1. Evolutionary Biology
  2. Genetics and Genomics
Download icon

The distribution of fitness effects among synonymous mutations in a gene under directional selection

  1. Eleonore Lebeuf-Taylor
  2. Nick McCloskey
  3. Susan F Bailey
  4. Aaron Hinz
  5. Rees Kassen  Is a corresponding author
  1. University of Ottawa, Canada
  2. Clarkson University, United States
Research Article
Cite this article as: eLife 2019;8:e45952 doi: 10.7554/eLife.45952
4 figures, 2 tables, 1 data set and 2 additional files

Figures

Distributions of relative fitness effects of gtsB point mutations in low glucose media.

(A) Counts of nonsynonymous (blue; n = 71) and synonymous (red; n = 39) mutations display a wide range of fitness effects, with ticks under the bars indicating the relative fitness values of nonsense mutations. Dashed and dotted lines show the mean relative fitness of the wild type (WT) competed against the marked competitor. (B) The DFE of beneficial-effect mutations (proportions; pooled synonymous and nonsynonymous samples, n = 55) is fit by a κ value of −0.35, which corresponds to the Weibull domain of attraction of the Generalised Pareto Distribution. On this normalised histogram (total area = 1), relative fitness values are shifted to the smallest observed value and expressed as selection coefficients. See Figure 1—source data 1.

https://doi.org/10.7554/eLife.45952.002
Figure 1—source data 1

Relative fitness estimates from competitions.

The experimental fitness data found in this file were also used to create Figure 4.

https://doi.org/10.7554/eLife.45952.003
Figure 1—source code 1

Analysis of distributions of fitness effects.

https://doi.org/10.7554/eLife.45952.015
Figure 2 with 1 supplement
Comparison of transcriptional and translational effects of the evolved mutants and correlation with relative fitness.

(A) The schematic shows the sites of YFP insertion for transcriptional and translational fusions. The plot compares maximum YFP expression (± SEM) from transcriptional and translational YFP fusions at the Tn7 site for the WT (n = 14 replicates) and evolved mutants (n = 7, 7, and six technical replicates, respectively). Significance with respect to transcriptional fusion: ***p<0.001. See Figure 2—source data 1. (B) Linear regression of fluorescent signal of YFP transcriptional fusions as a proxy for transcript levels and relative fitness measures for a subset of synonymous mutations (n = 27). Grey shading indicates the 95% confidence interval for the regression (adjusted R2 = 0.69, p<0.001). See Figure 2—source data 2. (C) Expression of transcriptional YFP fusions inserted across the gts operon of evolved mutants. Maximum fluorescence (± SEM) of the YFP transcriptional fusions at different loci in the gts operon relative to SBW25. See Figure 2—source data 3; YFP fusion positions are depicted in Figure 2—figure supplement 1. **p<0.01, ***p<0.001.

https://doi.org/10.7554/eLife.45952.004
Figure 2—source data 1

YFP expression for transcriptional and translational fusions after gtsB at the Tn7 site.

https://doi.org/10.7554/eLife.45952.006
Figure 2—source data 2

YFP expression for transcriptional fusions after gtsB in the native site for a subset of synonymous mutations.

https://doi.org/10.7554/eLife.45952.007
Figure 2—source data 3

YFP expression for transcriptional fusions across the gts operon.

https://doi.org/10.7554/eLife.45952.008
Figure 2—source code 1

Source code for Figure 2C: analysis of YFP expression and fitness.

https://doi.org/10.7554/eLife.45952.016
Figure 2—figure supplement 1
Schematic depicting positions of YFP transcriptional fusions within the native gts operon.
https://doi.org/10.7554/eLife.45952.005
Figure 3 with 1 supplement
Potential mechanism for fitness differences at different loci in gtsB.

(A) Bars represent the mean of each variable in units relative to the WT. Experimental relative fitness and transcriptional expression of YFP measures include standard error. See Figure 3—source data 1. (B) Locations of potential transcriptional start sites in the gts operon are represented by vertical arrows. 5’ ends were identified by 5’ RACE analysis of RNA isolated from cultures of the wild type (SBW25) and four gtsB mutants. The location of each gtsB mutation is indicated by a red line, and the nucleotide distance from each 5’ end to the nearest start codon is given. See Figure 3—source data 2; sequence information for the 5’ RACE analysis is found in Figure 3—figure supplement 1.

https://doi.org/10.7554/eLife.45952.009
Figure 3—source data 1

YFP, fitness and promoter strength data.

https://doi.org/10.7554/eLife.45952.011
Figure 3—source data 2

5RACE experiment results.

https://doi.org/10.7554/eLife.45952.012
Figure 3—source code 1

Analysis of promoter strength.

https://doi.org/10.7554/eLife.45952.017
Figure 3—figure supplement 1
Locations of potential transcriptional start sites in the gts operon.

The precise nucleotide positions of the 5’ ends are highlighted yellow within the intergenic (pink) and coding sequences of gtsA (green), gtsB (blue), and gtsC (brown). Positions of gtsB mutations (A10T, A15A, G38G, and 232–3T) are in red text and underlined. Predicted promoter sites using Softberry’s BPROM prediction software are highlighted grey.

https://doi.org/10.7554/eLife.45952.010
Beneficial synonymous mutations (red) are often observed in the phylogeny of related Pseudomonads, while nonsynonymous mutations are less so (blue).

There was a significant logarithmic relationship between the probability of observing a given mutation as a binary variable (present/absent) and relative fitness (p=0.0121).

https://doi.org/10.7554/eLife.45952.013
Figure 4—source code 1

Phylogenetic analysis.

https://doi.org/10.7554/eLife.45952.018

Tables

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background (Pseudomonas fluorescens)SBW25; wild typePMID: 8564013Ancestral strain
Strain, strain background (Pseudomonas fluorescens)SBW25-lacZPMID: 17669526SBW25 with neutral chromosomal lacZ insertion
Strain, strain background (Escherichia coli)DH5α λpirPMID: 11207743E. coli cloning strain
Recombinant DNA reagentpAH79 (plasmid)PMID: 24912567P. fluorescens allelic exchange vector
Recombinant DNA reagentgtsB mutagenesis vector (plasmid)This paperpAH79 modified for Golden Gate Assembly of mutant gtsB alleles
Genetic reagent
(Pseudomonas fluorescens)
gtsB site-directed mutagenesis libraryThis paperCollection of gtsB single nucleotide mutants in SBW25 background
Recombinant DNA reagentpUC18T-mini-Tn7T-Gm (plasmid)PMID: 15908923GenBank: AY599232.2Source of mini-Tn7T-Gm transposon
Recombinant DNA reagentpUC18T-mini-Tn7T-Gm-eYFP (plasmid)PMID: 17406227GenBank: DQ493879.2Source of YFP
Genetic reagent (Pseudomonas fluorescens)Mini-Tn7 gtsB-YFP transcriptional fusionsThis paperTranscriptional YFP fusions at SBW25 Tn7 site (see Figure 2A and B)
Genetic reagent (Pseudomonas fluorescens)Mini-Tn7 gtsB-YFP translational fusionsThis paperTranslational YFP fusions at SBW25 Tn7 site (see Figure 2A)
Genetic reagent (Pseudomonas fluorescens)gts operon YFP transcriptional fusionsThis paperTranscriptional YFP fusions at sites within gts operon (see Figure 2C and Figure 2C—figure supplement 1)
Table 1
Oligonucleotides used in this study.

Restriction enzyme recognition sequences are capitalised. BsaI overhangs are underlined. Introduced mutations are in bolded capital letters. Additional oligonucleotides used for site-directed mutagenesis are listed in Tables S1 and S2 of Supplementary file 1.

https://doi.org/10.7554/eLife.45952.014
NameSequence (5’ to 3’)Function
F2-pUC19-BsaIgcgAGATCTgtcgtGAGACCggtgatgacggtgaaaacctgtsB mutagenesis vector construction
R3-pUC19-MfeI-SpeIactgcgACTAGTCAATTGattaatgcagctggcacgacgtsB mutagenesis vector construction
F-800RightactgcgCAATTGagaccccggaagacatcaggtsB mutagenesis vector construction
R-800RightactgcgTCTAGAcattgcgaagttcaagcgtagtsB mutagenesis vector construction
F2-gtsB-FactgcgGGTCTCagtcgaaaagtcgcgacctacatggConserved gtsB forward primer
R3-gtsB-RactgcgGGTCTCctgccggaCaccacggtcggccagctcConserved gtsB reverse primer
4845-M13FGTAAAACGACGGCCAGTTCCGACAGGCTGTAGTCCTTgtsB sequencing primer
R2-M13R-gtsBGGAAACAGCTATGACCATGTGGTCCTCAGCTCGGAATAgtsB sequencing primer
SP1ACCACACCGAACAGGAAGTC5’ RACE cDNA synthesis
B-SP2ACTGCGTCTAGAGACCAAGGTGATACCGATAAACA5’ RACE gtsB amplification
B-SP3ACTGCGTCTAGACGAACAAGGCCAGGTTTTT5’ RACE gtsB amplification
A-SP2ACTGCGTCTAGATTTCTTGTCGAGCAGGGAGT5’ RACE gtsA amplification
A-SP3ACTGCGTCTAGATTCTTCTTTGGCGACGTCTT5’ RACE gtsA amplification

Data availability

Genomic data has been deposited into the NCBI Sequence Read Archive as BioProject PRJNA515918. All other data generated during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 1, 2, and 3.

The following data sets were generated
  1. 1
    NCBI Sequence Read Archive
    1. E Lebeuf-Taylor
    2. N McCloskey
    3. SF Bailey
    4. A Hinz
    5. R Kassen
    (2019)
    ID BioProject PRJNA515918. Pseudomonas fluorescens SBW25 gtsB mutants.

Additional files

Supplementary file 1

Sequences of gtsB mutagenesis primers are found in Tables S1 and S2.

https://doi.org/10.7554/eLife.45952.019
Transparent reporting form
https://doi.org/10.7554/eLife.45952.020

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)