1. Cell Biology
  2. Developmental Biology

CCN1 interlinks integrin and hippo pathway to autoregulate tip cell activity

  1. Myo-Hyeon Park
  2. Ae kyung Kim
  3. Sarala Manandhar
  4. Su-Young Oh
  5. Gun-Hyuk Jang
  6. Li Kang
  7. Dong-Won Lee
  8. Do Young Hyeon
  9. Sun-Hee Lee
  10. Hye Eun Lee
  11. Tae-Lin Huh
  12. Sang Heon Suh
  13. Daehee Hwang
  14. Kyunghee Byun
  15. Hae-Chul Park
  16. You Mie Lee  Is a corresponding author
  1. Research Institute of Pharmaceutical Sciences, College of Pharmacy, Kyungpook National University, Republic of Korea
  2. College of Natural Sciences, Kyungpook National University, Republic of Korea
  3. Korea University, Ansan Hospital, Republic of Korea
  4. POSTECH, Republic of Korea
  5. Chonnam National University Hospital, Korea
  6. DGIST, Republic of Korea
  7. Gachon University, School of Medicine, Republic of Korea
https://doi.org/10.7554/eLife.46012
Share this article
Cite this article
  1. Myo-Hyeon Park
  2. Ae kyung Kim
  3. Sarala Manandhar
  4. Su-Young Oh
  5. Gun-Hyuk Jang
  6. Li Kang
  7. Dong-Won Lee
  8. Do Young Hyeon
  9. Sun-Hee Lee
  10. Hye Eun Lee
  11. Tae-Lin Huh
  12. Sang Heon Suh
  13. Daehee Hwang
  14. Kyunghee Byun
  15. Hae-Chul Park
  16. You Mie Lee
(2019)
CCN1 interlinks integrin and hippo pathway to autoregulate tip cell activity
eLife 8:e46012.
https://doi.org/10.7554/eLife.46012
  2. Download BibTeX
  3. Download .RIS
8 figures, 2 videos, 2 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
CCN1 knockdown induces defects in vessel migration and sprouting as well as identity of endothelial cells in zebrafish vascular development.

(A) Scheme showing ccn1 gene exon and intron. Morpholinos (MO) binding to ccn1 ATG starting site (ATG MO) and intron 1/exon two boundary region (Splicing MO) denoted as red lines were synthesised …

https://doi.org/10.7554/eLife.46012.002
Figure 1—figure supplement 1
Download asset Open asset
Arterio-venous identity was altered in ccn1 MO embryos.

In situ hybridization of Notch-1b and Flt-4 was performed at 32 hpf in control and ccn1 MO-injected zebrafish embryos. The expression of Notch-1b was normally in neural tube (NT), DA and ISV and …

https://doi.org/10.7554/eLife.46012.003
Figure 2
Download asset Open asset
CCN1 stimulates tip cell activity in ECs.

(A) Mouse aorta isolated and cut at 6 weeks old, planted on Matrigel-coated plate and incubated for 7 days in presence or absence of CCN1 (10 ng/mL) or VEGF (10 ng/mL). Expression of CD31, DLL4, and …

https://doi.org/10.7554/eLife.46012.004
Figure 2—source data 1

Source data for Figure 2G.

https://doi.org/10.7554/eLife.46012.005
Figure 3 with 1 supplement
Download asset Open asset
CCN1-VEGFR2-MAPK, PI3K-YAP/TAZ signalling involved in CCN1-mediated tip cell activation.

(A) Nuclear localization of YAP/TAZ in HUVECs treated with CCN1 at 5, 10, or 50 ng/mL for 1 hr. (B) Western blotting of LATS, YAP, and TAZ and their phosphorylated forms in HUVECs treated with CCN1 …

https://doi.org/10.7554/eLife.46012.008
Figure 3—source data 1

Source data for Figure 3B, C, D, E, F, H, J, L.

https://doi.org/10.7554/eLife.46012.010
Figure 3—figure supplement 1
Download asset Open asset
Knockdown of CCN1 decreased tip cell markers.

(A) After starved for 16 hr, HUVECs were treated with serum for 10, 30 and 60 min and lysed for Western blot analysis against CCN1. (B) After transfection with siVEGF, starved HUVECs were treated …

https://doi.org/10.7554/eLife.46012.009
Figure 4
Download asset Open asset
mDia1is essential for CCN1-induced Cdc42 activation in tip cell formation.

(A) HUVECs were treated with PBS (Control) or CCN1 (10 ng/mL) for 24 hr, and total RNA was used for the detection of DIAPH1 (mDia1) mRNA expression by qRT-PCR. *p<0.001 vs. Control. (B) After …

https://doi.org/10.7554/eLife.46012.011
Figure 4—source data 1

Source data for Figure 4C.

https://doi.org/10.7554/eLife.46012.012
Figure 5 with 1 supplement
Download asset Open asset
Tip cell properties are induced by CCN1 via interactions between integrin αvβ3 and VEGFR2.

(A) HUVECs treated with CCN1 (10 ng/mL) for 24 hr in the presence or absence of cyclo(RGDfK) (1 μg/mL) were used for IP and immunoblotting analyses to detect interactions between integrin αvβ3 and …

https://doi.org/10.7554/eLife.46012.013
Figure 5—source data 1

Source data for Figure 5C and D.

https://doi.org/10.7554/eLife.46012.015
Figure 5—figure supplement 1
Download asset Open asset
The involvement of integrin αvβ3 in CCN1-induced activation of EC.

(A) Starved HUVECs were allowed to adhere to vitronectin (left) and fibronectin (right) after treated with CCN1 (10 ng/ml) or VEGF (10 ng/ml) in the presence or absence of integrin β3 monoclonal …

https://doi.org/10.7554/eLife.46012.014
Figure 6 with 2 supplements
Download asset Open asset
Endothelial CCN1 is crucial for sprouting angiogenesis.

(A, B) Whole mount retinas at postnatal day 5 (P5) stained with anti-IB4 antibody, allowing comparison of whole retina (upper) and peripheral retina ECs (lower) in WT and TG mice. Yellow dots …

https://doi.org/10.7554/eLife.46012.016
Figure 6—figure supplement 1
Download asset Open asset
Whole mount retinas at postnatal day 5 (p5) stained with anti-IB4 and CCN1 antibody in WT and TG mice.
https://doi.org/10.7554/eLife.46012.017
Figure 6—figure supplement 2
Download asset Open asset
CCN1 induces in vivo angiogenesis.

(A) CCN1 (10 ng/ml) in the presence or absence of cyclo(RGDfK) or SU5416 (1 μg/ml) were applied to the ED 4.5 CAM for two days, neovessel formation from the large vessels was observed, and …

https://doi.org/10.7554/eLife.46012.018
Figure 7 with 1 supplement
Download asset Open asset
Role of CCN1 in pathological angiogenesis and clinical correlation with integrin/Hippo pathway.

(A) LLC allograft tumour tissues in WT and Ccn1-EC-specific TG mice were extracted at 10 days after inoculation, sectioned, and immunostained with anti-CD31 and anti-PDGFβ antibodies and green and …

https://doi.org/10.7554/eLife.46012.019
Figure 7—figure supplement 1
Download asset Open asset
Negative correlation between mRNA expression levels of CCN1 and patient survival in several cancer.

(A, C) Difference in the survival curves of the two groups [CCN1 high (red line) and CCN1 low (blue line), 25% of patients with highest and lowest mRNA expression levels, respectively, n = 126/group]…

https://doi.org/10.7554/eLife.46012.020
Figure 8
Download asset Open asset
Schematic diagram depicting CCN1 induction of tip cell identity through interplay of integrin αvβ3/VEGFR2 with Hippo pathway.

CCN1 in the milieu is sensed by ECs by binding to membrane integrin αvβ3 and VEGFR2 receptors, thus activating the MAPK and PI3K-YAP/TAZ signalling pathways, leading to activation of YAP/TAZ. …

https://doi.org/10.7554/eLife.46012.021

Videos

Video 1
Download asset
CCN1 promoted EC migration.
https://doi.org/10.7554/eLife.46012.006
Video 2
Download asset
CCN1 promoted EC migration.
https://doi.org/10.7554/eLife.46012.007

Tables

Key resources table
Reagent
type(species)
or resource		DesignationSource or
reference		IdentifiersAdditional
information
Antibodyanti-Flk1(VEGFR2) (A-3)
(Mouse monoclonal)		Santa Cruzsc6251
RRID:AB_628431		WB(1:1000)
Antibodyanti-DLL4(H-70)
(Rabbit polyclonal)		Santa Cruzsc28915 RRID:AB_2092978WB(1:1000)
Antibodyanti-Sox17
(Goat polyclonal)		R and D SystemsAF1924
RRID:AB_355060		WB(1:1000)
Antibodyanti-p-VEGFR2 (Tyr1059)(D5A6)
(Rabbit monoclonal)		Cell Signalling3817
RRID:AB_2132351		WB(1:1000)
Antibodyanti-p-VEGFR2 (Tyr1175) (19A10)
(Rabbit monoclonal)		Cell Signalling2478
RRID:AB_331377		WB(1:1000)
Antibodyanti-p-ERK1/2 (Thr202/Tyr204) (197G2)
(Rabbit monoclonal)		Cell Signalling4377
RRID:AB_331775		WB(1:1000)
CyeAntibodyanti-ERK1/2 (137F5)
(Rabbit monoclonal)		Cell Signalling4695
RRID:AB_390779		WB(1:1000)
Antibodyanti-p-p38 (Thr180/Tyr182)
(Rabbit polyclonal)		Cell Signalling9211
RRID:AB_331641		WB(1:1000)
Antibodyanti-p38 (A-12)
(Mouse monoclonal)		Santa Cruzsc7972
RRID:AB_620879		WB(1:1000)
Antibodyanti- p85α (Z-8)
(rabbit polyclonal)		Santa Cruzsc423
RRID:AB_632211		WB(1:1000)
Antibodyanti- p-PI3-kinase p85 α (Tyr 508)
(goat polyclonal)		Santa Cruzsc12929
RRID:AB_2252313		WB(1:1000)
Antibodyanti-CCN1
(Rabbit polyclonal)		AbcamAb24448
RRID:AB_2088724		WB(1:1000) IHC (1:200)
Antibodyanti-CCN1
(Rabbit polyclonal)		Novus BiologicalsNB100-356
RRID:AB_10000986		(1:1000) neutralization
Antibodyanti-integrin αvβ3
(Mouse monoclonal)		Novus BiologicalsNB600-1342
RRID:AB_10003443		WB(1:1000)
Antibodyanti-p-STAT-3 (Tyr705) (D3A7) (Rabbit monoclonal)Cell signalling9145
RRID:AB_2491009		WB(1:1000)
Antibodyanti-p-STAT1(Tyr701)
(58D6)
(Rabbit monoclonal)		Cell signalling9167
RRID:AB_561284		WB(1:1000)
Antibodyanti-STAT3 (79D7)
(Rabbit monoclonal)		Cell signalling4904
RRID:AB_331269		WB(1:1000)
Antibodyanti-STAT1
(Rabbit polyclonal)		Cell signalling9172
RRID:AB_2198300		WB(1:1000)
Antibodyanti-p-YAP (Ser127)
(Rabbit polyclonal)		Cell signalling4911
RRID:AB_2218913		WB(1:1000)
Antibodyanti-YAP/TAZ (D24E4) (Rabbit monoclonal)Cell signalling8418
RRID:AB_10950494		WB(1:1000)
Antibodyanti-p-LATS1 (Thr1079)(D57D3) (Rabbit monoclonal)Cell signalling8654
RRID:AB_10971635		WB(1:1000)
IF (1:200)
Antibodyanti-LATS1(C66B5)
(Rabbit monoclonal)		Cell signalling3477
RRID:AB_2133513		WB(1:1000)
AntibodyAlexa-488–conjugated anti-isolectin B4InvitrogenI21411
RRID:AB_2314662		IHC (1:200)
Antibodyanti-VEGF
(Goat polyclonal)		R and D SystemsAF564
RRID:AB_2212821		(1:1000) neutralization
Antibodyanti-vinculin (EPR8185)
(Rabbit monoclonal)		Abcamab196579
RRID:AB_2810877		IF (1:200)
AntibodyCdc42
(Mouse monoclonal)		Cell signalling8747
RRID:AB_2810881		WB(1:1000)
AntibodyIntegrin β3 blocking IgG
(Mouse monoclonal)		MilliporeMAB1976
RRID:AB_2296419		Neutralization
AntibodyAnti-GFP (B-2)
(Mouse monoclonal)		Santa Cruzsc9996
RRID:AB_627695		WB(1:1000)
Antibodyanti-CD31
(Mouse monoclonal)		BD Biosciences553370
RRID:AB_2638986		IF (1:200)
AntibodyAnti-CD34
(Rabbit polyclonal)		BosterPA1334
RRID:AB_2810878		IF (1:200)
AntibodyAnti-DLL4
(Rat-monoclonal)		R and D systemsMAB1389
RRID:AB_2092985		IF (1:200)
OtherAlexa-488-phalloidinInvitrogenA12379IHC (1:200)
Chemical compound, drugJNK Inhibitor II anthra[1,9 cd]pyrazol-6(2H)-one-1,9-pyrazoloanthrone (SP600125)Calbiochem420119
Chemical compound, drugP38 MAP Kinase Inhibitor 4-(4-fluorophenyl)−2-(4-methylsulfinylphenyl)−5-(4-pyridyl)1H-imidazole (SB203580)Calbiochem559389
Chemical compound, drug2′-amino-3′-methoxyflavone (PD98059)Calbiochem513000
Chemical compound, drug2-(4-morpholinyl)−8-phenyl-4H-1-benzopyran-4-one (LY294002)Calbiochem440202
Chemical compound, drugVerteporfinSigma-AldrichSML0534
Chemical compound, drugCyclo(RGDfK)SelleckchemS7834
Peptide recombinant proteinCCN1R and D Systems4055
Peptide recombinant proteinVitronectinCorning354238
Peptide recombinant proteinfibronectinCorning354008
Commercial assay, or kitActive Cdc42 detection kitCell Signalling11859
Recombinant DNA reagentpEG-DIAPH1Pro Jung Weon Lee (College of Pharmacy, Seoul National University)
Recombinant DNA reagentpEG-DIAPH1 ΔN3Prof. Jung Weon Lee (College of Pharmacy, Seoul National University)
Recombinant DNA reagentpGL3-CCN1
(cloned on VE-cadherin promoter)		This paperProgenitors: PCR, pGL3
Recombinant DNA reagentpGL3-DLL4 luciferase plasmidProf. Young Geun Kwon
Yonsei University
Recombinant DNA reagentpRL-SV40 plasmidPromegaE2231
Sequence-based reagentsiRNA:siCCN1QiagenSI03053477
SI03028655
SI02626428
SI02626421
Sequence-based reagentsiRNA: siIntegrin β3QiagenSI02664095
SI02628094
SI00034188
SI00034174
Sequence-based reagentNegative control siRNAQiagenSI03650325
Cell line
(H. sapiens)		HUVECATCCCRL-1730
RRID:CVCL_2959
Cell line
(H. sapiens)		EA.hy926ATCCCRL-2922
RRID:CVCL_3901
Cell line
(M. musculus)		LCCATCCCRL-1642
RRID:CVCL_4358
Transgenic miceCcn1-TG (Chd5:Ccn1, C57BL/6J)Macrogen, Seoul, Korea
Transgenic zebrafish
(D. rerio)		hemizygous TG (flk-1:EGFP)s843Korea Zebrafish Organogenesis Mutant Bank (ZOMB) at Kyungpook National University
Jin et al., 2005
Sequence-based reagentccn1 MO (D. rerio)
5′-CTCCGCTGACACACACACACAGGAC-3′		Gene-Tools, Philomathccn1-l2, ENSDARG00000099985
Software, algorithmPrismGraphpad SoftwareRRID:SCR_002798
Software, algorithmImageJhttps://imagej.nih.gov/ij/RRID:SCR_003070
Software, algorithmedgeR packagehttp://www.bioconductor.org./help/search/index.html?q=edger+package/
Robinson et al., 2010		RRID:SCR_012802
Software, algorithmquantile normalisationhttp://bioconductor.org
Bolstad et al., 2003		RRID:SCR_001786
Software, algorithmKaplan–Meier estimationhttps://www.xlstat.com/en/solutions/features/kaplan-meier-analysis
Bewick et al., 2004
NCI Genomic Data Commons (GDC)Data Portalhttps://gdc-portal.nci.nih.gov
Grossman et al., 2016
Table 1
Gene primer sequences for qPCR.
https://doi.org/10.7554/eLife.46012.022
Gene nameForwardReverse
DLL4ATTCGTCACCTGGATCCTTCTCATTCTGGGCCAGTTGTAA
SOX17CAGACTCCTGGGTTTTTGTTGTTGCTGGAAATGGAGGAAGCTGTTTTGGGACAC
ROBO4GACGGGAATCAGAACCACTTCAGAGAAACACAGGCCAAGA
VEGFR2CTCGGGTCCATTTCAAATCTGCTGTCCCAGGAAATTCTGT
JAG1AAGGCTTCACGGGAACATACAGCCGTCACTACAGATGCAC
NOTCH1AAGATGCTCCAGCAACACAGGGCTCTGGCAAGTCTCCTAC
β-actinGGATGTCCACGTCACACTTCCACTCTTCCAGCCTTCCTTC
DIAPH1CAAGACAACCTCTTGTGCCCGCTCCGAAGCTAGCAGAGAT

Additional files

Transparent reporting form
https://doi.org/10.7554/eLife.46012.023

Download links