Myosin II isoforms play distinct roles in adherens junction biogenesis
- Université de Paris and CNRS UMR 7592, France
- Swansea University, United Kingdom
- Eindhoven University of Technology, Netherlands
- Sorbonne Université and CNRS UMR 7636, France
Figures
Figure 1 with 1 supplement
Development of an in vitro system for the study of junction biogenesis.
(a) Sequential steps for controlled initiation and visualization of junction biogenesis. The two cells are initially confined on a pair of fibronectin-coated 5 µm-away patterns (T0). When desired, …
-
Figure 1—source data 1
Development of anin vitrosystem for the study of junction biogenesis.
- https://doi.org/10.7554/eLife.46599.005
Figure 1—figure supplement 1
Reversal of nucleus-centrosome polarity axis after cell-cell contact.
(a) Scheme depicting the switchable micro-patterning strategy used for confinement release (click chemistry). (b) Spinning disk image sequence of GFP-E-cadherin and RFP-Pericentrin of doubled …
-
Figure 1—figure supplement 1—source data 1
Reversal of nucleus-centrosome polarity axis after cell-cell contact.
- https://doi.org/10.7554/eLife.46599.004
Figure 2 with 1 supplement
NMIIA and NMIIB are both required for proper junction biogenesis.
(a, b) Left panels: Representative immunoblots showing the isoform specific knockdown of NMIIA (a) and NMIIB (b) in NMIIA KD and NMIIB KD MDCK cells. GAPDH expression levels were used as loading …
-
Figure 2—source data 1
NMIIA and NMIIB are both required for proper junction biogenesis.
- https://doi.org/10.7554/eLife.46599.010
Figure 2—figure supplement 1
Isoform-specific NMII Knock-down in MDCK cells.
(a, b) Original uncropped Immunoblots presented in Figure 2a (a) and 2b (b).
Figure 3 with 2 supplements
NMIIB, but not NMIIA, localizes to early AJs.
(a, b) Representative confocal images and zoom boxes of GFP-E-cadherin-expressing MDCK cell doublets fixed 20 hr after BCN-RGD addition and immuno-stained for NMIIA (a) or NMIIB (b) Scale bar: 10 …
-
Figure 3—source data 1
NMIIB, but not NMIIA, localizes to early AJs.
- https://doi.org/10.7554/eLife.46599.017
Figure 3—figure supplement 1
NMIIA and NMIIB exhibit differential localizations in early AJs.
(a, b) Representative confocal images of MDCK cell doublets fixed 20 hr after BCN-RGD addition and stained for F-actin, NMIIA and NMIIC (a) or F-actin, NMIIB and Vimentin (b) as indicated. Scale …
-
Figure 3—figure supplement 1—source data 1
NMIIA and NMIIB exhibit differential localizations in early AJs.
- https://doi.org/10.7554/eLife.46599.014
Figure 3—figure supplement 2
NMIIB, but not NMIIA, localizes to early epithelial AJs.
(a) Representative confocal images of WT MDCK cells plated on fibronectin-coated glass for 1 or 3 days and stained for F-actin, NMIIA and NMIIB. Scale bar: 10 µm. (b) Representative confocal images …
-
Figure 3—figure supplement 2—source data 1
NMIIB, but not NMIIA, localizes to early epithelial AJs.
- https://doi.org/10.7554/eLife.46599.016
Figure 4
NMIIB localizes to a junctional actin network distinct from NMIIA-associated actin.
(a–b) SIM (Structured Illumination Microscopy) images of WT MDCK cells fixed 20 hr after addition of BCN-RGD and stained as indicated. Scale bar: 3 µm. (c) Relative intensity profiles (raw and …
-
Figure 4—source data 1
NMIIB localizes to a junctional actin network distinct from NMIIA-associated actin.
- https://doi.org/10.7554/eLife.46599.019
Figure 5 with 1 supplement
NMIIB supports juxtamembrane actin organization and regulates α-catenin unfolding.
(a) SIM (Structured Illumination Microscopy) images of junctional areas from Ctrl, NMIIA KD and NMIIB KD cells fixed 20 hr after addition of BCN-RGD and stained for F-actin and β-catenin. Scale bar: …
-
Figure 5—source data 1
NMIIB supports juxtamembrane actin organization and regulates α-catenin unfolding.
- https://doi.org/10.7554/eLife.46599.022
Figure 5—figure supplement 1
NMIIB supports junctional actin organization.
Related to Figure 5a: other examples of junctional actin organization in Ctrl, NMIIA KD and NMIIB KD cells. (a, b) SIM (Structured Illumination Microscopy) images of junctional area from Ctrl, NMIIA …
Figure 6 with 3 supplements
NMIIA and NMIIB are both required for establishment of proper inter-cellular stress.
(a) Heat map with vectorial field of traction forces (left panels) and ellipse representation of intra-cellular stress (right panel, the two axes represent the direction and magnitude of the …
-
Figure 6—source data 1
NMIIA and NMIIB are both required for establishment of proper inter-cellular stress.
- https://doi.org/10.7554/eLife.46599.030
Figure 6—figure supplement 1
NMIIA regulates cell adhesion and traction forces on fibronectin.
(a) Representative confocal images of paxillin and F-actin staining of Ctrl, NMIIA KD and NMIIB KD single cells plated on fibronectin-coated glass coverslip for 16 hr. Scale bar: 10 µm. (b, c) …
-
Figure 6—figure supplement 1—source data 1
NMIIA regulates cell adhesion and traction forces on fibronectin.
- https://doi.org/10.7554/eLife.46599.025
Figure 6—figure supplement 2
NMIIB favors E-cadherin clustering on E-cadherin-coated substrate.
(a) Confocal images with zoom boxes of Ctrl, NMIIA KD and NMIIB KD cells plated on E-cadherin-coated glass for 6 hr and immuno-stained for β-catenin and F-actin. Scale bar: 10 µm. (b) Scheme …
-
Figure 6—figure supplement 2—source data 1
NMIIB favors E-cadherin clustering on E-cadherin-coated substrate.
- https://doi.org/10.7554/eLife.46599.027
Figure 6—figure supplement 3
NMIIA and NMIIB are both required for establishment of proper inter-cellular stress.
(a) Scheme depicting the junction subdomains and the orientation of traction forces relative to the junction axis quantified in (b) and (c). (b, c) Scatter plots with mean + /- SEM representing the …
-
Figure 6—figure supplement 3—source data 1
NMIIA and NMIIB are both required for establishment of proper inter-cellular stress.
- https://doi.org/10.7554/eLife.46599.029
Figure 7
Proposed model for the role of NMIIA and NMIIB during junction biogenesis.
Upper panels: organization of early cell-cell contacts of Ctrl, NMIIA KD and NMIIB KD cells. Lower panels: proposed molecular organization of early junctions. Middle panels: distribution of …
Author response image 1
NMIIB localizes to early AJs.
(a) Representative confocal images and zoom boxes of GFP-E-cadherin-expressing MDCK cell doublets fixed 20h after BCN-RGD addition and immuno-stained for NMIIB. Scale bar: 10 μm. (b) Relative …
Videos
Video 1
Dynamic of junction formation on reversible micropatterns.
Spinning disk movie showing contact formation between two MDCK cells expressing GFP-E-cadherin and stained with Hoechst. Scale bar: 10 µm.
Video 2
Dynamic of junction formation in Y27-treated cells.
Spinning disk movie of MDCK cells expressing GFP-E-cadherin, stained with Hoechst and treated with 50 µM Y27. Scale bar: 10 µm.
Video 3
Dynamic of junction formation in Ctrl, NMIIA KD and NMIIB KD cells.
Epi-fluorescence movies of Ctrl, NMIIA KD and NMIIB KD MDCK cells expressing GFP-E-cadherin. Scale bar: 10 µm.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Canis familiaris, dog) | MDCK | ATCC | ATCC CCL-34 | |
| Cell line (H. sapiens) | Caco-2 | ATCC | ATCC HTB-37 | Kindly provided by S.Robine (Institut Cuire/CNRS, Paris) |
| Antibody | anti-NMIIA rabbit polyclonal | Biolegend | 909801 | 1/100 for IF and 1/1000 for WB |
| Antibody | anti-NMIIA mouse monoclonal | Abcam | ab55456 | 1/100 for IF and 1/1000 for WB |
| Antibody | rabbit anti-NMIIB polyclonal | Biolegend | 909901 | 1/100 for IF and 1/1000 for WB |
| Antibody | anti-β-catenin rabbit polyclonal | Sigma-Aldrich | C2206 | 1/100 for IF |
| Antibody | anti-β-catenin mouse monoclonal | BD Biosciences | 610156 | 1/100 for IF |
| Antibody | recombinant anti-paxillin rabbit monoclonal antibody | Abcam | Ab32084 | 1/100 for IF |
| Antibody | mouse anti-GAPDH | ProteinTech | 60004–1-Ig | 1/100 for IF |
| Antibody | mouse anti-Arp3 | Sigma-Aldrich | A5979 | 1/100 for IF |
| Antibody | mouse anti-E-cadherin | BD Biosciences | 610181 | 1/100 for IF |
| Antibody | rabbit anti-α-catenin polyclonal | Sigma-Aldrich | C-2081 | 1/100 for IF |
| Antibody | rat anti-α18-catenin monoclonal | generously provided by A. Nagafuchi, (Kumamoto University, Japan) | 1/100 for IF | |
| Antibody | Alexa488- | Life Technologies | A11039, A11055, A11013 | 1/250 for IF |
| Antibody | Alexa568- | Life Technologies | A11004, A11011, A11077 | 1/250 for IF |
| Antibody | Alexa647- | Life Technologies | A31571, A31573 | 1/250 for IF |
| Chemical compound, drug | Alexa (488) -coupled phalloidins | Invitrogen | A12379 | 1/250 for IF |
| Chemical compound, drug | Alexa (555 or 647) -coupled phalloidins | Life Technologies | A34055, A22287 | 1/250 for IF |
| Other | Hoechst 34580 | ThermoFisher | H3570 | 1/10000 for IF |
| Antibody | Horseradish peroxidase-coupled anti-mouse IgGs | Sigma-Aldrich | A9044 | 1/10000 for WB |
| Antibody | Horseradish peroxidase-coupled anti-rabbit IgGs | Pierce | 1/10000 for WB | |
| Chemical compound, drug | Mitomycin C | Sigma-Aldrich | M2487 | 10 μg/ml for 1 hr |
| Chemical compound, drug | Y-27632 dihydrochloride | Sigma-Aldrich | Y0503 | 50 μM |
| Other | APP (Azido-Poly-lysine Poly (ethylene glycol)) | Inspired protocol from M. van Dongen, Matthieu Piel | https://doi.org/10.1002/adma.201204474 | Inspired protocol from M. van Dongen, Matthieu Piel |
| Peptide, recombinant protein | BCN-RGD peptide (BCN: bicyclo[6.1.0]- nonyne, coupled to RGD: peptide sequence Arg-Gly-Asp) | Inspired protocol from M. van Dongen, Matthieu Piel | https://doi.org/10.1002/adma.201204474 | Inspired protocol from M. van Dongen, Matthieu Piel |
| Commercial assay or kit | DMEM (containing Glutamax, High Glucose and Pyruvate) | Life Technologies | 31966–021 | |
| Commercial assay or kit | Fluorobrite DMEM | Thermo Fisher | A18967-01 | |
| Commercial assay or kit | Penicillin/Streptomycin | Life Technologies | 15140–122 | |
| Commercial assay or kit | Foetal Bovine Serum | Life Technologies | S1810-500 | 10% FBS in DMEM |
| Commercial assay or kit | geneticin | Life Technologies | 10131–019 | |
| Chemical compound, drug | Trypsin | Life Technologies | 25300–054 | |
| Genetic reagent (Plasmid) | pLKO.1-puro | Sigma-Aldrich | SHC002 | |
| Genetic reagent (Plasmid) | MYH9 | Sigma-Aldrich | transcript ID: ENSCAFT00000002643.3 | TTGGAGCCATACAACAAATAC for NMIIA |
| Genetic reagent (Plasmid) | MYH10 | Sigma-Aldrich | transcript ID: ENSCAFT00000027478 | TCGGGCAGCTCTACAAAGAAT for NMIIB |
| Genetic reagent (Plasmid) | RFP-Pericentrin | kindly provided M. Coppey, Institut Jacques Monod, Paris | kindly provided M. Coppey, Institut Jacques Monod, Paris | |
| Genetic reagent (Plasmid) | m-Cherry cortactin | kindly provided by Alexis Gautreau, Biochemisty laboratory, Ecole polytechnique, France | https://portail.polytechnique.edu/bioc/en/gautreau | pcDNA5-FRT-GFP-mCherry-3pGW back bone (1740-pcDNAM FRTPC-mCherry Cortactine) |
| Genetic reagent (Plasmid) | mCherry Myosin IIB | Addgene | 55107 | |
| Genetic reagent (Plasmid) | CMV-GFP-NMHC II-A | Addgene | 11347 | |
| Chemical compound, drug | protease inhibitor cocktail | Roche | 27368400 | |
| Chemical compound, drug | phosphataseinhibitor (Phosphostop) | Roche | 4906837001 | |
| Commercial assay or kit | Bradford assay | BioRad | 500–0006 | |
| Commercial assay or kit | 4–12% Bis-Tris gel | Novex | NP0335 | |
| Commercial assay or kit | Supersignal west femto maximum sensitivity substrate | ThermoFisher | 34095 | |
| Commercial assay or kit | LookOut Mycoplasma PCR detection Kit | Sigma-Aldrich | MP0035 | |
| Chemical compound, drug | paraformaldehyde | Thermo Scientific | 22980 | |
| Chemical compound, drug | Fluoromount-G mounting media | Southern Biotech | ||
| Peptide, recombinant protein | fibronectin | Merck Millipore | FC010 | |
| Chemical compound, drug | APTES | Sigma-Aldrich | A3648 | |
| Chemical compound, drug | EDC-HCl | Thermo Scientific | 22980 | 2 mM freshly prepared in 0.1M MES pH4.7 |
| Chemical compound, drug | NHS | Sigma-Aldrich | 130672 | 5 mM |
| Peptide, recombinant protein | recombinant human E-cadherin | R and D systems | 8505-EC | 1 μg |
| Chemical compound, drug | Cy 52–276 A and Cy 52–276 B silicone elastomer | Dow corning | ||
| Chemical compound, drug | carboxylated red fluorescent beads | Invitrogen | F8801 | |
| Software, algorithm | FIJI-Image J | https://imagej.net/Fiji/Downloads | Image analysis were done using Fiji-Image J and plugins | |
| Software, algorithm | MATLAb | MATLAB | Traction force, PIV analysis were done using alogorithms developed in lab to analyse traction force | |
| Software, algorithm | Photoshop and Illustrator | Adobe | Images were mounted using these softwares | |
| Software, algorithm | GraphPad prism | GraphPad Prism | Graphs and statistical tests were done using GraphPad Prism |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.46599.032
