HSV-1 single-cell analysis reveals the activation of anti-viral and developmental programs in distinct sub-populations
- The University of Chicago, United States
Figures
Figure 1 with 4 supplements
Cell-to-cell variability in infection dynamics and viral gene expression.
(A) HDFn cells were infected with HSV-1 expressing ICP4-YFP and analyzed by time-lapse fluorescent imaging and scRNA-seq. (B) Distribution of the initial time of ICP4 expression. The black line …
Figure 1—figure supplement 1
Technical data relating to single-cell RNA-sequencing.
(A) Flow chart describing the generation of a DGE (digital expression matrix) from raw sequencing data and the filtering criteria applied at different stages to the generation of the final DGE. Note …
Figure 1—figure supplement 2
Joint analysis of host +viral genes in mock and wt-infected HDFn.
The left panel shows the identity of the cells (blue = mock, purple = wt infected) and the right panel shows the level of HSV-1 gene expression (blue = low, red = high). Highly infected cells …
Figure 1—figure supplement 3
Cell-to-cell variability in viral gene expression upon ΔICP0 infection.
(A) tSNE plot based on viral gene expression. Each dot represents a single cell and is colored according to the % of viral transcripts from blue (low) to red (high). The color bar is logarithmic. …
Figure 1—video 1
Live imaging of HDFn infected by wildtype HSV-1 expressing ICP4-YFP.
https://doi.org/10.7554/eLife.46339.007
Figure 2 with 2 supplements
The anti-viral program is initiated in a rare sub-population of abortively infected cells.
(A) tSNE plot based on viral and host gene expression. Cells are colored according to their clustering. Cluster one is colored green and cluster two is colored purple. (B) tSNE plot as in panel (A). …
Figure 2—figure supplement 1
Cell-cycle is anti-correlated with viral gene expression and is a major source of transcriptional variability.
(A) tSNE plots based on viral and host gene expression (wildtype infection). (Left) Cells are colored according to their clustering. Cluster one is colored green, cluster two is colored blue and …
Figure 2—figure supplement 2
ISGs expression in single-cells infected by wildtype HSV-1.
Here we compare the expression of interferon-stimulated genes (ISGs) in the top (orange) and bottom (blue) 25% of cells, sorted according to the level of HSV-1 gene expression. The top left panel …
Figure 3 with 1 supplement
Anti-viral signaling in cells infected by ΔICP0 mutant.
(A) tSNE plot based on viral and host gene expression. Cells are colored according to their clustering. (B) tSNE plot as in panel (A), with cells colored according to the % expressed transcripts …
Figure 3—figure supplement 1
ISGs expression in single-cells infected by ΔICP0 HSV-1.
Here we compare the expression of interferon-stimulated genes) (ISGs) in the top (orange) and bottom (blue) 25% of cells, sorted according to the level of HSV-1 gene expression. The top left panel …
Figure 4 with 1 supplement
HSV-1 infection upregulates developmental pathways.
(A) Heat-map of genes that are significantly upregulated in ICP4+ cells, as compared to both mock-infected and ICP4– cells. RNA-sequencing was performed in duplicates denoted by the numbers 1 and 2 …
Figure 4—figure supplement 1
ΔICP0 infection upregulates developmental pathways.
(A) Heat-map of genes that are significantly upregulated in ICP4+ cells, as compared to both mock-infected and ICP4– cells. RNA-sequencing was performed in duplicates denoted by the numbers 1 and 2 …
Figure 5
Cellular reprogramming during HSV-1 infection.
(A) Bar plots showing the expression level (transcripts per million (TPM)) of selected examples of genes that participate in developmental pathways and are upregulated in HSV-1-infected cells. Black …
Figure 6 with 1 supplement
β-catenin translocates to the nucleus and concentrates in the viral replication compartments.
(A) Immunoflorescent staining of β-catenin in mock-infected (top) or HSV-1 infected (bottom) HDFn cells at 5 hr post infection. (B) Magnified images of the four cells denoted by dashed white boxes …
Figure 6—figure supplement 1
β-catenin translocates to the nucleus and concentrates in the viral replication compartments upon ΔICP0 infection.
(A) Immunofluorescent staining of β-catenin in ΔICP0-infected HDFn cells at 5 hr post infection. (B) Magnified images of the four cells denoted by dashed white boxes in panel (A), showing …
Figure 7
β-catenin is required for late viral gene expression and progeny production.
(A-D) HDFn treated with the β-catenin inhibitor iCRT14 or with vehicle alone (dimethyl sulfoxide (DMSO)) were infected with HSV-1 and analyzed for viral gene expression by RT-PCR at 5 hr post …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HDFn, primary human dermal fibrobalsts | Cascade Biologics | cat #C0045C | |
| Cell line (Homo sapiens) | A549 | Sigma-Aldrich | cat #86012804-1VL | |
| Cell line (Homo sapiens) | Mel624 | Mel624 is a patient-derived melanoma cell-line, generated by the lab of Professor Thomas Gajewski at the Univeristy of Chicago | ||
| Cell line (Cercopithecus aethiops) | Vero | Obtained from the lab of Matthew D Weitzman, University of Pennsylvania | Used to grow wildtype HSV-1 and for plaque assay | |
| Cell line (Homo sapiens) | U2OS | Obtained from the lab of Matthew D Weitzman, University of Pennsylvania | Used to grow δICP0 HSV-1 | |
| Strain, strain background (HSV-1) | Wild-type strain 17, ICP4-YFP | Everett et al., 2003 | Obtained from the lab of Matthew D Weitzman, University of Pennsylvania | |
| Strain, strain background (HSV-1) | δICP0 strain 17, ICP4-YFP | Everett et al., 2003 | Obtained from the lab of Matthew D Weitzman, University of Pennsylvania | |
| Antibody | β-catenin (mouse monoclonal) | R and D systems | MAB13291-SP | Used for IF 1:400 |
| Antibody | IRF3 (rabbit monoclonal) | Cell Signaling Technologies | cat #11904 | Used for IF 1:200 |
| Sequence-based reagent | QPCR primer ICP4 Fwd | IDT | GCGTCGTCGAGGTCGT | |
| Sequence-based reagent | QPCR primer ICP4 Rev | IDT | CGCGGAGACGGAGGAG | |
| Sequence-based reagent | QPCR primer ICP8 Fwd | IDT | CGACAGTAACGCCAGAAGCTC | |
| Sequence-based reagent | QPCR primer ICP8 Rev | IDT | GGAGACAAAGCCCAAGACGG | |
| Sequence-based reagent | QPCR primer gB Fwd | IDT | CACCGCTACTCCCAGTTTATGG | |
| Sequence-based reagent | QPCR primer gB Rev | IDT | CCCTTGGCGTTGATCTTGTC | |
| Sequence-based reagent | QPCR primer UL36 Fwd | IDT | CGGGTCAAAAAGGTATGCGGTGT | |
| Sequence-based reagent | QPCR primer UL36 Rev | IDT | TGTCGTACACGCTCCTAACCATTG | |
| Sequence-based reagent | QPCR primer IFIT1 Fwd | IDT | CCT CCT TGG GTT CGT CTA CA | |
| Sequence- based reagent | QPCR primer IFIT1 Rev | IDT | GAA ATG AAA TGT GAA AGT GGC TGA T | |
| Sequence- based reagent | QPCR primer IFIT2 Fwd | IDT | GCTGAATCCTGACAACCAGTACC | |
| Sequence- based reagent | QPCR primer IFIT2 Rev | IDT | CACCTTCCTCTTCACCTTCTTCAC | |
| Sequence-based reagent | QPCR primer CTNNB1 Fwd | IDT | GAGATGGCCCAGAATGCAGTT | |
| Sequence-based reagent | QPCR primer CTNNB1 Rev | IDT | GGTGCATGATTTGCGGGAC | |
| Sequence-based reagent | siRNA againstβ-catenin | Dharmacon | M-003482-00-0005 | |
| Sequence-based reagent | siRNA non-targeting | Dharmacon | D-001206-13-05 | |
| Commercial assay or kit | RNEasy PLUS minikit | QIAGEN | cat #74134 | |
| Chemical compound, drug | iCRT14 | Sigma-Aldrich | cat ##SML0203 | Stock made in DMSO - 20 mM. Used at 20 micromolar final concentration |
| Software, algorithm | Single cell RNA seq analysis | This paper | https://github.com/nirdrayman/single-cell-RNAseq-HSV1.git |
Additional files
-
Supplementary file 1
Differential gene expression identified by sRNAseq.
(A) Genes that are upregulated in highly infected cells (wildtype infection). (B) GO annotations associated with genes from tab (A). (C) Transcription factors enriched in the promoters of genes from tab (A). (D) Genes that are upregulated in highly infected cells (ΔICP0 infection). (E) GO annotations associated with genes from tab (D). (F) Transcription factors enriched in the promoters of genes from tab (D).
- https://doi.org/10.7554/eLife.46339.019
-
Supplementary file 2
Analysis of genes that are upregulated in ICP4-negative sorted cells.
(A) Genes that are upregulated in ICP4-negative cells (afer wildtype infection). (B) GO annotations associated with genes from tab (A). (C) Genes that are upregulated in ICP4-negative cells (after ΔICP0 infection). (D) GO annotations associated with genes from tab (C). (E) Transcription factors enriched in the promoters of genes from tab (C).
- https://doi.org/10.7554/eLife.46339.020
-
Supplementary file 3
Analysis of genes upregulated in ICP4-positive sorted cells.
(A) Genes that are upregulated in ICP4-positive cells (after wildtype infection). (B) GO annotations associated with genes from tab (A). (C) Transcription factors that are enriched in the promoters of genes from tab (A). (D) Genes that are upregulated in ICP4-positive cells (after ΔICP0 infection). (E) GO annotations associated with genes from tab (D). (F) Transcription factors that are enriched in the promoters of genes from tab (D).
- https://doi.org/10.7554/eLife.46339.021
-
Transparent reporting form
- https://doi.org/10.7554/eLife.46339.022
