  4. University of Toyama, Japan
  5. Shizuoka University, Japan
  6. Ehime University, Japan
Research Article
Cite this article as: eLife 2019;8:e45306 doi: 10.7554/eLife.45306
11 figures, 3 tables, 1 data set and 1 additional file

Figures

Light-at-night-induced disruption of diurnal variation of pineal ALLO synthesis during early life.

Diurnal changes in srd5a mRNA expression in the pineal gland under LD (a), LL (b), or light-at-night (c) conditions at P7 chicks (n = 10). ALLO synthesis (d) and concentration (e) in the pineal gland of ZT16 at P7 chicks (n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.002
Figure 1—source data 1

Source data for diurnal changes in srd5a mRNA expression, and ALLO synthesis and concentration in the pineal gland.

https://doi.org/10.7554/eLife.45306.003
Figure 2 with 3 supplements
Light-at-night-induced Purkinje cell death during early life.

(a–g) Male chicks were incubated under LD, LL, or light-at-night cycle for 1 week, and then, all groups were housed under LD cycle for 2 or 9 weeks (a). (b) The lobular structure of the whole cerebellum of chick. Scale bar, 3 mm. (c) Number of Purkinje cells expressing active caspase-3 in each lobule at P7 (n = 10). (d) Purkinje cells expressing active caspase-3 in lobule IV at P7. (e) Number of Purkinje cells in each lobule at P21 (n = 10). (f) Purkinje cells in lobule IV at P21. (g) Number of Purkinje cells in each lobule at P70 (young adult; n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.004
Figure 2—source data 1

Numbers of active caspase-3 positive cells, and Purkinje cells in male.

https://doi.org/10.7554/eLife.45306.010
Figure 2—figure supplement 1
Light-at-night-induced Purkinje cell death during early life in female.

Female chicks were incubated under LD, LL, or light-at-night cycle for 1 week, and then, all groups were housed under LD cycle for 2 weeks. (a) Number of Purkinje cells expressing active caspase-3 in lobule IV at P7 (n = 10). (b) Number of Purkinje cells in lobule IV at P21 (n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.005
Figure 2—figure supplement 1—source data 1

Numbers of active caspase-3 positive cells, and Purkinje cells in female.

https://doi.org/10.7554/eLife.45306.006
Figure 2—figure supplement 2
Effect of pineal ALLO on the thickness of the molecular layer.

Male chicks were incubated under LD, LL, or light-at-night cycle for 1 week, and then, all groups were housed under LD cycle for 2 weeks. The thickness of the molecular layer in lobule IV at P21 (n = 10).

https://doi.org/10.7554/eLife.45306.007
Figure 2—figure supplement 2—source data 1

Source data for the thickness of the molecular layer of Purkinje cells.

https://doi.org/10.7554/eLife.45306.008
Figure 2—figure supplement 3
Estimation plots of the effects of light-at-night on cerebellar Purkinje cells.

(a, b) The mean difference for two comparisons against the shared control LD are shown in the above Cumming estimation plot. The raw data are plotted on the upper axes. On the lower axes, mean differences are plotted as bootstrap sampling distributions. Each mean difference is depicted as a dot. Each 95% confidence interval is indicated by the ends of the vertical error bars. (c) The mean difference between LD and LAN is shown in the above Gardner-Altman estimation plot. Both groups are plotted on the left axes; the mean difference is plotted on a floating axes on the right as a bootstrap sampling distribution. The mean difference is depicted as a dot; the 95% confidence interval is indicated by the ends of the vertical error bar. LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.009
Light-at-night-induced Purkinje cell death was rescued by ALLO injection during early life.

(a) Male chicks were incubated under LD or light-at-night cycle for 1 week, and then, all groups were housed under LD cycle for 2 weeks. Half of the light-at-night chicks were treated with a daily injection of ALLO from P1 to P7. (b) Number of Purkinje cells expressing active caspase-3 in lobule IV at P7 (n = 10). (c) Number of Purkinje cells in lobule IV at P21 (n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.011
Figure 3—source data 1

Numbers of active caspase-3 positive cells, and Purkinje cells in male.

https://doi.org/10.7554/eLife.45306.012
Figure 4 with 2 supplements
Pineal ALLO prevented Purkinje cell death through mPRα in cerebellar Purkinje cells.

(a) Shown are the expressions of the α1-subunit of the GABAA receptor, mPRα, mPRβ, mPRγ, and PXR in the cerebellum of P1 chicks (similar results were obtained in repeated experiments using three different samples). (b–e) Number of Purkinje cells expressing active caspase-3 in lobule IV at P7 by receptor gene silencing as a candidate of the ALLO receptor in the cerebellar cortex at P1 (n = 10). (f) Immunohistochemistry of mPRα in the cerebellum of P1 chicks (similar results were obtained in repeated experiments using three different samples). (g) Representative saturation curve and Scatchard plot of specific [3H]-ALLO binding to plasma membranes of mPRα transfected cells (n = 4). (h) Structure of fluorescein-labeled ALLO. (i) Confocal images of mPRα-expressing cells stained with fluorescein-labeled ALLO under permeabilized conditions in the absence (upper panel) or presence (lower panel) of excess competing ALLO (similar results were obtained in repeated experiments using three different samples). ML, molecular layer; PCL, Purkinje cell layer; GCL, granule cell layer.

https://doi.org/10.7554/eLife.45306.013
Figure 4—source data 1

Numbers of active caspase-3 positive cells in male.

https://doi.org/10.7554/eLife.45306.016
Figure 4—figure supplement 1
Western blot analysis with the anti-goldfish mPRα antibody.

lane 1, brain protein. Lane 2, Extract of COS-7 cells that were transfected with the chicken mPRα cDNA.

https://doi.org/10.7554/eLife.45306.014
Figure 4—figure supplement 2
Synthetic scheme for the synthesis of the Fluorescein-labeled ALLO.
https://doi.org/10.7554/eLife.45306.015
Pineal ALLO-induced expression of PACAP, an endogenous neuroprotective factor, in cerebellar Purkinje cells.

(a) Shown are the effects of Px or Px plus ALLO on the expression of neuroprotective and neurotoxic factors (n = 10). (b) Diurnal changes in PACAP mRNA expression in the cerebellum under LD or light-at-night conditions in P7 chicks (n = 10). (c) Number of Purkinje cells expressing active caspase-3 in lobule IV at P7 (n = 10). (d) Number of Purkinje cells in lobule IV at P21 (n = 10). Immunohistochemistry of PACAP (e) and PAC1 (f) in the cerebellum of P1 chicks (similar results were obtained in repeated experiments using three different samples). Calbindin is used as a marker for Purkinje cells. ML, molecular layer; PCL, Purkinje cell layer; GCL, granule cell layer; LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.017
Figure 5—source data 1

source data for mRNA expressions (a), diurnal changes in PACAP mRNA expression (b), and numbers of Purkinje cells (c and d) in male.

https://doi.org/10.7554/eLife.45306.018
ALLO did not rescue Purkinje cells from death during the second week posthatch.

Male chicks were housed under LD cycle for 1 week during the first week posthatch. They were then incubated under light-at-night cycle and injected with ALLO or a solvent daily for 1 week during the second week posthatch. Finally, the chicks were housed under LD cycle for a week during the third week posthatch (a). (b) Number of Purkinje cells expressing active caspase-3 in lobule IV at P14 (n = 10). (c) Number of Purkinje cells in lobule IV at P21 (n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.019
Figure 6—source data 1

Numbers of active caspase-3 positive cells, and Purkinje cells in male.

https://doi.org/10.7554/eLife.45306.020
Neuroprotective effects of PACAP were not restricted during early life.

(a) Male chicks were incubated under LD or light-at-night cycle for 1 week during the first week posthatch and injected either with PACAP or solvent daily, and then, all groups were housed under LD cycle for 2 weeks during the second and third weeks posthatch. (b) Number of Purkinje cells expressing active caspase-3 in lobule IV at P7 (n = 10). (c) Number of Purkinje cells in lobule IV at P21 (n = 10). Male chicks were housed under LD cycle for 1 week during the first week posthatch and then incubated under light-at-night cycle and injected PACAP or solvent daily for 1 week during the second week posthatch. Finally, chicks were housed under LD cycle for 1 week during the third week posthatch (d). (e) Number of Purkinje cells expressing active caspase-3 in lobule IV at P14 (n = 10). (f) Number of Purkinje cells in lobule IV at P21 (n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.021
Figure 7—source data 1

Numbers of active caspase-3 positive cells, and Purkinje cells in male.

https://doi.org/10.7554/eLife.45306.022
Pineal ALLO did not induce the expression of PACAP in the cerebellum during the second week posthatch.

(a) The effects of Px or Px plus ALLO on the expression of PACAP in the cerebellum during the second week posthatch (n = 10). (b) Changes in the expression of PACAP during early life.

https://doi.org/10.7554/eLife.45306.023
Figure 8—source data 1

Source data for mRNA expressions.

https://doi.org/10.7554/eLife.45306.024
H3K9me3 levels at the Adcyap1 promoter increased in Purkinje cells during development.

(a) Changes in the levels of histone modification between the first and second weeks of posthatch. (b) Immunohistochemistry of H3K9me3 in the cerebellum of P1 chicks. Calbindin is used as a marker for Purkinje cells. (c) The relative intensity of H3K9me3 in the nucleus of Purkinje cells (n = 10).

https://doi.org/10.7554/eLife.45306.025
Figure 9—source data 1

Source data for the levels of histone modification.

https://doi.org/10.7554/eLife.45306.026
Light-at-night and Px increased in H3K9me3 levels at the Adcyap1 promoter.

(a) The effects of light-at-night and light-at-night plus ALLO on the level of H3K9me3 at the Adcyap1 gene promoter (n = 10). (b) The effects of Px and Px plus ALLO on the level of H3K9me3 at the Adcyap1 gene promoter (n = 10). LAN, light-at-night.

https://doi.org/10.7554/eLife.45306.027
Figure 10—source data 1

source data for H3K9me3 levels at the Adcyap1 promoter.

https://doi.org/10.7554/eLife.45306.028
A schematic model of the effect of pineal ALLO on Purkinje cell survival during the first week posthatch under LD or light-at-night conditions.

(Left panel) A schematic model of normal development of the cerebellum under LD during the first week posthatch (that is early posthatch life-stage). Pineal ALLO-induced the expression of PACAP, a neuroprotective factor, through mPRα mechanism in Purkinje cells. Then, PACAP inhibited the expression of active caspase-3 that may facilitate the apoptosis of Purkinje cells in the cerebellum. (Right panel) A schematic model of the abnormal development of the cerebellum under light-at-night conditions during the first week posthatch (that is early posthatch life-stage). Light-at-night conditions disrupted the diurnal rhythm in pineal ALLO synthesis. Decreased pineal ALLO synthesis induced H3K9me3 histone tail modifications of the Adcyap1 gene promoter and then decreased the expression of PACAP in Purkinje cells. Following this, increased amounts of caspase-3 facilitated the apoptosis of Purkinje cells in the cerebellum.

https://doi.org/10.7554/eLife.45306.029

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional
information
Cell line (Cercopithecus aethiops)COS-7JCRBCat# JCRB9127
RRID:CVCL_0224
Recombinant DNA reagentmembrane progesterone receptor α (mPRα)-HistagThis studyMaterials and methods subsection ‘Conformation of the specificity of mPRα antisera’
AntibodyAnti-Cleaved Caspase-3 (Asp175) ,
(Rabbit polyclonal)
Cell Signaling TechnologyCat# 9661,
RRID:AB_2341188
1:300, IHC
AntibodyAnti-Calbindin D-28k,
(Mouse monoclonal)
Swant Swiss antibodiesCat# 300,
RRID:AB_10000347
1:1000, IHC
AntibodyAnti-Pituitary adenylate cyclase-activating polypeptide (PACAP),
(Chicken polyclonal)
Nakamachi et al., 2018doi: 10.1016/j.peptides.2018.03.0061:100, IHC
AntibodyAnti-membrane progesterone receptor α (mPRα),(Rabbit polyclonal)This studyMaterials and methods subsection ‘Conformation of the specificity of mPRα antisera’; Against Goldfish mPRα aa 19–34 and53–66; 1:100, IHC
AntibodyAnti-ADCYAP1R1 (PAC1),
(Mouse monoclonal)
Santa Cruz BiotechnologyCat# sc-100315,
RRID:AB_1126992
1:100, IHC
AntibodyAnti-trimethyl-Histone H3 (Lys9),
(Rabbit polyclonal)
Merck MilliporeCat# 07–442,
RRID:AB_310620
1:50, ChIP
AntibodyAnti-trimethyl-Histone H3 (Lys27),
(Rabbit polyclonal)
Merck MilliporeCat# 07–449,
RRID:AB_310624
1:50, ChIP
AntibodyAnti-trimethyl-Histone H4 (Lys20),
(Rabbit polyclonal)
Merck MilliporeCat# 07–463,
RRID:AB_310636
1:50, ChIP
AntibodyAnti-Mouse IgG (H+L), F(ab’)2 Fragment, Alexa Fluor 555 ConjugateCell Signaling TechnologyCat# 4409,
RRID:AB_1904022
1:1000, IHC
AntibodyAnti-rabbit IgG (H+L), F(ab')2 Fragment, Alexa Fluor 488 ConjugateCell Signaling TechnologyCat# 4412,
RRID:AB_1904025
1:1000, IHC
Peptide, recombinant proteinChicken PACAPThis study
Commercial assay kitSimpleChIP plus sonication chromatin IP kitCell Signaling TechnologyCat# 56383
Chemical compoundAllopregnanoloneCayman Chemical16930, CAS RN: 516-54-1
Chemical compound, drugFluorescein-labeled allopregnanoloneThis studyCAS RN: 2294937-67-8Materials and methods subsection ‘Fluorescein-labeled ALLO synthesis’
Software, algorithmGraphPad Prism6GraphPad SoftwareRRID:SCR_002798
Table 1
Oligonucleotide sequence of PCR.
https://doi.org/10.7554/eLife.45306.030
Target genesForward primer 5’- > 3’Reverse primer 5’- > 3’
Srd5aAGAAAACCCGGGGAAGTCACAGCGATGGCAAAACCAAACC
α1-subunit of GABAARTCGTGGCAGTCTCCTTTGTCCTCATGCCCACAAGTGTCCT
mPRαTCTGCCCTGTGTGTCTTCACTTTGTCCCTCACCTTCCGTG
mPRβAGGGCCTTGTGGGAAAGATGTGCCAGATTCAAAGCCCCAT
mPRγCGTGCGCTCGATGAGAAATGTTTCATAACCCACCCCCAGC
PXRCCCATAACCAAAGCCAAGCGATCATGTCCTTCCGCATCCC
PACAPCACGCCGATGGGATCTTCAGTGCAGGTATTTCCTTGCGG
BDNFACATCACTGGCGGACACTTTCAGCATGACTCGGGATGTGT
NT-3ACCACCACCACTGTACCTCATCGGTGGCTCTTGTGTTCTG
3β-HSDCACTCTGCTGAACACCCCTTGCTGGTGTACCTCTTTGCCT
P450aromCGGGGCTGTGTAGGAAAGTTTGTCTGTACTCTGCACCGTC
Dio2TGACCACCATTCACAAGCCACAACAGAAAGTCAGCCACGC
IGF-1ATGGATCCAGCAGTAGACGCGCCTCCTCAGGTCACAACTC
Adcyap1 gene promoterCAGTTTCATGGTAAGGACCCGACGACCCACCGAGCG
Table 2
Oligonucleotide sequence of siRNA.
https://doi.org/10.7554/eLife.45306.031
Target genesSequence-senseSequence-anti-sense
mPRαCGGAGCUGGGCUGGUUUCUUCCCAUGGGAAGAAACCAGCCCAGCUCCG
mPRβGAGGAGGAUGCUGCUUGGUACCAUAUGGUNCCAAGCAGCAUCCUCCUC
mPRγCCGACAGAGUUUGGCUGCUGCGAUAUCGCAGCAGCCAAACUCUGUCGG

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files for Figures 1-10 have been deposited to Dryad (https://doi.org/10.5061/dryad.k6g8b53).

The following data sets were generated
  1. 1

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)