Malaria remains a serious health burden globally, with over 216 million cases annually (WHO, 2018). Plasmodium falciparum is responsible for 99% of estimated malaria cases in sub-Saharan Africa. Outside Africa, P. vivax is the predominant parasite and causes ~ 7.4 million clinical cases annually. Despite extensive efforts, in 2016 the number of malaria cases were on the rise again for the first time in several years (WHO, 2018). Achieving global malaria eradication requires new tools and approaches for addressing emerging drug resistance, relapsing P. vivax infections, and emerging zoonotic P. knowlesi infections, which represent significant causes of severe disease and death (Singh and Daneshvar, 2013; Hanboonkunupakarn and White, 2016; Menard and Dondorp, 2017).

Although P. vivax displays some distinctive features to P. knowlesi, including the formation of latent hypnozoites stages in the liver and restriction to reticulocytes in the blood, the two parasites are closely related, occupying a separate simian parasite clade to P. falciparum (Pacheco et al., 2018). Host cell invasion by P. vivax and P. knowlesi relies on the Duffy binding proteins (DBP) PvDBP and PkDBPα, respectively, both ligands for human red blood cell (RBC) Duffy antigen/receptor for chemokines (DARC) (Adams et al., 1990; Horuk et al., 1993; Singh et al., 2005; Miller et al., 1975). The critical binding motif of the ligands is the cysteine-rich region 2 (DBP-RII) (Chitnis and Miller, 1994), with ~70% identity between PkDBPα and PvDBP (Ranjan and Chitnis, 1999). Despite their similarity, PvDBP has also been implicated in both P. vivax reticulocyte restriction (Ovchynnikova et al., 2017) and as a host tropism factor preventing P. vivax from infecting macaques (Tachibana et al., 2015). PvDBP-RII is also the leading blood stage vaccine candidate for P. vivax (Ntumngia et al., 2012; Payne et al., 2017a; Singh et al., 2018), with antibodies targeting PvDBP-RII blocking parasite invasion in ex vivo P. vivax assays (Russell et al., 2011). P. knowlesi additionally contains two PkDBPα paralogues, namely DBPβ and DBPγ which share high levels of amino acid identity (68–88%) to PkDBPα but bind to distinct receptors via N-glycolylneuraminic acid - a sialic acid found on the surface of macaque RBCs, but absent from human RBCs (Dankwa et al., 2016).

Due to the lack of a long-term in vitro culture system for P. vivax, vaccine development currently relies on recombinant protein assays, or low throughput ex vivo studies, primate infections or controlled human malaria infections (Russell et al., 2011; Arévalo-Herrera et al., 2005; Shakri et al., 2012; Payne et al., 2017b). Thus, higher throughput parasitological assays to assess antisera and antigens, prior to escalation to in vivo work, are desperately needed. The evolutionary similarity between P. vivax and P. knowlesi means the adaptation of P. knowlesi to long-term culture in human RBCs (Moon et al., 2013; Lim et al., 2013) provides unique opportunities to study DARC-dependent invasion processes in both species. While adaptation of the CRISPR-Cas9 genome editing system to the most prevalent malaria parasite, P. falciparum (Ghorbal et al., 2014), provided a powerful tool for studying parasite biology, scalable approaches for P. falciparum remain constrained by inefficient transfection and very high genome AT-content (averaging 80.6%) (Gardner et al., 2002). P. knowlesi offers significant experimental advantages over P. falciparum including a more balanced genome AT-content of 62.5% and orders-of-magnitude-more-efficient transgenesis (Moon et al., 2013; Grüring et al., 2014; Kocken et al., 2002).

Here, we establish CRISPR-Cas9 genome editing in P. knowlesi. Using an optimised and scalable PCR-based approach for generating targeting constructs we define critical parameters determining effective genome editing and apply the technique to introduce epitope/fluorescent protein tags to a variety of proteins with distinct cellular locations. We then use these tools to replace the P. knowlesi PkDBPα gene with its PvDBP orthologue, and delete the P. knowlesi DBP paralogues to create a transgenic P. knowlesi line reliant on the PvDBP protein for invasion of RBCs. The additional deletion of the PkDBP paralogues not only excludes interference through antibody cross-reactivity during growth inhibition assays, but also allows us to demonstrate that, in contrast to previous findings (Ovchynnikova et al., 2017), PvDBP plays no role in reticulocyte restriction, but has an effect on macaque/human host cell preference. Finally, we show that antibodies raised against the P. vivax antigen are potent inhibitors of P. knowlesi/PvDBP transgenic parasites, providing an invaluable tool to support P. vivax vaccine development. Thus, we have developed a robust and flexible system for genome editing in an important human malaria parasite and generated essential new tools to accelerate both basic and applied malaria research.

In this work, we adapt CRISPR-Cas9 genome editing to the zoonotic malaria parasite P. knowlesi. Whilst various approaches for CRISPR-Cas9 have been used for other malaria parasites, here we combine a plasmid containing a single recyclable positive selection marker with a fusion PCR-based approach for generation of repair templates. This allows for seamless insertion or deletion at any location within a gene and unlimited iterative modifications of the genome. Genome-wide reverse genetics screens have been applied with great success to the rodent malaria parasite, P. berghei, but they have remained challenging for P. falciparum, and impossible for P. vivax. The tools presented here will enable scalable construct assembly and genome-wide systematic knockout or tagging screens in an alternative human infective species, thus providing a complementary tool to address both shared and species-specific biology. The analysis of lines with multiple tagged or deleted genes is particularly valuable for multigene families with highly redundant functions, as exemplified by our modification of all three P. knowlesi DBP genes.

Here we investigate key parameters associated with successful genome editing and show that the process is also highly robust; targeting of the p230p locus demonstrated successful editing for 25/25 transfections and only 1/10 sgRNAs targeting different loci failed to generate an edited line. The failure of an sgRNA guide (AGAAAATAGTGAAAACCCAT) designed to target the DBPβ locus, a non-essential gene, suggests that multiple guides may need to be tested for some loci. All sgRNA guides used are shown in Figure 3—source data 1. We did not detect any off-target effects, consistent with other reports of CRISPR-Cas9 use in malaria parasites (Ghorbal et al., 2014; Lu et al., 2016; Wagner et al., 2014; Zhang et al., 2017). Negative selection of the pCas9/sg plasmid then enables generation of markerless lines allowing unlimited iterative modifications of the genome, with each round requiring only ~30 days (including dilution cloning). Whilst the generation of markerless Cas9 modifications in the genome of P. falciparum has been possible for some time, initial systems contained multiple different selectable markers and relied on passive loss of episomes to recycle at least one marker (Ghorbal et al., 2014; Mogollon et al., 2016; Lu et al., 2016; Wagner et al., 2014). Whilst this is possible in some cases, it can create difficulties particularly if long selection protocols are necessary which may result in stabilisation/integration of episomes. Our format is similar to a more recent system developed in P. falciparum (Knuepfer et al., 2017), which by using only one bifunctional positive/negative selection cassette enables complete recycling of selectable markers. This has critically enabled generation of important base lines such as marker-free dimerisable Cre recombinase lines used for conditional knockouts in P. falciparum (Knuepfer et al., 2017). More extensive modifications using Cas9, such as the three sequential genetic modifications undertaken for P. yoelli (Zhang et al., 2017), remains relatively uncommon suggesting that the timescales involved in generation of these lines is still a challenge.

One clear disadvantage of this system is that we do still see a background remnant of wild type parasites for many of the modifications that are made. This may mean that modifications resulting in slow growing phenotypes could create a challenge for generating clonal lines. In our subsequent experience this is largely mitigated by the relatively fast grow out times and in extreme instances may be combated by immediately cloning after transfection. The selection-linked integration (SLI) method used in P. falciparum and P. knowlesi rapidly selects for genomic integration by using an additional selectable marker that is only expressed when correctly integrated, resulting in transgenic lines that do not require cloning (Birnbaum et al., 2017; Lyth et al., 2018). The disadvantage of this approach is that multiple selectable markers are required and at least one of them cannot be recycled in the final transgenic line, limiting scope for subsequent modifications. In our experience, the ability to extensively and iteratively modify parasites has been perhaps the most transformative aspect of this method and was integral to our work to modify all members of the PkDBP family. Importantly, as Cas9 modified lines are markerless, the two systems are entirely compatible, such that a baseline containing a range of Cas9 induced modifications could then be modified again using a SLI-based approach to enable access to more challenging slow growing mutants.

Parasites with integration of eGFP into the p230p locus reached 1% parasitaemia in 8 to 14 days after transfection. However for the most efficient transfections we were able to observe parasites reaching 1% at only 5 to 6 days suggesting significant differences in targeting efficiency at different loci and with different gRNAs. Whilst P. knowlesi grows slightly faster (with 3–4 fold per cycle equating to around 9-fold in 48 hr) than P. falciparum, this still indicates orders of magnitude greater modification rates than achieved for P. falciparum - which can take 2–6 weeks for transgenic parasites to be detected in culture depending on the transfection system used (Ghorbal et al., 2014; Mogollon et al., 2016; Lu et al., 2016; Knuepfer et al., 2017; Wagner et al., 2014). Despite the relatively fast recovery time it is also clear that as more than 8% of parasites are able to take up donor DNA during transfection it still takes more than a week for integrated parasites to grow out, indicating that efficiency of homology mediated repair is still the major bottleneck and the majority of Cas9 induced DSBs are not successfully repaired.

We systematically tested key parameters associated with successful genome editing and found increasing HR length enhanced integration efficiency proportionately, a trend seen in both P. falciparum and P. berghei (Collins et al., 2013; Wagner et al., 2014; MacPherson and Scherf, 2015). Whilst integration was detected with HRs as short as 50 bp, efficient editing was achieved with HRs between 200–800 bp. We were also able to examine how distance from the DSB affected editing efficiency. Whilst in other systems editing efficiency decreases rapidly as the DSB distance increases, we saw only a steady decline with distance, an effect which could be ameliorated by simply increasing HR length. The use of PCR products as repair templates is particularly well adapted for tagging and knockout approaches which tend to be relatively short. For relatively large or complex constructs, such as those for gene replacement, or those targeting multigenic families conventional cloning may be preferable, as shown here for the PkDBP family.

By applying these techniques to the P. knowlesi and P. vivax DBP family we have been able to examine the role of these genes in host and reticulocyte preference of the two species. Even after long-term adaptation to culture with human RBCs, P. knowlesi parasites can retain a strong preference for invasion of macaque RBCs (Dankwa et al., 2016; Moon et al., 2016). Both DBPγ and DBPβ have been shown to bind to proteins with a distinct sialic acid residue found in non-human primates, but absent in humans (Dankwa et al., 2016). Deletion of these genes led to a significant increase in growth rates in human RBCs, and interestingly also a similar, but non-significant, increase in growth rates in macaque RBCs. This suggests that PkDBPα alone is sufficient to retain the multiplication capacity and that the PkDBP paralogues are not responsible for the macaque cell preference retained in the A1-H.1 human adapted line. Whilst likely non-functional for invasion of human RBCs, both PkDBPγ and DBPβ would still compete for surface space and potentially some of the same interacting proteins as DBPα, which may account for the increased growth rate when they are deleted. The increased growth rate in macaque cells, would suggest that even here, where DBPγ and DBPβ are functional, PkDBPα is the preferred and more efficient pathway for invasion in macaque cells. In vivo, this advantage would be countered by the significant benefits provided by redundancy both to combat host blood cell polymorphisms and antibody responses. Importantly, this data suggests that loss of DBPγ and DBPβ could provide an adaptation route to increased growth/virulence within human infections. However, to do so the parasites would need to sacrifice redundancy within its primary macaque hosts – a situation only likely to occur with prolonged human to human transmission. Further work to analyse the effect of these mutations through long-term parasite competition assays will enable us to determine the precise extent of this advantage and determine how quickly such mutations could move to fixation within a parasite population.

Despite being closely related to P. knowlesi and other macaque infecting species such as P. cynomolgi, P. vivax cannot infect macaques and the PvDBP protein has been suggested to play a role in enforcing this tropism, as key interacting residues are missing within the macaque DARC protein (Tachibana et al., 2015). P. knowlesi parasites expressing PvDBP in the absence of DBP paralogues demonstrate a significant reduction in growth in macaque cells, resulting in an overall shift towards preference for human cells consistent with PvDBP binding macaque DARC less efficiently. Nevertheless as the multiplication rate remained quite close to that seen for human RBCs it seems unlikely that the PvDBP protein alone represents a significant barrier to P. vivax infection of macaques.

Previous work has shown that PvDBP_RII binds more strongly to RBCs expressing the Fy^b allele of the Duffy antigen than Fy^a, with studies using recombinant protein demonstrating that the binding efficiency is 50% lower for Fy^a (Kano et al., 2018). This effect was shown to correlate with a 30–80% reduced risk of clinical vivax malaria amongst patients with the FyA phenotype (King et al., 2011). A similar effect of reduced DBP-FyA binding has also been demonstrated using recombinant PkDBPα (Fong et al., 2018) but experiments to examine this with human RBC culture adapted P. knowlesi parasites failed to demonstrate any difference in multiplication rates in either Fy^b+ or Fy^a+ RBC (Moon et al., 2013). Here, we also did not observe a significant association between growth of the PvDBP^OR/Δ14Δγ line and Duffy haplotype. Whilst the size of our dataset cannot rule out relatively subtle effects on parasite growth rate, which over the course of an infection could become clinically relevant, it does rule out major growth differences and demonstrates that the invasion process is very tolerant of even quite large changes in receptor-ligand affinity. Notably, the study first identifying a role for Duffy polymorphisms in P. vivax clinical susceptibility also demonstrated that the Fy^a+ RBCs demonstrate increased sensitivity to invasion-blocking antibodies, so protective effects may stem from this rather than a direct effect on invasion efficiency (King et al., 2011; Moon et al., 2013). Subsequent experiments using these lines could readily test this hypothesis.

Another key difference between the two species is that unlike P. knowlesi, P. vivax has a strict restriction to invasion of reticulocytes. A second family of RBC binding proteins, known as the reticulocyte binding-like proteins (RBPs) have previously been implicated in this tropism. More recently, the PvDBP protein itself has been implicated with work using recombinant PvDBP_RII suggesting that whilst DARC is present on both reticulocytes and mature normocytes, changes during red cell maturation mean that DARC is only accessible to PvDBP binding in young reticulocytes (Ovchynnikova et al., 2017; Haynes et al., 1988). Here we show that transgenic P. knowlesi parasites using PvDBP for invasion have no such restriction, invading human RBCs (which typically contain less than 0.5% reticulocytes) with the same efficiency as those expressing PkDBPα – thus providing compelling evidence that PvDBP plays no role in the reticulocyte tropism. Further, recent work determining that PvRBP2b, which lacks an orthologue in P. knowlesi, binds to the reticulocyte specific marker CD71 further asserts the RBPs as the key to reticulocyte tropism. Importantly, the ability to compare and contrast activity of Pk/Pv DBP family members in parasitological assays will provide a vital new tool to test hypotheses and models arising from studies that have until now relied on assays using recombinant protein fragments.

Using a combination of binding assays, mutagenesis and structural studies with recombinant PvDBP_RII, previous work has identified residues involved in DBP-DARC interactions (Choe et al., 2005; Hans et al., 2005; VanBuskirk et al., 2004), as well as a DBP dimerization domain thought to drive the stepwise engagement with DARC (Batchelor et al., 2014; Batchelor et al., 2011). Efforts to develop a P. vivax vaccine to elicit antibodies against the lead candidate PvDBP have predominantly relied on using ELISA-based assays, which assess the ability of antibodies to block recombinant PvDBP_RII binding to DARC (Shakri et al., 2012). This has successfully identified a range of binding inhibitory antibodies mapped to residues involved in DARC binding, dimerization as well as subdomain 3, which is distant from the DARC binding site, demonstrating that multiple mechanisms of inhibition may be important (Chen et al., 2016; Chootong et al., 2010). However, validation of these findings in a parasitological assay is critical. Some epitopes identified in recombinant protein assays may be inaccessible in the context of invasion and it is also possible that not all inhibitory antibodies block receptor binding. DARC-DBP binding is only one step in the multi-step invasion process, with subsequent conformational changes and potential downstream signalling roles for the protein (Batchelor et al., 2011). The full-length DBP antigen is 140 kDa which contains a C-terminal transmembrane domain and as such structural and biochemical analysis of the protein has almost exclusively focused on the PvDBP_RII fragment alone. Whilst efforts to standardise ex vivo P. vivax assays have been successful (Russell et al., 2011), they remain hugely challenging, low throughput and rely on genetically diverse P. vivax clinical isolates, that are maintained in culture for a only a single cycle of RBC invasion. The P. knowlesi PvDBP^OR line thus provides an opportunity to interrogate the function of the full-length protein in an accessible and scalable manner.

Whilst the relationship between in vitro GIA and in vivo protection against malaria challenge has not always been clear, previous studies have shown that there is a strong correlative link between activity in the in vitro assay of GIA and in vivo protection from challenge of two different species of human malaria (P. falciparum and P. knowlesi) in two different non-human primate models (Aotus monkeys and rhesus macaques) targeting three different merozoite proteins (PfAMA1, PfRH5, PfMSP1) (Douglas et al., 2015; Mahdi Abdel Hamid et al., 2011; Singh et al., 2006). Importantly, Douglas et al. in 2015 determined a threshold value for in vitro GIA assay which must be reached before protection from malaria challenge is afforded (Douglas et al., 2015). Thus, the ability to readily assess P. vivax candidates in an in vitro GIA offers an important mechanism to determine whether candidates are appropriate for moving on to challenge studies.

A vaccine against P. vivax must ultimately elicit antibodies with strain-transcending inhibitory activity, but the ability to test on a defined genetic background can provide a significant advantage when it comes to benchmarking and prioritising target epitopes and characterising sera raised against them. Here we use the PvDBP sequence from the SalI reference strain, but multiple lines expressing distinct PvDBP variants could be generated in future, as has already been used for recombinant ELISA based assays (Ntumngia et al., 2012), to systematically examine inhibition in heterologous strains. Isolates refractory to a given test antibody in ex vivo assays can then be sequenced and direct the generation of new transgenic P. knowlesi PvDBP^OR variant lines to support rational vaccine development. These assays in turn can provide vital triaging for non-human primate models, and controlled human challenge infections (Payne et al., 2017a; Russell et al., 2011; Arévalo-Herrera et al., 2005; Payne et al., 2017b) – both of which carry the imperative to ensure that only highly optimised antigens are tested. The transgenic P. knowlesi OR lines developed here represent the ideal platform for scalable testing of polyclonal and monoclonal sera from vaccine trials and natural P. vivax infections. This will enable detailed investigation of epitopes providing invasion inhibitory activity and a means for systematic development of a strain-transcending vaccine. Our work also revealed low-level cross-reactivity of PvDBP_RII antibodies against P. knowlesi and suggests cross-immunity between the two species could exist in the field, which may have a significant impact on disease outcome. Understanding the precise epitopes involved could facilitate development of a dual species vaccine, and epitopes conserved across species are also more likely to be conserved across polymorphic strains of P. vivax. The same approach could readily be applied to other potential vaccine candidates, novel drug targets or to investigate mechanisms of drug resistance, which are also thought to differ between P. falciparum and P. vivax (Price et al., 2014).

In conclusion, we demonstrate that adaptation of CRISPR-Cas9 genome editing to P. knowlesi provides a powerful system for scalable genome editing of malaria parasites and can provide critical new tools for studying both shared and species-specific biology.

Raw whole genome sequencing data has been deposited to the European Nucleotide Archive under accession number ERS3042513. All other data generated or analysed during this study are included in the manuscript and supporting files. Source data files for all figures has been provided.

1. 1. Mohring F
   2. Hart MN
   3. Rawlinson TA
   4. Henrici R
   5. Charleston JA
   6. Benavente ED
   7. Patel A
   8. Hall J
   9. Almond N
   10. Campino S
   11. Clark TG
   12. Sutherland CJ
   13. Baker DA
   14. Draper SJ
   15. Moo RW

   (2019) European Nucleotide Archive

   ID ERS3042513. Genome editing in the zoonotic malaria parasite Plasmodium knowlesi provides new tools for P. vivax research.

   http://www.ebi.ac.uk/ena/data/view/ERS3042513

1. 1. Adams JH
   2. Hudson DE
   3. Torii M
   4. Ward GE
   5. Wellems TE
   6. Aikawa M
   7. Miller LH

   (1990) The Duffy receptor family of Plasmodium knowlesi is located within the micronemes of invasive malaria merozoites

   Cell 63:141–153.

   https://doi.org/10.1016/0092-8674(90)90295-P

   • PubMed
   • Google Scholar
2. 1. Arévalo-Herrera M
   2. Castellanos A
   3. Yazdani SS
   4. Shakri AR
   5. Chitnis CE
   6. Dominik R
   7. Herrera S

   (2005) Immunogenicity and protective efficacy of recombinant vaccine based on the receptor-binding domain of the Plasmodium vivax Duffy binding protein in Aotus monkeys

   The American Journal of Tropical Medicine and Hygiene 73:25–31.

   https://doi.org/10.4269/ajtmh.2005.73.5_suppl.0730025

   • PubMed
   • Google Scholar
3. 1. Bannister LH
   2. Hopkins JM
   3. Dluzewski AR
   4. Margos G
   5. Williams IT
   6. Blackman MJ
   7. Kocken CH
   8. Thomas AW
   9. Mitchell GH

   (2003) Plasmodium falciparum apical membrane antigen 1 (PfAMA-1) is translocated within micronemes along subpellicular microtubules during merozoite development

   Journal of Cell Science 116:3825–3834.

   https://doi.org/10.1242/jcs.00665

   • PubMed
   • Google Scholar
4. 1. Batchelor JD
   2. Zahm JA
   3. Tolia NH

   (2011) Dimerization of Plasmodium vivax DBP is induced upon receptor binding and drives recognition of DARC

   Nature Structural & Molecular Biology 18:908–914.

   https://doi.org/10.1038/nsmb.2088

   • PubMed
   • Google Scholar
5. 1. Batchelor JD
   2. Malpede BM
   3. Omattage NS
   4. DeKoster GT
   5. Henzler-Wildman KA
   6. Tolia NH

   (2014) Red blood cell invasion by Plasmodium vivax: structural basis for DBP engagement of DARC

   PLOS Pathogens 10:e1003869.

   https://doi.org/10.1371/journal.ppat.1003869

   • PubMed
   • Google Scholar
6. 1. Baum J
   2. Richard D
   3. Healer J
   4. Rug M
   5. Krnajski Z
   6. Gilberger TW
   7. Green JL
   8. Holder AA
   9. Cowman AF

   (2006) A conserved molecular motor drives cell invasion and gliding motility across malaria life cycle stages and other apicomplexan parasites

   Journal of Biological Chemistry 281:5197–5208.

   https://doi.org/10.1074/jbc.M509807200

   • PubMed
   • Google Scholar
7. 1. Benavente ED
   2. de Sessions PF
   3. Moon RW
   4. Grainger M
   5. Holder AA
   6. Blackman MJ
   7. Roper C
   8. Drakeley CJ
   9. Pain A
   10. Sutherland CJ
   11. Hibberd ML
   12. Campino S
   13. Clark TG

   (2018) A reference genome and methylome for the Plasmodium knowlesi A1-H.1 line

   International Journal for Parasitology 48:191–196.

   https://doi.org/10.1016/j.ijpara.2017.09.008

   • PubMed
   • Google Scholar
8. Software

   1. Benchling

   (2018) Benchling [Biology Software]

   Benchling [Biology Software].

   http://benchling.com
9. 1. Birnbaum J
   2. Flemming S
   3. Reichard N
   4. Soares AB
   5. Mesén-Ramírez P
   6. Jonscher E
   7. Bergmann B
   8. Spielmann T

   (2017) A genetic system to study Plasmodium falciparum protein function

   Nature Methods 14:450–456.

   https://doi.org/10.1038/nmeth.4223

   • PubMed
   • Google Scholar
10. 1. Byrne SM
    2. Ortiz L
    3. Mali P
    4. Aach J
    5. Church GM

    (2015) Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells

    Nucleic Acids Research 43:e21.

    https://doi.org/10.1093/nar/gku1246

    • PubMed
    • Google Scholar
11. 1. Campino S
    2. Benavente ED
    3. Assefa S
    4. Thompson E
    5. Drought LG
    6. Taylor CJ
    7. Gorvett Z
    8. Carret CK
    9. Flueck C
    10. Ivens AC
    11. Kwiatkowski DP
    12. Alano P
    13. Baker DA
    14. Clark TG

    (2016) Genomic variation in two gametocyte non-producing Plasmodium falciparum clonal lines

    Malaria Journal 15:229.

    https://doi.org/10.1186/s12936-016-1254-1

    • PubMed
    • Google Scholar
12. 1. Cao J
    2. Kaneko O
    3. Thongkukiatkul A
    4. Tachibana M
    5. Otsuki H
    6. Gao Q
    7. Tsuboi T
    8. Torii M

    (2009) Rhoptry neck protein RON2 forms a complex with microneme protein AMA1 in Plasmodium falciparum merozoites

    Parasitology International 58:29–35.

    https://doi.org/10.1016/j.parint.2008.09.005

    • PubMed
    • Google Scholar
13. 1. Chen E
    2. Salinas ND
    3. Huang Y
    4. Ntumngia F
    5. Plasencia MD
    6. Gross ML
    7. Adams JH
    8. Tolia NH

    (2016) Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein

    PNAS 113:6277–6282.

    https://doi.org/10.1073/pnas.1600488113

    • PubMed
    • Google Scholar
14. 1. Chitnis CE
    2. Miller LH

    (1994) Identification of the erythrocyte binding domains of Plasmodium vivax and Plasmodium knowlesi proteins involved in erythrocyte invasion

    Journal of Experimental Medicine 180:497–506.

    https://doi.org/10.1084/jem.180.2.497

    • PubMed
    • Google Scholar
15. 1. Choe H
    2. Moore MJ
    3. Owens CM
    4. Wright PL
    5. Vasilieva N
    6. Li W
    7. Singh AP
    8. Shakri R
    9. Chitnis CE
    10. Farzan M

    (2005) Sulphated tyrosines mediate association of chemokines and plasmodium vivax duffy binding protein with the duffy antigen/receptor for chemokines (DARC)

    Molecular Microbiology 55:1413–1422.

    https://doi.org/10.1111/j.1365-2958.2004.04478.x

    • PubMed
    • Google Scholar
16. 1. Chootong P
    2. Ntumngia FB
    3. VanBuskirk KM
    4. Xainli J
    5. Cole-Tobian JL
    6. Campbell CO
    7. Fraser TS
    8. King CL
    9. Adams JH

    (2010) Mapping epitopes of the plasmodium vivax duffy binding protein with naturally acquired inhibitory antibodies

    Infection and Immunity 78:1089–1095.

    https://doi.org/10.1128/IAI.01036-09

    • PubMed
    • Google Scholar
17. 1. Collins CR
    2. Hackett F
    3. Strath M
    4. Penzo M
    5. Withers-Martinez C
    6. Baker DA
    7. Blackman MJ

    (2013) Malaria parasite cGMP-dependent protein kinase regulates blood stage merozoite secretory organelle discharge and egress

    PLOS Pathogens 9:e1003344.

    https://doi.org/10.1371/journal.ppat.1003344

    • PubMed
    • Google Scholar
18. 1. Crawford ED
    2. Quan J
    3. Horst JA
    4. Ebert D
    5. Wu W
    6. DeRisi JL

    (2017) Plasmid-free CRISPR/Cas9 genome editing in Plasmodium falciparum confirms mutations conferring resistance to the dihydroisoquinolone clinical candidate SJ733

    PLOS ONE 12:e0178163.

    https://doi.org/10.1371/journal.pone.0178163

    • PubMed
    • Google Scholar
19. 1. Dankwa S
    2. Lim C
    3. Bei AK
    4. Jiang RH
    5. Abshire JR
    6. Patel SD
    7. Goldberg JM
    8. Moreno Y
    9. Kono M
    10. Niles JC
    11. Duraisingh MT

    (2016) Ancient human sialic acid variant restricts an emerging zoonotic malaria parasite

    Nature Communications 7:11187.

    https://doi.org/10.1038/ncomms11187

    • PubMed
    • Google Scholar
20. 1. de Cassan SC
    2. Shakri AR
    3. Llewellyn D
    4. Elias SC
    5. Cho JS
    6. Goodman AL
    7. Jin J
    8. Douglas AD
    9. Suwanarusk R
    10. Nosten FH
    11. Rénia L
    12. Russell B
    13. Chitnis CE
    14. Draper SJ

    (2015) Preclinical assessment of viral vectored and protein vaccines targeting the Duffy-Binding protein region II of Plasmodium Vivax

    Frontiers in Immunology 6:348.

    https://doi.org/10.3389/fimmu.2015.00348

    • PubMed
    • Google Scholar
21. 1. Douglas AD
    2. Baldeviano GC
    3. Lucas CM
    4. Lugo-Roman LA
    5. Crosnier C
    6. Bartholdson SJ
    7. Diouf A
    8. Miura K
    9. Lambert LE
    10. Ventocilla JA
    11. Leiva KP
    12. Milne KH
    13. Illingworth JJ
    14. Spencer AJ
    15. Hjerrild KA
    16. Alanine DG
    17. Turner AV
    18. Moorhead JT
    19. Edgel KA
    20. Wu Y
    21. Long CA
    22. Wright GJ
    23. Lescano AG
    24. Draper SJ

    (2015) A PfRH5-based vaccine is efficacious against heterologous strain blood-stage Plasmodium falciparum infection in aotus monkeys

    Cell Host & Microbe 17:130–139.

    https://doi.org/10.1016/j.chom.2014.11.017

    • PubMed
    • Google Scholar
22. 1. Ecker A
    2. Moon R
    3. Sinden RE
    4. Billker O

    (2006) Generation of gene targeting constructs for Plasmodium berghei by a PCR-based method amenable to high throughput applications

    Molecular and Biochemical Parasitology 145:265–268.

    https://doi.org/10.1016/j.molbiopara.2005.10.006

    • PubMed
    • Google Scholar
23. 1. Ehlgen F
    2. Pham JS
    3. de Koning-Ward T
    4. Cowman AF
    5. Ralph SA

    (2012) Investigation of the Plasmodium falciparum food vacuole through inducible expression of the chloroquine resistance transporter (PfCRT)

    PLOS ONE 7:e38781.

    https://doi.org/10.1371/journal.pone.0038781

    • PubMed
    • Google Scholar
24. 1. Fong MY
    2. Cheong FW
    3. Lau YL

    (2018) Erythrocyte-binding assays reveal higher binding of Plasmodium knowlesi Duffy binding protein to human Fy^a+/b+ erythrocytes than to Fy^a+/b- erythrocytes

    Parasites & Vectors 11:527.

    https://doi.org/10.1186/s13071-018-3118-8

    • PubMed
    • Google Scholar
25. 1. Gardner MJ
    2. Hall N
    3. Fung E
    4. White O
    5. Berriman M
    6. Hyman RW
    7. Carlton JM
    8. Pain A
    9. Nelson KE
    10. Bowman S
    11. Paulsen IT
    12. James K
    13. Eisen JA
    14. Rutherford K
    15. Salzberg SL
    16. Craig A
    17. Kyes S
    18. Chan MS
    19. Nene V
    20. Shallom SJ
    21. Suh B
    22. Peterson J
    23. Angiuoli S
    24. Pertea M
    25. Allen J
    26. Selengut J
    27. Haft D
    28. Mather MW
    29. Vaidya AB
    30. Martin DM
    31. Fairlamb AH
    32. Fraunholz MJ
    33. Roos DS
    34. Ralph SA
    35. McFadden GI
    36. Cummings LM
    37. Subramanian GM
    38. Mungall C
    39. Venter JC
    40. Carucci DJ
    41. Hoffman SL
    42. Newbold C
    43. Davis RW
    44. Fraser CM
    45. Barrell B

    (2002) Genome sequence of the human malaria parasite Plasmodium falciparum

    Nature 419:498–511.

    https://doi.org/10.1038/nature01097

    • PubMed
    • Google Scholar
26. 1. Ghorbal M
    2. Gorman M
    3. Macpherson CR
    4. Martins RM
    5. Scherf A
    6. Lopez-Rubio JJ

    (2014) Genome editing in the human malaria parasite Plasmodium falciparum using the CRISPR-Cas9 system

    Nature Biotechnology 32:819–821.

    https://doi.org/10.1038/nbt.2925

    • PubMed
    • Google Scholar
27. 1. Grüring C
    2. Moon RW
    3. Lim C
    4. Holder AA
    5. Blackman MJ
    6. Duraisingh MT

    (2014) Human red blood cell-adapted Plasmodium knowlesi parasites: a new model system for malaria research

    Cellular Microbiology 16:612–620.

    https://doi.org/10.1111/cmi.12275

    • PubMed
    • Google Scholar
28. 1. Hanboonkunupakarn B
    2. White NJ

    (2016) The threat of antimalarial drug resistance

    Tropical Diseases, Travel Medicine and Vaccines 2:10.

    https://doi.org/10.1186/s40794-016-0027-8

    • PubMed
    • Google Scholar
29. 1. Hans D
    2. Pattnaik P
    3. Bhattacharyya A
    4. Shakri AR
    5. Yazdani SS
    6. Sharma M
    7. Choe H
    8. Farzan M
    9. Chitnis CE

    (2005) Mapping binding residues in the Plasmodium vivax domain that binds Duffy antigen during red cell invasion

    Molecular Microbiology 55:1423–1434.

    https://doi.org/10.1111/j.1365-2958.2005.04484.x

    • PubMed
    • Google Scholar
30. 1. Haynes JD
    2. Dalton JP
    3. Klotz FW
    4. McGinniss MH
    5. Hadley TJ
    6. Hudson DE
    7. Miller LH

    (1988) Receptor-like specificity of a Plasmodium knowlesi malarial protein that binds to Duffy antigen ligands on erythrocytes

    Journal of Experimental Medicine 167:1873–1881.

    https://doi.org/10.1084/jem.167.6.1873

    • PubMed
    • Google Scholar
31. 1. Horuk R
    2. Chitnis CE
    3. Darbonne WC
    4. Colby TJ
    5. Rybicki A
    6. Hadley TJ
    7. Miller LH

    (1993) A receptor for the malarial parasite Plasmodium vivax: the erythrocyte chemokine receptor

    Science 261:1182–1184.

    https://doi.org/10.1126/science.7689250

    • PubMed
    • Google Scholar
32. 1. Kano FS
    2. de Souza AM
    3. de Menezes Torres L
    4. Costa MA
    5. Souza-Silva FA
    6. Sanchez BAM
    7. Fontes CJF
    8. Soares IS
    9. de Brito CFA
    10. Carvalho LH
    11. Sousa TN

    (2018) Susceptibility to Plasmodium vivax malaria associated with DARC (Duffy antigen) polymorphisms is influenced by the time of exposure to malaria

    Scientific Reports 8:13851.

    https://doi.org/10.1038/s41598-018-32254-z

    • PubMed
    • Google Scholar
33. 1. Kennedy MC
    2. Wang J
    3. Zhang Y
    4. Miles AP
    5. Chitsaz F
    6. Saul A
    7. Long CA
    8. Miller LH
    9. Stowers AW

    (2002) In vitro studies with recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1): production and activity of an AMA1 vaccine and generation of a multiallelic response

    Infection and Immunity 70:6948–6960.

    https://doi.org/10.1128/IAI.70.12.6948-6960.2002

    • PubMed
    • Google Scholar
34. 1. King CL
    2. Adams JH
    3. Xianli J
    4. Grimberg BT
    5. McHenry AM
    6. Greenberg LJ
    7. Siddiqui A
    8. Howes RE
    9. da Silva-Nunes M
    10. Ferreira MU
    11. Zimmerman PA

    (2011) Fy(a)/Fy(b) antigen polymorphism in human erythrocyte duffy antigen affects susceptibility to Plasmodium vivax malaria

    PNAS 108:20113–20118.

    https://doi.org/10.1073/pnas.1109621108

    • PubMed
    • Google Scholar
35. 1. Knuepfer E
    2. Napiorkowska M
    3. van Ooij C
    4. Holder AA

    (2017) Generating conditional gene knockouts in Plasmodium - a toolkit to produce stable DiCre recombinase-expressing parasite lines using CRISPR/Cas9

    Scientific Reports 7:3881.

    https://doi.org/10.1038/s41598-017-03984-3

    • PubMed
    • Google Scholar
36. 1. Kocken CH
    2. Ozwara H
    3. van der Wel A
    4. Beetsma AL
    5. Mwenda JM
    6. Thomas AW

    (2002) Plasmodium knowlesi provides a rapid in vitro and in vivo transfection system that enables double-crossover gene knockout studies

    Infection and Immunity 70:655–660.

    https://doi.org/10.1128/IAI.70.2.655-660.2002

    • PubMed
    • Google Scholar
37. 1. Lim C
    2. Hansen E
    3. DeSimone TM
    4. Moreno Y
    5. Junker K
    6. Bei A
    7. Brugnara C
    8. Buckee CO
    9. Duraisingh MT

    (2013) Expansion of host cellular niche can drive adaptation of a zoonotic malaria parasite to humans

    Nature Communications 4:.

    https://doi.org/10.1038/ncomms2612

    • Google Scholar
38. 1. Lu J
    2. Tong Y
    3. Pan J
    4. Yang Y
    5. Liu Q
    6. Tan X
    7. Zhao S
    8. Qin L
    9. Chen X

    (2016) A redesigned CRISPR/Cas9 system for marker-free genome editing in Plasmodium falciparum

    Parasites & Vectors 9:198.

    https://doi.org/10.1186/s13071-016-1487-4

    • PubMed
    • Google Scholar
39. 1. Lyth O
    2. Vizcay-Barrena G
    3. Wright KE
    4. Haase S
    5. Mohring F
    6. Najer A
    7. Henshall IG
    8. Ashdown GW
    9. Bannister LH
    10. Drew DR
    11. Beeson JG
    12. Fleck RA
    13. Moon RW
    14. Wilson DW
    15. Baum J

    (2018) Cellular dissection of malaria parasite invasion of human erythrocytes using viable plasmodium knowlesi merozoites

    Scientific Reports 8:10165.

    https://doi.org/10.1038/s41598-018-28457-z

    • PubMed
    • Google Scholar
40. 1. MacPherson CR
    2. Scherf A

    (2015) Flexible guide-RNA design for CRISPR applications using Protospacer Workbench

    Nature Biotechnology 33:805–806.

    https://doi.org/10.1038/nbt.3291

    • PubMed
    • Google Scholar
41. 1. Mahdi Abdel Hamid M
    2. Remarque EJ
    3. van Duivenvoorde LM
    4. van der Werff N
    5. Walraven V
    6. Faber BW
    7. Kocken CH
    8. Thomas AW

    (2011) Vaccination with plasmodium knowlesi AMA1 formulated in the novel adjuvant co-vaccine HT protects against blood-stage challenge in rhesus macaques

    PLOS ONE 6:e20547.

    https://doi.org/10.1371/journal.pone.0020547

    • PubMed
    • Google Scholar
42. 1. Menard D
    2. Dondorp A

    (2017) Antimalarial drug resistance: a threat to malaria elimination

    Cold Spring Harbor Perspectives in Medicine 7:a025619.

    https://doi.org/10.1101/cshperspect.a025619

    • PubMed
    • Google Scholar
43. 1. Miller LH
    2. Mason SJ
    3. Dvorak JA
    4. McGinniss MH
    5. Rothman IK

    (1975) Erythrocyte receptors for (Plasmodium knowlesi) malaria: Duffy blood group determinants

    Science 189:561–563.

    https://doi.org/10.1126/science.1145213

    • PubMed
    • Google Scholar
44. 1. Miller LH
    2. Mason SJ
    3. Clyde DF
    4. McGinniss MH

    (1976) The resistance factor to Plasmodium vivax in blacks. The Duffy-blood-group genotype, FyFy

    The New England Journal of Medicine 295:302–304.

    https://doi.org/10.1056/NEJM197608052950602

    • PubMed
    • Google Scholar
45. 1. Mogollon CM
    2. van Pul FJ
    3. Imai T
    4. Ramesar J
    5. Chevalley-Maurel S
    6. de Roo GM
    7. Veld SA
    8. Kroeze H
    9. Franke-Fayard BM
    10. Janse CJ
    11. Khan SM

    (2016) Rapid generation of Marker-Free P. falciparum fluorescent reporter lines using modified CRISPR/Cas9 constructs and selection protocol

    PLOS ONE 11:e0168362.

    https://doi.org/10.1371/journal.pone.0168362

    • PubMed
    • Google Scholar
46. 1. Moon RW
    2. Hall J
    3. Rangkuti F
    4. Ho YS
    5. Almond N
    6. Mitchell GH
    7. Pain A
    8. Holder AA
    9. Blackman MJ

    (2013) Adaptation of the genetically tractable malaria pathogen Plasmodium knowlesi to continuous culture in human erythrocytes

    PNAS 110:531–536.

    https://doi.org/10.1073/pnas.1216457110

    • PubMed
    • Google Scholar
47. 1. Moon RW
    2. Sharaf H
    3. Hastings CH
    4. Ho YS
    5. Nair MB
    6. Rchiad Z
    7. Knuepfer E
    8. Ramaprasad A
    9. Mohring F
    10. Amir A
    11. Yusuf NA
    12. Hall J
    13. Almond N
    14. Lau YL
    15. Pain A
    16. Blackman MJ
    17. Holder AA

    (2016) Normocyte-binding protein required for human erythrocyte invasion by the zoonotic malaria parasite Plasmodium knowlesi

    PNAS 113:7231–7236.

    https://doi.org/10.1073/pnas.1522469113

    • PubMed
    • Google Scholar
48. 1. Ntumngia FB
    2. Schloegel J
    3. Barnes SJ
    4. McHenry AM
    5. Singh S
    6. King CL
    7. Adams JH

    (2012) Conserved and variant epitopes of Plasmodium vivax Duffy binding protein as targets of inhibitory monoclonal antibodies

    Infection and Immunity 80:1203–1208.

    https://doi.org/10.1128/IAI.05924-11

    • PubMed
    • Google Scholar
49. 1. Ovchynnikova E
    2. Aglialoro F
    3. Bentlage AEH
    4. Vidarsson G
    5. Salinas ND
    6. von Lindern M
    7. Tolia NH
    8. van den Akker E

    (2017) DARC extracellular domain remodeling in maturating reticulocytes explains Plasmodium vivax tropism

    Blood 130:1441–1444.

    https://doi.org/10.1182/blood-2017-03-774364

    • PubMed
    • Google Scholar
50. 1. Pacheco MA
    2. Matta NE
    3. Valkiunas G
    4. Parker PG
    5. Mello B
    6. Stanley CE
    7. Lentino M
    8. Garcia-Amado MA
    9. Cranfield M
    10. Kosakovsky Pond SL
    11. Escalante AA

    (2018) Mode and rate of evolution of haemosporidian mitochondrial genomes: timing the radiation of avian parasites

    Molecular Biology and Evolution 35:383–403.

    https://doi.org/10.1093/molbev/msx285

    • PubMed
    • Google Scholar
51. 1. Pain A
    2. Böhme U
    3. Berry AE
    4. Mungall K
    5. Finn RD
    6. Jackson AP
    7. Mourier T
    8. Mistry J
    9. Pasini EM
    10. Aslett MA
    11. Balasubrammaniam S
    12. Borgwardt K
    13. Brooks K
    14. Carret C
    15. Carver TJ
    16. Cherevach I
    17. Chillingworth T
    18. Clark TG
    19. Galinski MR
    20. Hall N
    21. Harper D
    22. Harris D
    23. Hauser H
    24. Ivens A
    25. Janssen CS
    26. Keane T
    27. Larke N
    28. Lapp S
    29. Marti M
    30. Moule S
    31. Meyer IM
    32. Ormond D
    33. Peters N
    34. Sanders M
    35. Sanders S
    36. Sargeant TJ
    37. Simmonds M
    38. Smith F
    39. Squares R
    40. Thurston S
    41. Tivey AR
    42. Walker D
    43. White B
    44. Zuiderwijk E
    45. Churcher C
    46. Quail MA
    47. Cowman AF
    48. Turner CM
    49. Rajandream MA
    50. Kocken CH
    51. Thomas AW
    52. Newbold CI
    53. Barrell BG
    54. Berriman M

    (2008) The genome of the simian and human malaria parasite Plasmodium knowlesi

    Nature 455:799–803.

    https://doi.org/10.1038/nature07306

    • PubMed
    • Google Scholar
52. 1. Payne RO
    2. Silk SE
    3. Elias SC
    4. Milne KH
    5. Rawlinson TA
    6. Llewellyn D
    7. Shakri AR
    8. Jin J
    9. Labbé GM
    10. Edwards NJ
    11. Poulton ID
    12. Roberts R
    13. Farid R
    14. Jørgensen T
    15. Alanine DG
    16. de Cassan SC
    17. Higgins MK
    18. Otto TD
    19. McCarthy JS
    20. de Jongh WA
    21. Nicosia A
    22. Moyle S
    23. Hill AV
    24. Berrie E
    25. Chitnis CE
    26. Lawrie AM
    27. Draper SJ

    (2017a) Human vaccination against Plasmodium vivax Duffy-binding protein induces strain-transcending antibodies

    JCI Insight 2:.

    https://doi.org/10.1172/jci.insight.93683

    • PubMed
    • Google Scholar
53. 1. Payne RO
    2. Griffin PM
    3. McCarthy JS
    4. Draper SJ

    (2017b) Plasmodium vivax controlled human malaria infection – Progress and Prospects

    Trends in Parasitology 33:141–150.

    https://doi.org/10.1016/j.pt.2016.11.001

    • Google Scholar
54. 1. Price RN
    2. von Seidlein L
    3. Valecha N
    4. Nosten F
    5. Baird JK
    6. White NJ

    (2014) Global extent of chloroquine-resistant Plasmodium vivax: a systematic review and meta-analysis

    The Lancet Infectious Diseases 14:982–991.

    https://doi.org/10.1016/S1473-3099(14)70855-2

    • PubMed
    • Google Scholar
55. 1. Ranjan A
    2. Chitnis CE

    (1999) Mapping regions containing binding residues within functional domains of Plasmodium vivax and Plasmodium knowlesi erythrocyte-binding proteins

    PNAS 96:14067–14072.

    https://doi.org/10.1073/pnas.96.24.14067

    • PubMed
    • Google Scholar
56. 1. Russell B
    2. Suwanarusk R
    3. Borlon C
    4. Costa FT
    5. Chu CS
    6. Rijken MJ
    7. Sriprawat K
    8. Warter L
    9. Koh EG
    10. Malleret B
    11. Colin Y
    12. Bertrand O
    13. Adams JH
    14. D'Alessandro U
    15. Snounou G
    16. Nosten F
    17. Rénia L

    (2011) A reliable ex vivo invasion assay of human reticulocytes by Plasmodium vivax

    Blood 118:e74–e81.

    https://doi.org/10.1182/blood-2011-04-348748

    • PubMed
    • Google Scholar
57. 1. Shakri AR
    2. Rizvi MM
    3. Chitnis CE

    (2012) Development of quantitative receptor-ligand binding assay for use as a tool to estimate immune responses against Plasmodium vivax Duffy binding protein Region II

    Journal of Immunoassay and Immunochemistry 33:403–413.

    https://doi.org/10.1080/15321819.2012.659781

    • PubMed
    • Google Scholar
58. 1. Singh AP
    2. Ozwara H
    3. Kocken CH
    4. Puri SK
    5. Thomas AW
    6. Chitnis CE

    (2005) Targeted deletion of Plasmodium knowlesi Duffy binding protein confirms its role in junction formation during invasion

    Molecular Microbiology 55:1925–1934.

    https://doi.org/10.1111/j.1365-2958.2005.04523.x

    • PubMed
    • Google Scholar
59. 1. Singh S
    2. Miura K
    3. Zhou H
    4. Muratova O
    5. Keegan B
    6. Miles A
    7. Martin LB
    8. Saul AJ
    9. Miller LH
    10. Long CA

    (2006) Immunity to recombinant Plasmodium falciparum merozoite surface protein 1 (MSP1): protection in Aotus nancymai monkeys strongly correlates with anti-MSP1 antibody titer and in vitro parasite-inhibitory activity

    Infection and Immunity 74:4573–4580.

    https://doi.org/10.1128/IAI.01679-05

    • PubMed
    • Google Scholar
60. 1. Singh K
    2. Mukherjee P
    3. Shakri AR
    4. Singh A
    5. Pandey G
    6. Bakshi M
    7. Uppal G
    8. Jena R
    9. Rawat A
    10. Kumar P
    11. Bhardwaj R
    12. Yazdani SS
    13. Hans D
    14. Mehta S
    15. Srinivasan A
    16. Anil K
    17. Madhusudhan RL
    18. Patel J
    19. Singh A
    20. Rao R
    21. Gangireddy S
    22. Patil R
    23. Kaviraj S
    24. Singh S
    25. Carter D
    26. Reed S
    27. Kaslow DC
    28. Birkett A
    29. Chauhan VS
    30. Chitnis CE

    (2018) Malaria vaccine candidate based on Duffy-binding protein elicits strain transcending functional antibodies in a Phase I trial

    npj Vaccines 3:.

    https://doi.org/10.1038/s41541-018-0083-3

    • PubMed
    • Google Scholar
61. 1. Singh B
    2. Daneshvar C

    (2013) Human infections and detection of Plasmodium knowlesi

    Clinical Microbiology Reviews 26:165–184.

    https://doi.org/10.1128/CMR.00079-12

    • PubMed
    • Google Scholar
62. 1. Smolarek D
    2. Hattab C
    3. Hassanzadeh-Ghassabeh G
    4. Cochet S
    5. Gutiérrez C
    6. de Brevern AG
    7. Udomsangpetch R
    8. Picot J
    9. Grodecka M
    10. Wasniowska K
    11. Muyldermans S
    12. Colin Y
    13. Le Van Kim C
    14. Czerwinski M
    15. Bertrand O

    (2010) A recombinant dromedary antibody fragment (VHH or nanobody) directed against human Duffy antigen receptor for chemokines

    Cellular and Molecular Life Sciences 67:3371–3387.

    https://doi.org/10.1007/s00018-010-0387-6

    • PubMed
    • Google Scholar
63. 1. Tachibana S
    2. Kawai S
    3. Katakai Y
    4. Takahashi H
    5. Nakade T
    6. Yasutomi Y
    7. Horii T
    8. Tanabe K

    (2015) Contrasting infection susceptibility of the Japanese macaques and cynomolgus macaques to closely related malaria parasites, Plasmodium vivax and Plasmodium cynomolgi

    Parasitology International 64:274–281.

    https://doi.org/10.1016/j.parint.2014.10.004

    • PubMed
    • Google Scholar
64. 1. Thomas JA
    2. Collins CR
    3. Das S
    4. Hackett F
    5. Graindorge A
    6. Bell D
    7. Deu E
    8. Blackman MJ

    (2016) Development and application of a simple plaque assay for the human malaria parasite Plasmodium falciparum

    PLOS ONE 11:e0157873.

    https://doi.org/10.1371/journal.pone.0157873

    • PubMed
    • Google Scholar
65. 1. VanBuskirk KM
    2. Sevova E
    3. Adams JH

    (2004) Conserved residues in the Plasmodium vivax Duffy-binding protein ligand domain are critical for erythrocyte receptor recognition

    PNAS 101:15754–15759.

    https://doi.org/10.1073/pnas.0405421101

    • PubMed
    • Google Scholar
66. 1. Wagner JC
    2. Platt RJ
    3. Goldfless SJ
    4. Zhang F
    5. Niles JC

    (2014) Efficient CRISPR-Cas9-mediated genome editing in Plasmodium falciparum

    Nature Methods 11:915–918.

    https://doi.org/10.1038/nmeth.3063

    • PubMed
    • Google Scholar
67. Report

    1. WHO

    (2018) World Malaria Report

    World Health Organization.

    https://www.who.int/malaria/publications/world-malaria-report-2018/en/

    • Google Scholar
68. 1. Zhang C
    2. Gao H
    3. Yang Z
    4. Jiang Y
    5. Li Z
    6. Wang X
    7. Xiao B
    8. Su XZ
    9. Cui H
    10. Yuan J

    (2017) CRISPR/Cas9 mediated sequential editing of genes critical for ookinete motility in Plasmodium yoelii

    Molecular and Biochemical Parasitology 212:1–8.

    https://doi.org/10.1016/j.molbiopara.2016.12.010

    • PubMed
    • Google Scholar
69. 1. Zischewski J
    2. Fischer R
    3. Bortesi L

    (2017) Detection of on-target and off-target mutations generated by CRISPR/Cas9 and other sequence-specific nucleases

    Biotechnology Advances 35:95–104.

    https://doi.org/10.1016/j.biotechadv.2016.12.003

    • PubMed
    • Google Scholar

Author details

1. Franziska Mohring

   Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

   Contribution

   Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing

   Competing interests

   No competing interests declared

   "This ORCID iD identifies the author of this article:" 0000-0003-4726-6693

2. Melissa Natalie Hart

   Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

   Contribution

   Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—review and editing

   Competing interests

   No competing interests declared

3. Thomas A Rawlinson

   The Jenner Institute, University of Oxford, Oxford, United Kingdom

   Contribution

   Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing

   Competing interests

   No competing interests declared

4. Ryan Henrici

   Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

   Contribution

   Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing

   Competing interests

   No competing interests declared

5. James A Charleston

   Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

   Contribution

   Data curation, Formal analysis, Validation, Investigation, Methodology, Writing—review and editing

   Competing interests

   No competing interests declared

6. Ernest Diez Benavente

   Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

   Contribution

   Data curation, Formal analysis, Investigation, Methodology, Writing—review and editing

   Competing interests

   No competing interests declared

7. Avnish Patel

   Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

   Contribution

   Resources, Investigation, Methodology, Writing—review and editing

   Competing interests

   No competing interests declared

8. Joanna Hall

   Division of Infectious Disease Diagnostics, National Institute for Biological Standards and Control, Health Protection Agency, Hertfordshire, United Kingdom

   Contribution

   Resources, Investigation, Writing—review and editing

   Competing interests

   No competing interests declared

9. Neil Almond

   Division of Infectious Disease Diagnostics, National Institute for Biological Standards and Control, Health Protection Agency, Hertfordshire, United Kingdom

   Contribution

   Resources, Supervision, Writing—review and editing

   Competing interests

   No competing interests declared

10. Susana Campino

    Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

    Contribution

    Resources, Supervision, Funding acquisition, Investigation, Writing—review and editing

    Competing interests

    No competing interests declared

11. Taane G Clark

    Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

    Contribution

    Supervision, Funding acquisition, Writing—review and editing

    Competing interests

    No competing interests declared

    "This ORCID iD identifies the author of this article:" 0000-0001-8985-9265

12. Colin J Sutherland

    Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

    Contribution

    Supervision, Funding acquisition, Writing—review and editing

    Competing interests

    No competing interests declared

    "This ORCID iD identifies the author of this article:" 0000-0003-1592-6407

13. David A Baker

    Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

    Contribution

    Resources, Supervision, Funding acquisition, Writing—review and editing

    Competing interests

    No competing interests declared

14. Simon J Draper

    The Jenner Institute, University of Oxford, Oxford, United Kingdom

    Contribution

    Conceptualization, Resources, Supervision, Funding acquisition, Methodology, Project administration, Writing—review and editing

    Competing interests

    No competing interests declared

    "This ORCID iD identifies the author of this article:" 0000-0002-9415-1357

15. Robert William Moon

    Faculty of Infectious and Tropical Diseases, London School of Hygiene & Tropical Medicine, London, United Kingdom

    Contribution

    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing

    For correspondence

    rob.moon@lshtm.ac.uk

    Competing interests

    No competing interests declared

    "This ORCID iD identifies the author of this article:" 0000-0002-9070-4292

• 4,135

  views

• 525

  downloads

• 65

  citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.