DDR2 controls breast tumor stiffness and metastasis by regulating integrin mediated mechanotransduction in CAFs
- Washington University, United States
Figures
Figure 1
The primary effect of DDR2 in stromal cells is at the primary tumor site not lung metastatic site.
(A) Lung colonization assay. Number of tumors per lung at 2 weeks after tail vein injection of GFP-Luciferase PyMT breast tumor cells (Ddr2+/+) into syngeneic FVB/n Ddr2 WT (Ddr2+/+) mice (11 mice; …
Figure 2 with 3 supplements
DDR2 influences mechanotransduction by cancer associated fibroblasts.
(A) Cell Spreading Assay. Mouse breast CAFs were added to collagen I coated plates for 30 or 180 min. Blue columns WT CAFs; red columns Ddr2-/- CAFs; green columns Ddr2-/- CAFs rescued with WT DDR2; …
Figure 2—figure supplement 1
DDR2 influences mechanotransduction by cancer associated fibroblasts supplement 1.
(A) Western blot of WT, Ddr2-/- (FSP1-Cre) and Ddr2-/- mouse CAFs (mCAF) rescued with WT DDR2 with indicated antibodies. (B) Western blot of control shSCR or shDDR2 infected human CAFs (hCAFs) with …
Figure 2—figure supplement 2
DDR2 influences mechanotransduction by cancer associated fibroblasts supplement 2.
(A) Representative immunofluorescence images of focal adhesions formed by WT and Ddr2-/- FSP1cre mCAF plated on collagen I for 60 min. Scale bar = 10 um. Focal adhesions were detected with vinculin …
Figure 2—figure supplement 3
DDR2 influences mechanotransduction by cancer associated fibroblasts supplement 3.
(A) Amount of exogenously expressed rescue DDR2 isoforms in mouse CAFs, as indicated, as determined by total cellular fluorescence normalized to cell area. ns = no significant difference. (B) …
Figure 3 with 1 supplement
DDR2 is required for full activation of collagen binding β1 Integrin in CAFs.
(A) Representative n-SIM super-resolution microscopy images of control hCAFs (shSCR) or hCAFs depleted of Ddr2 (shDDR2) showing active integrin β1 (9EG7; red) and Talin1 (green) immunofluorescence …
Figure 3—figure supplement 1
DDR2 is required for full activation of collagen binding b1 Integrin in CAFs supplement 1.
(A) Representative n-SIM super-resolution microscopy images of control shSCR WT (upper panels) and shDDR2 (lower panels) hCAFs plated on collagen I for 15 min and stained for active integrin β1 …
Figure 4 with 1 supplement
Collagen I stimulated DDR2 activates Rap1 that controls Talin1 activation and recruitment to collagen binding β1 Integrins.
(A) n-SIM super resolution microscopy images of Talin1 (green) and total integrin β1 (red) (left panels), DDR2-YFP (green) and total integrin β1 (red) (middle panels), or DDR2-YFP (green) and Talin1 …
Figure 4—figure supplement 1
Collagen I stimulated DDR2 activates Rap1 that controls Talin1 activation and recruitment to collagen binding b1 Integrins supplement 1.
(A) Representative n-SIM super-resolution microscopy images of dsRed-RAP1 <Q63E> or dsRed-RAP1 <V12> transfected shSCR WT or shDDR2 hCAFs. Scale bars = 10 um. (B) Representative n-SIM …
Figure 5 with 1 supplement
Deletion of Ddr2 in breast tumor CAFs results in altered collagen fiber organization and decreased lung metastases.
(A) DNA PCR genotyping of Ddr2 alleles from whole tumors from indicated mice. (B) Western blot of CAFs isolated from MMTV-PyMT (WT) or FSP1cre; Ddr2fl/fl; MMTV-PyMT (Ddr2-/- FSP1cre) mice with the …
Figure 5—figure supplement 1
Deletion of Ddr2 in breast tumor CAFs results in altered collagen fiber organization and decreased lung metastases supplement 1.
(A) Representative immunofluorescence images of cell lineage marker (green), as indicated, of FSP1cre; ROSA-LSL-TdTomato (red) PyMT breast tumors. Pie graphs indicate percentage of each cell type …
Figure 6
Deletion of Ddr2 in breast tumor CAFs results in decreased tumor stiffness.
(A) Compiled total tumor stiffness measurements represented as a histogram fit with a Gaussian curve (kPA, Young’s elastic modulus) for WT PyMT (blue line) and Ddr2-/- FSP1cre (red line) tumors. Six …
Figure 7
In vivo, the presence of DDR2 in primary breast tumor CAFs controls full β1 Integrin activation.
WT (A), Ddr2-/- FSP1cre (B), and ubiquitous Ddr2-/-(C) breast tumor organoids were isolated from 12 week primary tumors and immediately placed in a 3D collagen I microfluidic device under hypoxic …
Videos
Video 1
FIB-SEM of WT PyMT tumor breast tumor cell-stromal boundary.
This is a 360° depiction of a Focused Ion Beam Scanning Electron Micrograph (FIB-SEM) of the tumor-stromal boundary of a WT PyMT breast tumor. Collagen fibers are in green. Views are within 2 μm …
Video 2
FIB-SEM of ubiquitous Ddr2-/- PyMT breast tumor cell-stromal boundary.
This is a 360° depiction of a Focused Ion Beam Scanning Electron Micrograph (FIB-SEM) of the tumor-stromal boundary of a ubiquitous Ddr2-/- PyMT breast tumor. Both tumor cells and stromal cells are …
Video 3
FIB-SEM of WT PyMT tumor.
This is a 360° depiction of a Focused Ion Beam Scanning Electron Micrograph (FIB-SEM) of the tumor-stromal boundary of a Ddr2fl/fl; FSP1cre; PyMT breast tumor. Tumor stromal CAFs are deleted of Ddr2.…
Tables
Table 1
Antibodies used for Western blot, IF, and IP.
https://doi.org/10.7554/eLife.45508.019| Antibody | Source | Application | Concentration |
|---|---|---|---|
| Α-SMA (1A4) | Sigma A2547 | WB | 1:10,000 |
| β-actin | Sigma A5441 | WB | 1:10,000 |
| β-tubulin | Sigma T4026 | WB | 1:2000 |
| CD31 | Abcam ab28364 | IF | 1:100 |
| CD45 | BD Biosciences 550539 | IF | 1:100 |
| Collagen 1a1 | EMD Millipore AB765P | IF | 1:200 |
| DDR2 | CST 12133 | WB | 1:1000 |
| FAP | EMD Millipore ABT11 | IF | 1:100 |
| Integrin β1 | BD Biosciences 552828 | IF | 1:50 |
| Integrin β1 | CST 4706 | WB | 1:500 |
| Integrin β1 (9EG7) | BD Biosciences 553715 | IF | 1:50 |
| K14 | Covance PRB-155P | IF | 1:100 |
| K8 | DSHB TROMA-1 | IF | 1:100 |
| p-MLC (Ser19) | CST 3671 | IF | 1:50 |
| PDGFRα-FITC | eBioscience 11-1401-80 | FACS | 1:50 |
| Rap1 | EMD Millipore 07–916 | WB | 1:500 |
| Talin1 (8D4) | Sigma T3287 | IF, WB | 1:250, 1:2000 |
| Vinculin | Sigma V9131 | IF | 1:250 |
Table 2
Primer sequences for DDR2 mouse genotyping.
https://doi.org/10.7554/eLife.45508.018| Name | Sequence (5’ – 3’) |
|---|---|
| FRT 5’ Fwd | CTGTGTCTCTGGCTCAAAGTGTC |
| Targeted exon Rv | CCTTCCCAAGGCAGACCATTC |
| PyMT Fwd | GGAAGCAAGTACTTCACAAGGG |
| PyMT Rv | GGAAAGTCACTAGGAGCAGGG |
| Cre Fwd | GCATTACCGGTCGATGCAACGAGTGATGAG |
| Cre Rv | GAGTGAACGAACCTGGTCGAAATCAGTGCG |
| ROSA-LSL-TdTomato Fwd | GAGGGCCGCCACCACCTGTTCCTGTACGG |
| ROSA-LSL-TdTomato Rv | ATGATACAAAGGCATTAAAGCAGCGTATCC |
| ROSA-WT Fwd | GGGGAGTGTTGCAATACCTTTCTGGGAGTTC |
| ROSA-WT Rv | AAAACCGAAAATCTGTGGGAAGTCTTGTC |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.45508.020
