1. Developmental Biology
  2. Evolutionary Biology
Download icon

Embryo polarity in moth flies and mosquitoes relies on distinct old genes with localized transcript isoforms

  1. Yoseop Yoon
  2. Jeff Klomp
  3. Ines Martin-Martin
  4. Frank Criscione
  5. Eric Calvo
  6. Jose Ribeiro
  7. Urs Schmidt-Ott  Is a corresponding author
  1. University of Chicago, United States
  2. National Institute of Allergy and Infectious Diseases, United States
Research Article
  • Cited 0
  • Views 750
  • Annotations
Cite this article as: eLife 2019;8:e46711 doi: 10.7554/eLife.46711

Abstract

Unrelated genes establish head-to-tail polarity in embryos of different fly species, raising the question of how they evolve this function. We show that in moth flies (Clogmia, Lutzomyia), a maternal transcript isoform of odd-paired (Zic) is localized in the anterior egg and adopted the role of anterior determinant without essential protein change. Additionally, Clogmia lost maternal germ plasm, which contributes to embryo polarity in fruit flies (Drosophila). In culicine (Culex, Aedes) and anopheline mosquitoes (Anopheles), embryo polarity rests on a previously unnamed zinc finger gene (cucoid), or pangolin (dTcf), respectively. These genes also localize an alternative transcript isoform at the anterior egg pole. Basal-branching crane flies (Nephrotoma) also enrich maternal pangolin transcript at the anterior egg pole, suggesting that pangolin functioned as ancestral axis determinant in flies. In conclusion, flies evolved an unexpected diversity of anterior determinants, and alternative transcript isoforms with distinct expression can adopt fundamentally distinct developmental roles.

https://doi.org/10.7554/eLife.46711.001

eLife digest

With very few exceptions, animals have ‘head’ and ‘tail’ ends that develop when they are an embryo. The genes involved in specifying these ends vary between species and even closely-related animals may use different genes for the same roles. For example, the products of two unrelated genes called bicoid in fruit flies and panish in common midges accumulate at one end of their respective eggs to distinguish head from tail ends. It remained unclear how other fly species, which have neither a bicoid nor a panish gene, distinguish the head from the tail end, or how genes can evolve the specific function of bicoid and panish.

Cells express genes by producing gene templates called messenger ribonucleic acids (or mRNAs for short). The central portions of mRNAs, known as protein-coding sequences, are then used to produce the protein. Proteins can play several distinct roles, which they acquire through evolution. This can happen in different ways, for example, genetic mutations in the part of a gene that codes for protein may alter the resulting protein, giving it a new activity. Alternatively, sequences at the beginning and the end of an mRNA molecule that do not code for protein, but regulate when and where proteins are made, can influence a protein’s role by changing its environment. Many genes produce mRNAs with alternative sequences at the beginning or the end, a process known as alternative transcription.

Here, Yoon et al. identified three unrelated genes that perform similar roles to bicoid and panish in the embryos of several different moth flies and mosquitoes. These genes appear to have acquired their activity because one of their alternative transcripts accumulated at the future head end, rather than through mutations in the protein-coding sequences. Studying multiple species also made it clear that panish inherited its function from a localized alternative transcript of an old gene that duplicated and diverged.

These findings suggest that alternative transcription may provide opportunities for genes to evolve new roles in fundamental processes in flies. Most animal genes use alternative start and stop sites for transcription, but the reasons for this remain largely obscure. This is especially the case in the human brain. The findings of Yoon et al., therefore, raise the question of whether alternative transcription has played an important role in the evolution of the human brain.

https://doi.org/10.7554/eLife.46711.002

Introduction

The specification of the primary axis (head-to-tail) in embryos of flies (Diptera) offers important advantages for studying how new essential gene functions evolve in early development. This process rests on lineage-specific maternal mRNAs that are localized at the anterior egg pole (‘anterior determinants’), which, surprisingly, have changed during the evolution of flies. While the anterior determinants of most flies remain unknown, they can be identified by comparing the transcriptomes of anterior and posterior egg halves (Klomp et al., 2015). Furthermore, their function can be analyzed in the syncytial early embryos of a broad range of species via microinjection, considering timing and subcellular localization. It is therefore possible to conduct phylogenetic comparisons at the functional level. Finally, when the function of anterior determinants is suppressed, embryos develop into an unambiguous, predictable phenotype: these embryos lack all anterior structures and develop as two outward facing tail ends (‘double abdomen’).

Anterior determinants can be encoded by new genes with a dedicated function in establishing embryonic polarity. One example is bicoid in the fruit fly Drosophila melanogaster. Maternal mRNA of bicoid is localized in the anterior pole of the egg and Bicoid protein is expressed in a gradient in the early embryo (Berleth et al., 1988). Bicoid-deficient embryos fail to develop anterior structures and instead form a second tail end, or a symmetrical double abdomen when the maternal activity gradient of another gene, hunchback, is disrupted simultaneously (Driever, 1993). The bicoid gene originated in the lineage of cyclorrhaphan flies more than 140 million years ago by duplication of zerknüllt (zen; aka Hox3), which, in insects, plays an important role in extraembryonic tissue development (Schmidt-Ott et al., 2010). The expression and function of cyclorrhaphan bicoid orthologs are conserved but bicoid has not been found outside this group, and has been lost in some lineages within the Cyclorrhapha.

Another example is panish, which encodes the anterior determinant of a midge, Chironomus riparius. This gene evolved by gene duplication of the Tcf homolog pangolin (pan) and capture of the maternal promoter of a nucleoside kinase gene, and has been called panish (for pan“ish’) (Klomp et al., 2015). Pangolin functions as the effector of ß-catenin-dependent Wnt signaling pathway (‘canonical’ Wnt signaling) but Panish lacks the ß-catenin domain of Pangolin, and sequence similarity between Pangolin and Panish is limited to the cysteine-clamp domain (30 amino acids). panish has not been found outside the family Chironomidae, suggesting that lower dipterans use different anterior determinants.

Here, we have used embryos of a wider range of dipteran species that lack bicoid and panish to address the question of how anterior determinants evolve. We started our analysis with moth flies (Psychodidae: Clogmia albipunctata, Lutzomyia longipalpis) and subsequently extended it to mosquitoes (Culicidae: Culex quinquefasciatus, Aedes aegypti, Anopheles gambiae, Anopheles coluzzii), and to crane flies (Tipulidae: Nephrotoma suturalis) (Figure 1A). Our results reveal three distinct old genes that evolved anterior determinants by localizing an alternative maternal transcript isoform at the anterior egg pole of the respective species. Therefore, alternative transcription might have played an important role in the evolution of this gene function and gene regulatory networks in fly embryos.

Figure 1 with 1 supplement see all
Expression of alternative Cal-opa transcripts in Clogmia embryos.

(A) Phylogenetic relationship of fly species referred to in the text (Wiegmann et al., 2011). (B) Differential expression analysis of maternal transcripts between anterior and posterior halves of 1 hr-old Clogmia embryos. logFC: log fold-change. (C) Stage-specific RNA-seq read coverage of Cal-opa locus. Transcription start sites (TSS) and transcription termination sites (TTS) are indicated on the genomic scaffold (solid line with 1000 bp intervals marked) and were confirmed by RACE. Exon-intron sketches of Cal-opaMat and Cal-opaZyg transcript variants are shown with the open reading frame in black and the position of in situ hybridization probes and dsRNA underlined in blue. (D) RNA in situ hybridization of Cal-opaMat and Cal-opaZyg transcripts in 1 hr-old preblastoderm and 7 hr-old cellular blastoderm embryos. Anterior is left and dorsal up. Scale bar: 100μm.

https://doi.org/10.7554/eLife.46711.003

Results

An alternative maternal transcript of the conserved segmentation gene odd-paired functions as anterior determinant in Clogmia

We annotated 5602 transcripts from the anterior and posterior transcriptomes of 1 hr-old bisected Clogmia embryos and ranked them according to the magnitude of their differential expression scores and P values (Figure 1B). In the anterior embryo, the most enriched transcript was homologous to odd-paired, the Drosophila homolog of mammalian Zic (zinc finger of the cerebellum) genes. ZIC proteins are known to function as transcription factors or co-factors (Houtmeyers et al., 2013). odd-paired was discovered in a screen for early Drosophila segmentation genes and subsequently classified as a ‘pair-rule’ gene, since odd-paired mutants fail to develop alternating segments (Jürgens et al., 1984). During the Drosophila segmentation process, odd-paired is expressed in a single broad domain and controls the 'frequency-doubling' of other pair-rule genes (Clark and Akam, 2016).

The Clogmia genome contains a single odd-paired locus (Cal-opa) (Vicoso and Bachtrog, 2015). Using RNA-seq data from preblastoderm and blastoderm embryos and Rapid Amplication of cDNA Ends (RACE), we identified maternal and zygotic Cal-opa transcripts with alternative first exons that we mapped onto a 54 kb genomic scaffold (Figure 1C). The maternal transcript (Cal-opaMat) was detected in preblastoderm embryos (0.5 hr-old) and syncytial blastoderm embryos (4 hr-old). The zygotic transcript (Cal-opaZyg) was found in cellularized blastoderm embryos (7 hr-old) and gastrulating embryos (9 hr-old). Protein alignments with homologs from other flies suggest that Cal-opaZyg encodes the full-length Cal-Opa protein (655 amino acids), while Cal-opaMat encodes a truncated protein variant (635 amino acids), lacking the N-terminal 20 amino acids of Cal-OpaZyg (Figure 1—figure supplement 1).

To confirm the alternative Cal-opaMat and Cal-opaZyg transcripts and their non-overlapping expression patterns, we performed whole mount RNA in situ hybridization experiments with transcript-specific probes. The Cal-opaMat transcript was anteriorly localized in preblastoderm embryos but absent at the cellular blastoderm stage. Conversely, the Cal-opaZyg transcript was absent in preblastoderm embryos but expressed broadly in the trunk region of 7 hr-old blastoderm embryos (Figure 1D), like odd-paired in Drosophila. These observations suggest that Cal-opa produces transcript isoforms with spatially and temporally distinct expression patterns.

To determine the function of Cal-opaMat and Cal-opaZyg, we established a protocol for microinjecting early Clogmia embryos and conducted transcript-specific RNA interference (RNAi) experiments. Injection of Cal-opaMat double-stranded RNA (dsRNA) led to mirror-image duplications of the tail end (double abdomen; Figure 2A and Figure 2—figure supplement 1). In contrast, injection of dsRNA targeting Cal-opaZyg resulted in half the number of segmental expression domains of Cal-slp (the ortholog of pair-rule gene sloppy-paired) and caused defects in segmentation, dorsal closure, and head development but did not alter embryo polarity (Figure 2B). Finally, injection of dsRNA targeting both Cal-opaMat and Cal-opaZyg resulted in double abdomens with missing segments (Figure 2—figure supplement 2). These observations indicate distinct roles of Cal-opaMat and Cal-opaZyg in specifying embryo polarity and in segmentation, respectively.

Figure 2 with 5 supplements see all
Function of alternative Cal-opa transcripts in early Clogmia embryo.

(A) 1 st instar larval cuticle of wild type (top) and following Cal-opaMat RNAi (middle). RNA in situ hybridization of Cal-cad in a wild-type preblastoderm embryo (bottom left) and stage-matched Cal-opaMat RNAi embryos (bottom right). Anterior is left and dorsal up. T: thoracic segment; A: abdominal segment. Segment numbers in Cal-opaMat RNAi larval cuticle were assigned based on the assumption of polarity reversal. Scale bar: 100μm. (B) 1 st instar larval cuticle phenotype following Cal-opaZyg RNAi (top) and RNA in situ hybridization of Cal-slp in extending wild-type germband (middle) and stage-matched Cal-opaZyg RNAi embryo (bottom). Anterior is left and dorsal up. Md: mandibular segment; Mx: maxillary segment; Lb: labial segment; T: thoracic segment; A: abdominal segment. Scale bar: 100μm. (C) RNA in situ hybridizations of Cal-otd in wild-type gastrula (top left) and stage-matched embryo following posterior Cal-opaMat mRNA injection (top right) are shown in ventral view. A live wild-type embryo (bottom left) and a stage-matched embryo following posterior Cal-opaMat mRNA injection (bottom right) in lateral view. Anterior is left. Scale bar: 100μm. (D) Posterior injection of Cal-opa mRNA and mutated variants. Complete, symmetrical duplication of the bilateral Cal-otd expression domain in gastrulating embryos was counted as double head (blue, see Figure 2C). All other phenotypes, including incomplete duplications and wild type, were conservatively counted as ‘no double head’ (black). Sketches of predicted Cal-Opa proteins are shown with ZIC/Opa conserved motif (ZOC) in yellow, the ZIC family protein N-terminal conserved domain (ZFNC) in green, and zinc finger domains in orange. The Met21Leu mutation in Cal-OpaZyg-Met21Leu is marked in red. Cal-opaMat (late): Cal-opaMat was injected during the syncytial blastoderm stage (4 hr). ns: p>0.05; ***: p<0.001; ****: p<0.0001, Fisher’s exact test. (E) RNA in situ hybridization of Cal-nos4 in a gastrulating embryo (left) and stage-matched Cal-opaMat RNAi embryos (right).

https://doi.org/10.7554/eLife.46711.005

We noticed that maternal transcripts of Cal-slp and Cal-mira, a homolog of miranda, which encodes an adaptor protein for cell fate determinants in Drosophila (Ikeshima-Kataoka et al., 1997; Adams et al., 2000), were also slightly enriched in the anterior portion of embryo (Figure 1B). This observation was confirmed by RNA in situ hybridizations (Figure 2—figure supplement 3). Injection of Cal-slp dsRNA resulted in head and dorsal closure defects while Cal-mira dsRNA caused labrum and antennal defects, but in both cases embryo polarity was retained (Figure 2—figure supplement 3).

To test whether Cal-opaMat can induce head development ectopically, we injected Cal-opaMat mRNA into the posterior pole of 1 hr-old embryos. These embryos expressed a head marker, Cal-otd (ortholog of ocelliless/orthodenticle), on both ends of the embryo and developed a symmetrical double head, including some duplicated thoracic elements (Figure 2C and Figure 2—figure supplement 4 and Video 1). These observations suggest that anterior enrichment of maternal transcripts other than Cal-opaMat mRNA is not essential for head development, and that Cal-opaMat localization is sufficient for establishing embryo polarity.

Video 1
Live double head embryo in ventrolateral view.

The larval cuticle of this embryo is shown in Figure 3—figure supplement 1.

https://doi.org/10.7554/eLife.46711.011

The anterior determinant function of Cal-opa is sensitive to expression timing but insensitive to 5’ truncation of the open reading frame

Next, we asked whether the early timing of odd-paired expression is critical for its function as anterior determinant in moth flies. To test this hypothesis, we conducted posterior injections of Cal-opaMat mRNA during the syncytial blastoderm stage (4 hr) and examined Cal-otd expression after gastrulation. These embryos developed with normal head-to-tail polarity (Figure 2D). This result places the requirement of odd-paired for axis specification prior to the syncytial blastoderm stage and suggests that early timing of odd-paired activity is essential for its function as anterior determinant.

Cal-opaMat and Cal-opaZyg mRNAs not only differ in the timing of expression, but also differ in their 5’UTRs and predicted N-terminal protein sequences, as mentioned above (Figure 1C and Figure 1—figure supplement 1). To test whether the open reading frame difference is required for the anterior determinant function, we injected Cal-opaZyg mRNA at the posterior pole of preblastoderm embryos. Embryos from this experiment also developed as double heads (Figure 2D). Because the translation start site of Cal-OpaMat is located downstream of the Cal-OpaZyg translation start site, we also tested Cal-opaZyg mRNA in which the putative start codon for Cal-OpaMat was mutated to encode leucine (Cal-opaZyg-Met21Leu). Posterior injection of Cal-opaZyg-Met21Leu mRNA also resulted in double heads (Figure 2D). These findings indicate that the protein difference between Cal-OpaMat and Cal-OpaZyg is not essential for the anterior determinant function of odd-paired in Clogmia.

To test whether only a small portion of the Cal-opa open reading frame is required for its function as anterior determinant, we examined the ability of various truncated variants of Cal-Opa mRNAs (Figure 1—figure supplement 1) to induce head development at the posterior egg pole (Figure 2D). mRNAs of protein variants with large N-terminal truncation (Cal-Opa115-655 and Cal-Opa182-655) retained the ability to induce double heads. However, mRNAs of protein variants with C-terminal truncation (Cal-Opa182-445 and Cal-Opa1-337+22, a hypothetical splice variant) failed to induce double heads. These results indicate that the ability of Cal-Opa to specify embryo polarity requires the C-terminal portion of the protein but is largely insensitive to N-terminal truncation, corroborating our above conclusion that N-terminal differences between Cal-OpaMat and Cal-OpaZyg were not essential for evolving the anterior determinant function of Cal-opa.

Cal-opaMat suppresses zygotic germ cell specification at the anterior pole and Clogmia lacks maternal germ plasm

In Drosophila and other dipterans, maternal germ plasm in the posterior embryo not only specifies primordial germ cells but also contributes to and stabilizes embryo polarity via nanos, which suppresses the translation of anterior determinants in the posterior embryo (Tautz, 1988; Gavis and Lehmann, 1992; Struhl et al., 1992; Lemke and Schmidt-Ott, 2009). The activity of nanos in the posterior preblastoderm is dependent on oskar (Lehmann, 2016), which is conserved in many insects (Ewen-Campen et al., 2010). However, in Clogmia, expression profiling of anterior and posterior egg halves did not reveal any posteriorly localized maternal transcripts (Figure 1B, alpha = 0.001, unadj.), and no oskar homolog was found in our Clogmia transcriptomes or the Clogmia genome (Vicoso and Bachtrog, 2015). To test whether Clogmia lacks maternal germ plasm, we examined the expression of candidate germ cell markers, including Clogmia homologs of nanos (Cal-nos1, Cal-nos2, Cal-nos3, and Cal-nos4), vasa (Cal-vas), tudor (Cal-tud), and germ cell-less (Cal-gcl). Cal-nos1, Cal-nos3, and Cal-nos4 were not localized in the posterior of preblastoderm embryos but were expressed in a small set of cells at the posterior pole of cellular blastoderm and gastrulating embryos along with Cal-vas, Cal-tud, and Cal-gcl that were expressed more broadly (Figure 2—figure supplement 5). These observations suggest that Clogmia lacks maternal germ plasm and that Clogmia may induce the germ cell fate zygotically. To test this hypothesis, we examined Cal-nos expression in Cal-opaMat RNAi embryos. Cal-nos positive cells were duplicated in double abdomens (Figure 2E), indicating that Clogmia uses an inductive mechanism for germ cell specification, which is repressed in the anterior embryo by Cal-opaMat. Therefore, axis specification in the Clogmia embryo is independent from germ cell specification. To our knowledge, Clogmia is also the first example of inductive germ cell specification in flies.

Evolution of the anterior determinant function of moth fly odd-paired

Maternal odd-paired transcript is absent in freshly deposited eggs of chironomids (Klomp et al., 2015) and mosquitoes (Akbari et al., 2013), both of which belong to the Culicomorpha lineage (Figure 1A). To test whether localized maternal odd-paired transcript is broadly conserved in the Psychodomorpha lineage, we examined maternal transcript localization in the eggs of the sand fly Lutzomyia longipalpis, a moth fly species of public health concern due to its role in the transmission of visceral leishmaniasis. Of 5392 annotated transcripts, the most enriched maternal transcript in the anterior half of 1–2 hr old embryos was homologous to odd-paired and was therefore named Llo-opaMat (Figure 3A). In the posterior Lutzomyia embryo, the most enriched transcript was homologous to oskar, indicating that Lutzomyia eggs contain maternal germ plasm at the posterior pole, unlike the Clogmia eggs. These findings suggest that a broad range of moth flies use odd-paired transcript as anterior determinant, and that maternal germ plasm was lost only in the Clogmia lineage. Close examination of Lutzomyia transcriptomes from 1 hr-old and 24 hr-old embryos also revealed zygotic odd-paired transcript (Llo-opaZyg) (Figure 3B). Llo-opaMat and Llo-opaZyg share the same open reading frame but differ at their untranslated 5’ and 3’ ends. Since the N-terminal ends of Llo-OpaMat/Llo-OpaZyg and Cal-OpaZyg proteins are homologous (Figure 1—figure supplement 1), we infer that the N-terminal truncation of Cal-OpaMat occurred after the transcript had evolved maternal expression and anterior localization. The detection of Llo-opaZyg transcript in 24 hr-old embryos coincided with that of gap and pair-rule segmentation gene homologs (Figure 3—figure supplement 1), indicating that Llo-opaZyg functions during segmentation.

Figure 3 with 1 supplement see all
Alternative odd-paired transcript isoforms in Lutzomyia and ectopic head induction by mRNAs derived from Cal-opa orthologs in Clogmia.

(A) Differential expression analysis of maternal transcripts between anterior and posterior halves of 1–2 hr-old Lutzomyia embryos. logFC: log fold-change. (B) Stage-specific RNA-seq read coverage of Llo-opa genomic locus and sketches of Llo-opaMat and Llo-opaZyg transcripts (see also legend to Figure 1A). (C) Posterior injection of odd-paired mRNAs from Lutzomyia, Chironomus, and Drosophila in Clogmia embryo. Phenotypes were counted as in (Figure 2D) and double head from Dme-opa mRNA injection is shown as example. Cri-opa and Dme-opa mRNAs include Kozak sequence of Cal-opaMat (TAAG upstream of the predicted translation start site). Cri-kozak and Dme-kozak refer to odd-paired sequences with donor-specific Kozak-sequences from Chironomus (AAAA) and Drosophila (GACC), respectively. ns.: p>0.05; *: p<0.05. ***: p<0.001, Fisher’s exact test.

https://doi.org/10.7554/eLife.46711.012

The odd-paired gene of ancestral moth flies could have evolved the ability to establish the embryo polarity via specific amino acid substitutions. In this case, odd-paired homologs from species with a different anterior determinant, such as Drosophila or Chironomus, should not induce ectopic head development in Clogmia embryos. Alternatively, odd-paired could have evolved its role as axis determinant in moth flies independent of any amino acid substitution via co-option. In this case, odd-paired homologs from Drosophila or Chironomus could have the ability to induce head development in Clogmia embryos when appropriately expressed. To test this possibility, we injected odd-paired mRNA from Lutzomyia, Chironomus, or Drosophila into the posterior pole of early Clogima embryos. All of these odd-paired homologs induced double heads in Clogmia, provided that the endogenous kozak sequence of Cal-opaMat was used for optimal translation efficiency (Figure 3C). Since neither Drosophila nor Chironomus uses odd-paired for specifying embryo polarity, these results suggest that amino acid substitutions were not essential for the evolution of the anterior determinant function of odd-paired in moth flies. We therefore propose that this gene function evolved via co-option when alternative maternal transcript of moth fly odd-paired became enriched at the anterior egg pole.

A previously uncharacterized C2H2 zinc finger gene, named cucoid, functions as anterior determinant in culicine mosquitoes

Given that freshly deposited mosquito eggs lack maternal odd-paired transcript orthologs (Akbari et al., 2013), we extended our search for anterior determinants to mosquitoes. Initially, we focused on the Southern House Mosquito Culex quinquefasciatus, a vector of West Nile virus (the leading cause of mosquito-borne disease in the continental United States) and of Wuchereria bancrofti (the major cause of lymphatic filariasis). This species was chosen because their eggs are large and have clearly distinguishable anterior and posterior egg poles. We annotated 8239 Culex transcripts from the pooled anterior and posterior transcriptomes of 1 hr-old preblastoderm embryos and ranked them according to the magnitude of their differential expression scores and P values (Figure 4A). In the posterior embryo, the most enriched transcript was related to nanos, consistent with the presence of maternal germ plasm in this species (Figure 4D) (Juhn et al., 2008). The most enriched transcript in the anterior embryo was closely related to an uncharacterized gene of Drosophila (CG9215). However, reciprocal BLAST searches suggest that CG9215 belongs to a poorly defined larger gene family in Drosophila that might be represented by a single gene in mosquitoes. We named this gene cucoid to reflect its bicoid-like function in a culicine mosquito. cucoid encodes a protein with five C2H2 zinc finger domains (Figure 4—figure supplement 1). RACE experiments with cDNA from 0 to 7 hr-old embryos revealed three alternative cucoid transcripts with distinct 3’ ends (cucoidA, cucoidB, and cucoidC) (Figure 4B), but only cucoidB and cucoidC were recovered from cDNA of 0–2 hr-old preblastoderm embryos, suggesting that one or both these transcripts might be maternally localized at the anterior pole. To test this hypothesis, we performed RNA in situ hybridizations with specific probes for cucoidA (probe A) or cucoidB (probe B) and, due to the very short sequence unique to cucoidC (121 nucleotides), a probe against all three isoforms (probe C). cucoidA and cucoidB expression was detected in the fore and hind gut of extended germbands but not in 1 hr-old preblastoderm embryos. In contrast, the probe against all three isoforms detected maternally localized cucoid transcript at the anterior pole in addition to the zygotic expression pattern (Figure 4C). Taken together, these results suggest that only the cucoidC isoform is maternally localized at the anterior pole and could function as anterior determinant. To test this hypothesis, we injected cucoid dsRNA from the shared 5’ region and examined the expression of a posterior marker (Cqu-cad) in gastrulating embryos. Many of these embryos expressed Cqu-cad in the anterior and underwent ectopic gastrulation at the anterior pole, suggesting that normal head-to-tail polarity was lost (Figure 4E). Taken together, our results suggest that cucoid acquired the anterior determinant function via the localization of a maternal transcript isoform with an alternative 3’ end.

Figure 4 with 1 supplement see all
Expression and function of alternative cucoid isoforms in Culex.

(A) Differential expression analysis of maternal transcripts between anterior and posterior halves of 1 hr-old Culex embryos. logFC: log fold-change. (B) Sketches of cucoid transcript isoforms based on RNA-seq and RACE experiments (see also legend to Figure 1A). Blue lines the position of in situ hybridization probes. (C) RNA in situ hybridization of cucoidA, cucoidB, and cucoidC transcripts in 1 hr-old preblastoderm and germband extending embryos. Anterior is left and dorsal up. Scale bar: 100μm. (D) RNA in situ hybridization of Cqu-nos in 1 hr-old preblastoderm embryo. Anterior is left. Scale bar: 100μm (E) RNA in situ hybridization of Cqu-cad in a wild-type gastrulating embryo (left) and in a stage-matched cucoid RNAi embryos (right; 16/48 with cucoid dsRNA versus 0/25 with lacZ control dsRNA; p<0.0005). Anterior is left and dorsal up. Scale bar: 100μm.

https://doi.org/10.7554/eLife.46711.014

We obtained similar results in another culicine mosquito, the Yellow Fever Mosquito Aedes aegypti, which transmits Dengue, Chikungunya, and Zika viruses. In this species, expression profiling of 5802 transcripts from the anterior and posterior transcriptomes of 1 hr-old preblastoderm embryos also identified cucoid (Aae-cucoid) as the gene with the most significantly enriched transcript in the anterior embryo (Figure 5A). RACE experiments with cDNA from 1 hr to 6 hr-old embryos revealed three similar Aae-cucoid transcripts with alternative 3’ ends (Aae-cucoidA, Aae-cucoidB, and Aae-cucoidC) (Figure 5B), and RNA in situ hybridization experiments with a probe against all three isoforms confirmed the anterior localization of Aae-cucoid transcript in preblastoderm embryos (Figure 5C). Aae-cucoid expression in Aedes germbands could not be examined for technical reasons.

Expression and function cucoid in Aedes.

(A) Differential expression analysis of maternal transcripts between anterior and posterior halves of 1 hr-old Aedes embryos. logFC: log fold-change. (B) Sketches of Aae-cucoid transcript isoforms based on RNA-seq and RACE experiments with the position of the in situ hybridization probe and dsRNA underlined in blue (see also legend to Figure 1A). (C) RNA in situ hybridization Aae-cucoid (left) and Aae-nos (right) transcript in 1 hr-old preblastoderm embryo. Anterior is left and dorsal up. Scale bar: 100μm. (D) 1 st instar Aedes larval cuticle of wild type (top) and following Aae-cucoid RNAi (bottom; 9/26 versus 0/22 with control dsRNA; p<0.005). Scale bar: 100μm.

https://doi.org/10.7554/eLife.46711.016

In the posterior embryo, no highly enriched transcripts were observed. This was unexpected given that whole mount in situ hybridizations revealed posterior localized transcript of Aedes nanos in 1 hr-old embryos (Figure 5C) and that maternal transcript of Aedes oskar is also localized at the posterior pole (Juhn and James, 2006). Low statistical power of our differential expression analysis in Aedes might explain this discrepancy, since we could have confounded the anterior and posterior pole in some of the bisected Aedes eggs (see Materials and methods). Alternatively, only a small portion of these transcripts might be localized at the posterior pole. Injection of Aae-cucoid dsRNA against the shared region of all transcripts resulted in double abdomens (Figure 5D), suggesting that cucoid evolved its function as anterior determinant prior to the divergence of the Culex and Aedes lineages.

pangolin/Tcf functions as anterior determinant in anopheline mosquitoes

The Anopheles gambiae species complex constitutes an outgroup to the Culex-Aedes clade. It includes eight or more sub-Saharan species that are difficult to distinguish due to widespread genealogical heterogeneity across the genome, incomplete lineage sorting and introgression (Thawornwattana et al., 2018). We interchangeably used A. gambiae and A. coluzzii, two sibling species within this species complex that are responsible for the majority of malaria transmission in Africa, to identify the anterior determinant of this mosquito lineage. Whole mount RNA in situ hybridizations with a probe against the Anopheles gambiae ortholog of cucoid did not detect any anterior localized transcript in 1 hr-old embryos, suggesting that Anopheles uses a different anterior determinant than Culex and Aedes.

To further test this possibility, we sequenced the anterior and posterior transcriptomes 1 hr-old preblastoderm embryos of A. gambiae and ranked 9353 transcripts according to the magnitude of their differential expression scores and P values. In the posterior embryo, the most enriched transcript was homologous to nanos. In the anterior embryo, the most enriched transcript was homologous to pangolin (also known as Tcf) (Figure 6A). To test for potential alternative maternal and zygotic isoforms of pangolin in Anopheles, we mapped the assembled transcripts and 5’ and 3’ RACE products from 1 to 6 hr-old embryos onto an available A. gambiae genome assembly (AgamP4). We identified two alternative transcript variants with non-overlapping 3’UTRs but nearly identical open reading frames that we named Aga-panMat and Aga-panZyg, respectively (Figure 6B and Figure 6—figure supplement 1). Aga-panMat was tightly localized at the anterior pole of 1–2 hr-old preblastoderm embryos and only weakly expressed in elongated germbands, whereas Aga-panZyg was expressed segmentally in elongated germbands but not in embryos younger than 2 hr-old preblastoderm embryos (Figure 6C). Both pangolin isoforms were conserved in Anopheles coluzzii with sequence identity above 99% and the maternal isoform (Aco-panMat) was localized at the anterior pole (Figure 6—figure supplement 2). The stage-specific expression of both pangolin isoforms was also conserved outside the Anopheles gambiae species complex in Anopheles stephensi (Figure 6—figure supplement 3). Alignments of dipteran Pangolin proteins suggest that, in Anopheles, the maternal variant includes an additional seven amino acids at C-terminal end due to alternative polyadenylation and splicing (Figure 6—figure supplement 1).

Figure 6 with 5 supplements see all
Expression and function of alternative pangolin isoforms in Anopheles.

(A) Differential expression analysis of maternal transcripts between anterior and posterior halves of 1 hr-old Anopheles embryos. logFC: log fold-change. (B) Sketches of Aga-panMat and Aga-panZyg transcripts based on RNA-seq and RACE experiments (see also legend to Figure 1A). Blue lines the position of in situ hybridization probes and dsRNA. (C) RNA in situ hybridization of Aga-panMat and Aga-panZyg transcripts in 1 hr-old preblastoderm and germband extending embryos of A.gambiae. Anterior is left and dorsal up. Scale bar: 100μm. (D) 1 st instar A.coluzzii larval cuticle of wild type (top). Cuticle phenotypes of double abdomen (middle; 3/37) and intermediate, anterior truncation phenotype (bottom; 8/37) following Aco-panMat RNAi. Scale bar: 100μm. (E) Differential expression analysis of maternal transcripts between anterior and posterior halves of 1 hr-old Nephrotoma (Tipulidae) embryos. logFC: log fold-change. (F) RNA in situ hybridization of Nsu-panMat.

https://doi.org/10.7554/eLife.46711.017

To investigate the function of localized maternal pangolin expression in Anopheles, we specifically targeted this isoform in Anopheles coluzzii. Injection of Aco-panMat-specific dsRNA into several hundred 1 hr-old A. coluzzii embryos resulted in only 37 cuticles with variable phenotypes, including anterior truncations and, in extreme cases, double abdomens (Figure 6D). We noticed perturbed segmentation boundaries in the double abdomens, suggesting that Aga-panMat may also function in segmentation, as suggested by its weak zygotic expression pattern. Injection of Aco-panZyg-specific dsRNA into 1 hr-old A. coluzzii embryos resulted in severe segmentation defects that were difficult to characterize, but no double abdomens or anterior-specific truncation defects were found (Figure 6—figure supplement 4). Taken together with the isoform-specific transcript localization data presented above, these RNAi results support the hypothesis that pangolin acquired the anterior determinant function via the localization of a maternal transcript isoform with an alternative 3’ end.

Localization of maternal pangolin transcript in crane flies suggests that pangolin functioned as anterior determinant in ancestral flies

Anterior-localized maternal pangolin (Tc-pan) transcript has also been observed in the eggs of a beetle (Tribolium castaneum) (Bucher et al., 2005), but the function of this transcript remains unknown. Previous Tc-pan RNAi experiments targeted both maternal and zygotic transcripts and only revealed a function in posterior development, due to the role of zygotic Tc-pan in canonical Wnt signaling in the posterior growth zone (Bolognesi et al., 2008; Fu et al., 2012; Prühs et al., 2017; Ansari et al., 2018). To test whether ancestral dipterans localized maternal pangolin transcript at the anterior pole of the egg, we established a culture of the crane fly Nephrotoma suturalis (Tipulidae), which belongs to the Tipulomorpha, one of the oldest branches of dipterans (Grimaldi and Engel, 2005; Wiegmann et al., 2011). We sequenced the anterior and posterior transcriptomes of freshly deposited Nephrotoma egg halves and ranked 5371 transcripts according to the magnitude of their differential expression scores and P values (Figure 6E). The most enriched transcript in the posterior embryo was related to oskar, suggesting that crane fly eggs contain maternal germ plasm at the posterior pole. The most enriched transcript in the anterior embryo was homologous to pangolin and therefore named Nsu-pan. The anterior localization of this transcript was confirmed by RNA in situ hybridization (Figure 6F). RACE experiments with cDNA from 1 hr-old embryos identified multiple isoforms with slightly variable 5’ ends but the same open reading frame. An alignment of the predicted Nsu-Pan protein from this open reading frame with other dipteran Pangolin homologs revealed conserved N-terminal and C-terminal ends in Nsu-Pan. Taken together with our Anopheles data, our results in Nephrotoma suggest that ancestral dipteran insects localized maternal pangolin transcript in the anterior egg pole, where this transcript may have functioned as anterior determinant.

Pangolin cannot substitute for Panish in Chironomnus

In the midge Chironomus, the ortholog of pangolin (Cri-pan) is not expressed maternally but its diverged paralog panish functions maternally as anterior determinant (Klomp et al., 2015). Given that panish evolved from pangolin via gene duplication, panish probably inherited its role from pangolin. Therefore, it is possible that Cri-pan and panish are still functionally equivalent when expressed at the anterior pole of preblastoderm Chironomus embryos. Alternatively, Panish may have co-evolved with the targets required for anterior patterning and Pangolin can no longer interact with those targets. In this case, Cri-pan should no longer be able to fulfill the function of panish. To distinguish between these possibilities, we examined the ability of panish and Cri-pan mRNAs to rescue the RNAi phenotype of panish. We have previously shown that dsRNA of the panish 3’UTR can induce the double abdomen phenotype with a penetrance of nearly 100%, and that this phenotype can be rescued in roughly half of the embryos by injecting panish mRNA with heterologous UTRs at the anterior pole, shortly after the injection of dsRNA (Klomp et al., 2015). We used this assay to compare the functions of panish mRNA (positive control), frame shifted panish mRNA (negative control), Cri-pan mRNA, and a modified Cri-pan mRNA designed to better resemble panish mRNA (Cri-pantrunc. mRNA). Cri-pantrunc. mRNA encodes a N-terminal truncated Cri-Pan variant, lacking the ß-Catenin binding and HMG box domains, with two mutations in the cysteine-clamp domain to mimic conserved changes of the Panish cysteine-clamp (Figure 6—figure supplement 5A). Only panish mRNA rescued panish RNAi embryos (Figure 6—figure supplement 5B), suggesting that panish co-evolved with its targets and functionally diverged after its origin via gene duplication from pangolin.

Discussion

Role of alternative transcription in the evolution of embryonic axis determinants from old genes

In this study, we have identified three unrelated old genes that encode the anterior determinant in moth flies, culicine mosquitoes, and anopheline mosquitoes, respectively (Figure 7). All three genes not only localize their maternal transcript at the anterior egg pole; they also are subject to alternative transcription, which allows a single gene to generate multiple transcript isoforms with distinct 5’ and 3’ ends through the use of alternative promoters (alternative transcription initiation) and polyadenylation signals (alternative transcription termination).

Figure 7 with 2 supplements see all
Anterior axis determinants in Diptera.

The phylogenetic tree of dipteran families is based on published data and shows Cylorrhapha in green (Wiegmann et al., 2011). Mya, million years ago.

https://doi.org/10.7554/eLife.46711.023

In moth flies, the localized maternal odd-paired transcript that functions as anterior determinant has an alternative first exon compared to the canonical isoform (Figure 1B–D, Figure 2, and Figure 3A–B). In the case of mosquitoes, maternal transcript isoforms of cucoid (in culicine mosquitoes) or pangolin (in anopheline mosquitoes) with alternative last exons are localized at the anterior pole of the egg and function as anterior determinant (Figure 4, Figure 5, and Figure 6). Since anterior determinants are localized in the anterior egg, and signals for the subcellular localization of transcripts are typically found in UTRs (Holt and Bullock, 2009), it is possible that alternative transcription facilitates the evolution of anterior determinants by providing the UTR sequence for isoform-specific localization signals that do not interfere with other gene functions. For example, it has been shown that alternative last exons of transcript isoforms confer isoform-specific localization in neurons (Taliaferro et al., 2016; Ciolli Mattioli et al., 2019). Additional experiments will be needed to test whether the unique UTR sequences of anterior determinants are essential for their localization at the anterior egg pole.

In addition to changes in UTR sequences, alternative transcription also can result in the truncation or elongation of the open reading frame. For example, the anterior determinant of Clogmia (Cal-OpaMat) lacks the N-terminal 20 amino acids (Figure 1—figure supplement 1), and the anterior determinant of Anopheles (Aga-panMat) encodes protein that includes additional seven amino acids at the C-terminal end (Figure 6—figure supplement 1). However, these changes to the protein may not have been important for adopting a function as anterior determinant. The truncation in the maternal Odd-paired protein that we observed in Clogmia is not conserved in Lutzomyia, in which Llo-opaMat and Llo-opaZyg encode the same protein, and full-length Odd-paired homologs from these and other species can function as anterior determinant in Clogmia (Figure 3B–C). Also, the elongation of Aga-PanMat protein is not conserved in Nephrotoma, in which the localized Nsu-panMat transcript encodes a Pangolin protein with a conserved C-terminal end (Figure 6—figure supplement 1). Therefore, modifications in the open reading frame of these genes may reflect secondary changes.

Evolution of new genes that encode embryonic axis determinants

Unlike the anterior determinants identified in this study, the previously described anterior determinants of Drosophila and Chironomus are encoded by newly evolved genes, bicoid and panish. These genes seem to be dispensable outside the context of axis specification (Driever, 1993; Klomp et al., 2015), suggesting that they evolved specifically for this function. They could have acquired their function de novo via protein evolution or via inheritance from the progenitor gene. Our findings suggest that the role of pangolin in axis specification was already present in ancestral dipterans (Figure 7). We therefore propose that panish, which evolved from pangolin via gene duplication in the Chironominae lineage (Figure 7—figure supplement 1), inherited its function from pangolin. Future examinations of pangolin isoforms and their expression in the eggs of chironomids that lack panish orthologs (species representing basal chironomid lineages) could reveal intermediate steps in this process, such as a localized truncated pangolin isoform.

Similarly, bicoid could have acquired its function de novo via protein evolution or via inheritance from its progenitor gene, zerknüllt. Several previous studies have hypothesized that Bicoid replaced Orthodenticle, a conserved homeodomain protein with similar DNA-binding affinity that functions in animal head development (Wimmer et al., 2000; Schröder, 2003; Lynch et al., 2006; Datta et al., 2018). Ancestrally reconstructed homeodomains confirmed that a single amino acid change in the homeodomain of Bicoid (Q50K), which is shared by Bicoid and Orthodenticle, caused a dramatic shift of Bicoid’s DNA-binding affinity in vitro and target recognition in vivo (Liu et al., 2018).

We cannot rule out that orthodenticle functioned as anterior determinant in ancestral brachyceran flies. However, in analogy with our findings, it is also possible that a maternal zerknüllt isoform became localized at the anterior pole of the egg and acquired the role of anterior determinant via co-option, prior to the origin of bicoid via gene duplication (Figure 7—figure supplement 2). Maternal zerknüllt expression is common in lower Diptera but was lost in Cyclorrhapha (Stauber et al., 2002). If bicoid inherited its function from zerknüllt, the Q50K mutation in the homeodomain of Bicoid must have been a secondary, potentially maladaptive change. In this case, it may have been fixed in the cyclorrhaphan stem lineage via a compensatory or balancing mechanism and would have driven co-evolution of its targets.

It may be objected that, in Drosophila, reverting the K50 residue of the Bicoid homeodomain to Q50 is lethal and results in a bicoid null phenotype (Liu et al., 2018). However, how the ancestral gene network responded to the Q50K mutation of Bicoid cannot be inferred from observations in Drosophila. Moreover, published biochemical data suggest that the Q50K mutation increases interaction with the consensus Bicoid binding DNA motif much stronger than it reduces interaction with the consensus Zerknüllt binding DNA motif. It is therefore conceivable that the Q50K mutation had a less dramatic effect in ancestral flies, in which the target genes of the anterior determinant were activated via Zerknüllt binding sites, than in Drosophila, in which the target genes of the anterior determinant are activated via Bicoid binding sites. Examination of the mechanisms that determine embryo polarity in non-cyclorrhaphan Brachycera flies might help to test this hypothesis. If panish and bicoid inherited their functions, their evolutionary origin and divergence could have served the purpose of reducing the pleiotropy of their progenitor genes, pangolin and zerknüllt, rather than allowing them to take on an entirely new function in development.

Role of alternative transcription in the evolution

Recent genome-wide analyses have shown that alternative transcription is a widespread phenomenon. For example, there are on average four alternative transcription start sites per gene in humans (Forrest et al., 2014) and at least 50–70% of mammalian genes are subject to alternative polyadenylation (Shepard et al., 2011; Adams et al., 2000; Derti et al., 2012). Alternative transcript isoforms can be tightly regulated in a cell or tissue specific manner and can affect transcription and translation efficiency as well as splicing (An et al., 2008; Davuluri et al., 2008; Lau et al., 2010; Pinto et al., 2011; Smibert et al., 2012; Anvar et al., 2018; Tushev et al., 2018; Taliaferro et al., 2016; Ciolli Mattioli et al., 2019; Shabalina et al., 2010). Functional studies in model organisms have shown that alternative transcription can generate dominant negative and alternatively localized protein isoforms (Davuluri et al., 2008; Bharti et al., 2008; Vacik et al., 2011; Berkovits and Mayr, 2015; Schrankel et al., 2016), while misregulation of alternative transcript isoforms has been associated with human diseases including cancer (Mayr and Bartel, 2009; Wiesner et al., 2015; Pal et al., 2012; Shapiro et al., 2011). However, the contribution of alternative promoters (alternative transcription initiation) and polyadenylation signals (alternative transcription termination) to the evolution of new gene functions and regulatory networks remains poorly understood (Carroll et al., 2005; Peter and Davidson, 2011; Wittkopp and Kalay, 2011; de Klerk and 't Hoen, 2015).

The results of several previous studies suggest that alternative transcription may underlie the evolutionary diversification of gene functions. For example, a large fraction of alternative promoter sequences is conserved between human and mice, but those with cell or tissue restricted expression have frequently changed during mammalian evolution (Baek et al., 2007; Forrest et al., 2014), suggesting that alternative promoters may have played a significant role in cell type evolution. Another likely substrate for evolutionary diversification are the protein terminal ends generated by alternative transcription in conjunction with alternative splicing. These terminal ends commonly contain intrinsically disordered regions which are enriched in sites that mediate protein-protein interactions (Buljan et al., 2013; Shabalina et al., 2014). A recent case study found that a light fur color variant of beach mice evolved repeatedly via selection for an alternative agouti isoform with increased translation efficiency (Linnen et al., 2013; Mallarino et al., 2017).

Our in vivo study revealed three old genes that evolved the anterior determinant function by localizing an alternative transcript isoform at the anterior pole of the egg. Therefore, we propose that differential expression of alternative transcript isoforms can result in the evolution of new gene functions, independent of, and prior to gene duplication and sub-functionalization. Given that alternative transcription is a widespread phenomenon, it could play an important role in the evolution of gene regulatory networks.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Nephrotoma suturalis)Nsuhttps://doi.org/10.1083/jcb.25.1.95NA
Strain, strain background (Chironomus riparius)Crihttps://doi.org/10.1126/science.aaa7105; https://doi.org/10.1111/mec.1411CRIP_Laufer
Strain, strain background (Clogmia albipunctata)Calhttps://doi.org/10.1007/s004270050238NA
Strain, strain background (Culex quinquefasciatus)CquNIAIDNA
Strain, strain background (Anopheles gambiae)A.gambiaeNIAIDG-3 strain
Strain, strain background (Anopheles coluzzii)A.coluzziiInsect transformation facility, University of MarylandNA
Strain, strain background (Aedes aegypti)AaeNIAIDLiverpool ‘Black eye’
Gene (Clogmia albipunctata)Cal-opaMatThis paperMN122104See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization;Rapid Amplification of cDNA Ends (RACE)
Gene (Clogmia albipunctata)Cal-opaZygThis paperMN122105See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization; Rapid Amplification of cDNA Ends (RACE)
Gene (Clogmia albipunctata)Cal-slpThis paperMN122106See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-miraThis paperMN122107See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-otdThis paperMN122108See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-nos1This paperMN122109See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-nos2This paperMN122110See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-nos3This paperMN122111See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-nos4This paperMN122112See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-vasThis paperMN122113See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-tudThis paperMN122114See Materials and methods - RNA in situ hybridization
Gene (Clogmia albipunctata)Cal-gclThis paperMN122115See Materials and methods - RNA in situ hybridization
Gene (Lutzomyia longipalpis)Llo-opaMatThis paperMN122116See Materials and methods - Rapid Amplification of cDNA Ends (RACE)
Gene (Lutzomyia longipalpis)Llo-opaZygThis paperMN122117See Materials and methods - Rapid Amplification of cDNA Ends (RACE)
Gene (Lutzomyia longipalpis)Llo-oskThis paperMN122118See Materials and methods - RNA in situ hybridization
Gene (Chironomus riparius)Cri-opaThis paperMN122119See Materials and methods - RNA in situ hybridization
Gene (Culex quinquefasciatus)cucoidAThis paperMN122120See Materials and methods - RNA in situ hybridization
Gene (Culex quinquefasciatus)cucoidBThis paperMN122121See Materials and methods - RNA in situ hybridization
Gene (Culex quinquefasciatus)cucoidCThis paperMN122122See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization
Gene (Culex quinquefasciatus)Cqu-nosThis paperMN122123See Materials and methods - RNA in situ hybridization
Gene (Aedes aegypti)Aae-cucoidAThis paperMN122124See Materials and methods - Rapid Amplification of cDNA Ends (RACE)
Gene (Aedes aegypti)Aae-cucoidBThis paperMN122125See Materials and methods - Rapid Amplification of cDNA Ends (RACE)
Gene (Aedes aegypti)Aae-cucoidCvectorbase.orgAAEL013321See Materials and methods - Rapid Amplification of cDNA Ends (RACE)
Gene (Aedes aegypti)Aae-nosvectorbase.orgAAEL012107See Materials and methods - RNA in situ hybridization
Gene (Anopheles gambiae)Aga-panMatThis paperMN122126See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization; Rapid Amplification of cDNA Ends (RACE)
Gene (Anopheles gambiae)Aga-panZygThis paperMN122127See Materials and methods - Cloning procedures and mRNA/dsRNA synthesis; RNA in situ hybridization; Rapid Amplification of cDNA Ends (RACE)
Gene (Anopheles gambiae)Aga-cadThis paperMN122128See Materials and methods - RNA in situ hybridization
Gene (Nephrotoma suturalis)Nsu-panThis paperMN122129See Materials and methods - RNA in situ hybridization
Sequence-based reagentdsRNAsThis papersee Materials and methods - Cloning procedures and mRNA/dsRNA
Sequence-based reagentRNA probesThis paperSee Materials and methods - RNA in situ hybridization
Commercial assay or kitSMARTer RACE 5'/3' KitTakara634858
Commercial assay or kitmMESSAGE mMACHINE SP6Thermo FisherAM1340
Commercial assay or kitQuikChange Lightning Site-Directed Mutagenesis KitAgilient210515
Software, algorithmGeneioushttps://www.geneious.comRRID:SCR_010519version 11.1.5
Software, algorithmGraphPad Prismhttps://graphpad.comRRID:SCR_015807version 1.4

Cloning procedures and mRNA/dsRNA synthesis

Request a detailed protocol

Coding sequences from Clogmia, Lutzomyia, Chironomus, Anopheles, Nephrotoma, Culex, and Aedes were amplified from embryonic cDNA with primers constructed from RNA-seq data. Coding sequence of odd-paired was amplified from cDNA (FI01113) that was obtained from the BDGP Gold collection of the Drosophila Genomics Resource Center. Amplified cDNA was cloned into the expression vector pSP35T (Amaya et al., 1991), using In-Fusion HD Cloning Kit (Clontech), and PstI- or EcoRI-linearized vector was used for mRNA synthesis using mMESSAGE mMACHINE SP6. panish, Cri-pan, and Cri-pantrunc mRNAs were synthesized from PCR template (containing T7 polymerase binding site) using mMESSAGE mMACHINE T7ultra. Mutations in the open reading frame (Cal-opaZyg-Met21Leu, panish FS, Cri-pantrunc) and in the kozak sequences of Dme-opa and Cri-opa were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). Double-stranded RNA (dsRNA) was generated from PCR-amplified templates using embryonic cDNA and primers containing T7 polymerase binding sites as described (Klomp et al., 2015).

Forward and reverse primer sequences for generating templates for mRNA synthesis were:

  • Cal-opaMat

  • 5’-TAAGATGAGTCCGAATCACTTACTGGCC

  • 5’-TTAATAGGCCGTCGCTGCACC

  • Cal-opazyg

  • 5’-CAACATGATGATGAACGCTTTTATGGAA

  • 5’-TTAATAGGCCGTCGCTGCACC

  • Cal-opa115-655

  • 5’-ATGCTCTTCTCAAATCACTCTTCAGC

  • 5’-TTAATAGGCCGTCGCTGCACC

  • Cal-opa182-655

  • 5’-ATGAACCCGGGAACCTTGGG

  • 5’-TTAATAGGCCGTCGCTGCACC

  • Cal-opa182-445

  • 5’-ATGAACCCGGGAACCTTGGG

  • 5’-TTACGCGGGATTCAGCTGACTATG

  • Cal-opa1-337+22

  • 5’-CAACATGATGATGAACGCTTTTATGGAA

  • 5’-TCACAAAATTTCACTGAATTCCGTCAAAATATCACTAGA

  • Llo-opa

  • 5’-AAAGATGATGATGAATGCATTTATGGACACAG

  • 5’-TCAGTACGCCGTGGCGGCG

  • Dme-opaDme kozak

  • 5’-GACCATGATGATGAACGCCTTCA

  • 5’-GTCAATACGCCGTCGCTGCGCCGGG

  • Cri-opaCri kozak

  • 5’-AAAAATGATGATGAATGGTTTTATGGACACA

  • 5’-TCAATAAGCTGTCGTTGGACCGTGAT

  • Cri-pantrunc

  • 5’- AAAAATGTATCCAGATTGGAGCTCGC

  • 5’- TTACGTCACACTAATAGCATTTCCATCATCCC

Forward and reverse primer sequences for dsRNA (lengths of dsRNAs in brackets; gene specific sequence of primers underlined):

  • Cal-opaMat (222 bp):

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAAAACAATTGTGAAGTGCGACA

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGACAAATTTCCAAACGATGACAGA

  • Cal-opazyg (315 bp):

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGAACTACCGCCGCGAACACACG

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAGTCCAGTCGATTCCATAAAAGC

  • Cal-slp (927 bp):

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGATCGATCAGCTCCCTTTTGCC

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGATGAGATCGTTCCCGTTGGAC

  • Cal-mira (993 bp):

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGAACAGCAAAAAGGAAGCGAAA

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAGGGATTCAATTTGCCTTTGA

  • Aga-panMat (976 bp):

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGACACACAGGGCACAATAATCG

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGAGACTGCATGTCCGTCGTCTA

  • Aga-panZyg (843 bp):

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGAACATCACACACCCCACACAC

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGATTGGTCCGTTCGTGATTGTA

  • cucoid (926 bp):

  • 5’ - CAGAGATGCATAATACGACTCACTATAGGGAGACGAGGATGTTGCTGGAGAAT

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGAACTCCCGAAATCGGAAAACT

  • Aae-cucoid (857 bp):

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGACGACAAGCCCTACAAATGCT

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGATGATCTGGATGTTGCCGTAG

Microinjection of embryos

Request a detailed protocol

Chironomus embryo injection was done as previously described (Klomp et al., 2015). Clogmia eggs were dissected from ovaries and activated under water. Eggs of Aedes, Culex, and Anopheles were collected in a dark chamber on a moist filter paper for about 30 min (Fisher Scientific, Cat. No 09–795C). These eggs were transferred to another filter paper cut into 4 cm x 2 cm pieces and aligned perpendicularly to the edge of a cover glass (Fisher Scientific, Cat. No 12-648-5C) with the prospective injection side pointing towards the glass edge. We noticed that injecting eggs near the anterior or posterior pole was critical for survival of the procedure. During the alignment procedure, water was applied to the filter paper as needed to prevent eggs from desiccation. After aligning the eggs, the cover glass was removed and excess water on the filter paper was absorbed using filter paper. A second cover glass with a layer of double-sided tape (Scotch 3M) was slightly pressed against the aligned eggs to transfer the eggs to the double-sided tape. The embryos were then immediately covered with halocarbon oil to prevent desiccation. For cuticle preparations, the embryos were injected under halocarbon oil 27 (Sigma, MKBZ7202V). The oil was washed off under a gentle stream of water immediately after injection. In the case of Clogmia, Aedes, and Culex the cover glass was transferred to a moist chamber (petri dish with wet kimwipe paper) and kept at 28 °C, and water was added every day to prevent desiccation. In the case of Anopheles, the eggs were allowed to develop under water. Removal of the halocarbon oil was critical to ensure embryo survival until late developmental stages and hatching. For eggs to be fixed within a day following injection, we used a 1:1 mixture of halocarbon oil 27 and halocarbon oil 700 (Sigma, MKCB5817) and left the injected eggs immersed in the oil until fixation. Embryos were injected with quartz needles using a Narishige IM-300 microinjector. Quartz capillaries (Sutter Instruments Q100-70-10) were pulled with a Sutter instrument P-2000 laser-based micropipette puller. Our settings for the needle puller were: Heat 645, Fil 4, Vel 40, Del 125, Pul 130. Needles were back-filled and the tip was broken open at the time of injection by slightly touching the first egg.

Embryo fixation

Request a detailed protocol

Clogmia Embryos were dechorionated using a 10% dilution of commercial bleach (8.25% sodium hypochloride) for 3 min. For Nephrotoma embryos, a 25% dilution was used for 3 min until the chorion became slightly transparent. Embryos of Aedes, Culex, and Anopheles were dechorionated as described (Juhn and James, 2012). Dechorionated embryos were fixed in a 50 mL falcon tube, using 20 mL of boiling salt/detergent-solution (100 μL 10% triton-X, 500 μL 28% NaCl, up to 20 mL of water). After 10 s, water was applied to the tube to cool down the embryos. If needed, the embryos were devitellinized in a 1:1 mixture of n-heptane and methanol by gentle shaking. Embryos with vitelline membrane attached were further devitellinized using sharp tungsten needles in an agar plate covered with methanol. Devitellized embryos were stored in 100% methanol at −20°C.

RNA in situ hybridization

Request a detailed protocol

RNA in situ hybridizations were conducted as described (Klomp et al., 2015), using digoxigenin (DIG)-labeled probes and Fab fragments from anti-DIG antibodies conjugated with alkaline phosphatase (AP) (Roche, IN, USA). Probes were prepared from PCR templates, using sequence-specific forward primers and reverse primers with T7 promoter sequence (see above for Cal-opaMat, Cal-opaZyg, Cal-cad, Cal-slp, Cal-mira, Aga-panMat, Aga-panZyg, and Aae-cucoid; gene specific sequence underlined).

  • Cal-nos1 (450 bp):

  • 5’-AGCACTTTTCCCCCAAGAGT

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAGGCATTCATATTTCCTCAGCA

  • Cal-nos2 (475 bp):

  • 5’-AATTATTCTGTTCCAAAGTTGAGATT

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGACCCCAGACTGGTGACAAAT

  • Cal-nos3 (548 bp):

  • 5’-TGAGTTAAATAGAGTGAAAACAGCAAA

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGATACCGTCTCGTGCTTAATCG

  • Cal-nos4 (440 bp):

  • 5’-GGCAAAATTTTCCAAGTGAA

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGACGTGTCCTCAAGCGTGTAGAT

  • Cal-vas (938 bp):

  • 5’-CTGAGGCGAACTTGTGTGAA

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAATTGGCAATGTCCAGTCCTC

  • Cal-tud (921 bp):

  • 5’-ATTCTGCAAGTCGTCGAGGT

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGACCTGTACCAGCCATTGTCCT

  • Cal-gcl (450 bp):

  • 5’-GCAGAACCCCTTGGACATTA

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAGTAACGCCCACAATTCGTCT

  • cucoidA (939 bp):

  • 5’-ACGATGAGGAGGAGGGTTCT

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGACGCACTTCACCGTGTGTAAC

  • cucoidB (717 bp):

  • 5’-GGGGCGACATCTATATCTCACT

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAACAGTGAGAAAAATTCCCAACTTTAGT

  • cucoidC (926 bp):

  • 5’-CGAGGATGTTGCTGGAGAAT

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAACTCCCGAAATCGGAAAACT

  • Cqu-cad (956 bp):

  • 5’-CACGTGTTCCATCAGTCCAG

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAATGAGGCTTAACGAGGATGG

  • Cqu-nos (927 bp):

  • 5’-AAGTGCCGTGAATTTTGTCC

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGAGCGAAACCAATTCGACAGTT

  • Nsu-pan (966 bp):

  • 5’-TCGCGGCAAGATCATAGTCC

  • 5’-CAGAGATGCATAATACGACTCACTATAGGGAGACCTGCAGGGTTTACACCACT

  • Aae-nos (914 bp):

  • 5’- CAAACGTGAAGCGGAAGATT

  • 5’- CAGAGATGCATAATACGACTCACTATAGGGAGAATTACGTCCGGAAGTGTTCG

Rapid Amplification of cDNA Ends (RACE)

Request a detailed protocol

Total RNA was phenol/chloroform extracted from Clogmia (1 hr-old and 9 hr-old embryos), Anopheles (1–6 hr-old embryos), Culex (0–7 hr old embryos), and Nephrotoma (1–29 hr-old embryos) fixed in TRIzol Reagent (Invitrogen) and precipitated with isopropanol. 5’/3’ RACE was performed using SMARTer RACE 5'/3' Kit (Clontech) with the custom-made primers (including at the 5’ end 15 nucleotides of pRACE vector sequence). Gene specific sequences are underlined.

  • Cal-opa 5’RACE primer: 5’-GATTACGCCAAGCTTCTGGGTGACGCCGTGGGCAAGGACGTCA

  • Cal-opa 3’RACE primer: 5’-GATTACGCCAAGCTTCGCGTCGATCGTCACGCCCCCAAATTCG

  • Aga-pan 5’RACE primer: 5’-GATTACGCCAAGCTTCGAATCTCCGGCCGCGGAATTGAGACTT

  • Aga-pan 3’RACE primer: 5’-GATTACGCCAAGCTTAGCTTCACGCGACCAGCAAAACCAACGG

  • cucoid 5’RACE primer: 5’- GATTACGCCAAGCTTCGTGACGGCTTCGATGGTTGGTTTTTCC

  • cucoid 3’RACE primer: 5’- GATTACGCCAAGCTTCGCACGTGTTGAACAGTCACATGTTGAC

  • Aae-cucoid 5’RACE primer: 5’- GATTACGCCAAGCTTGATCCGGTGGATCGGACTTGGCCGAGAT

  • Aae-cucoid 3’RACE primer: 5’- GATTACGCCAAGCTTAACCTCCCTCGGGGTTGAACGTGAAGCT

  • Aae-cucoid 5’RACE primer: 5’- GATTACGCCAAGCTTGATCCGGTGGATCGGACTTGGCCGAGAT

  • Aae-cucoid 3’RACE primer: 5’- GATTACGCCAAGCTTAACCTCCCTCGGGGTTGAACGTGAAGCT

  • Nsu-pan 5’RACE primer: 5’-GATTACGCCAAGCTTTCTGGTCGTGCGACGTTCTTCCAAATCG

  • Nsu-pan 3’RACE primer: 5’-GATTACGCCAAGCTTTCCCGTTGGTGCAAATCCACGAGATGTG

Cuticle preparations

Request a detailed protocol

Cuticles were prepped four to five days after injection. Eggshells was removed with tungsten needles and the embryos were transferred to a glass block dish with a drop of 1:4 glycerol/acetic acid. Following incubation in 1:4 glycerol/acetic acid overnight at room temperature, the cuticles were transferred onto a glass slide, oriented, mounted in 1:1 Hoyer’s medium/lactic acid (Stern and Sucena, 2000), covered with a cover glass, and dried overnight at 65 °C.

RNA-seq sample preparation and sequencing

Request a detailed protocol

Bisection of anterior and posterior embryo halves, RNA extraction, and sequencing were conducted as described (Klomp et al., 2015). In the case of Clogmia, anterior or posterior embryo halves from three 1 hr-old embryos were pooled and RNA-seq data were obtained from two replicates. In case of Lutzomyia, embryo halves from ten 1–2 hr-old embryos were pooled four replicates were generated. In case of Anopheles (G-3 strain), embryo halves from five 1 hr-old embryos were pooled and three replicates were generated, In the case of Culex, embryo halves from seven 1 hr-old embryos were pooled and three replicates were generated. In case of Aedes (Liverpool ‘black eye’ strain), embryo halves from five 1 hr-old embryos were pooled and four replicates were generated. In case of Nephrotoma, embryo halves from nine 1 hr-old embryos were pooled and three replicates were generated. Stage-specific Clogmia transcriptomes were generated from the offspring of a single mother and total RNA from five embryos was used for each stage. In the case of Lutzomyia, about 100 staged embryos were pooled for RNA extraction, and two independent RNA extractions from each time point were combined and submitted for sequencing.

Prior to library construction, RNA integrity, purity, and concentration were assessed using an Agilent 2100 Bioanalyzer with an RNA 6000 Nano Chip (Agilent Technologies, USA). Purification of messenger RNA (mRNA) was performed using the oligo-dT beads provided in the Illumina TruSEQ mRNA RNA-SEQ kit (Illumina, USA). Complementary DNA (cDNA) libraries for Illumina sequencing were constructed using the Illumina TruSEQ mRNA RNA-SEQ kit (Illumina, USA), using the manufacturer-specified protocol. Briefly, the mRNA was chemically fragmented and primed with random oligos for first strand cDNA synthesis. Second strand cDNA synthesis was then carried out with dUTPs to preserve strand orientation information. The double-stranded cDNA was then purified, end repaired, and ‘a-tailed’ for adaptor ligation. Following ligation, the samples were selected a final library size (adapters included) of 400–550 bp using sequential AMPure XP bead isolation (Beckman Coulter, USA). The libraries were sequenced in an Illumina HiSeq 4000 DNA sequencer, utilizing a pair end sequencing flow cell with a HiSeq Reagent Kit v4 (Illumina, USA).

RNA-seq data preprocessing

Request a detailed protocol

The TrimGalore (Krueger, 2012) wrapper for Cutadapt (Martin, 2011) and FastQC (Andrews, 2010) was used to remove adapters and low quality sequences from raw fastq files. Overlapping reads were combined with Flash (Magoč and Salzberg, 2011) prior to assembly.

Transcriptome assembly and annotation

Request a detailed protocol

Trinity 2.4.0 (Grabherr et al., 2011) on the Indiana University Karst high-performance computing cluster was used for assembling contiguous sequences (contigs) from the paired end (PE) sequence data of Clogmia, Lutzomyia, Anopheles, and Nephrotoma. ABySS 2.0 (Jackman et al., 2017) was used for assembling contigs from Culex and Aedes data. Only contigs of 200 nucleotides or greater were retained. BLAST+ tools (Camacho et al., 2009) were used to annotate contigs by conducting best-reciprocal-blast first against the Drosophila melanogaster transcriptome (BDGP6) peptide sequences (blastx/tblastn) and then the coding sequence (tblastx) with a maximum threshold evalue of 1e-10. Biomart and AnnotationDbi packages were used for gene ids and names. The longest open reading frames (ORFs) of unannotated transcripts were compared to the RefSeq invertebrate protein database (downloaded 4-1-2017) using blastp (max evalue 1e-10) followed by a similar comparison to remove transcripts with ORFs matching RefSeq plant, protozoan, archaea, bacteria, fungi, plasmid, or viral sequences (downloaded 6-1-2017). Remaining transcripts were designated by the top BLAST hit in D. melanogaster.

Alignment and differential expression analysis

Request a detailed protocol

Cleaned paired-end read data was aligned and analyzed using R base (Ihaka and Gentleman, 1996) and Bioconductor (Gentleman et al., 2004) software packages. Sequence alignment was conducted with the seed-and-vote aligner, Subread, as implemented in the Rsubread package (Liao et al., 2013) with up to five multi-mapping locations, six mismatches, and 20 subreads/seeds per read. Sequence file manipulation, including sorting and indexing of ‘.bam’ files, was done using Rsamtools (Morgan et al., 2013).

To avoid potential biases in transcript localization unrelated to anterior-posterior axis formation, transcripts annotated with mitochondrial, ribosomal, or ambiguous status (e.g., predicted, hypothetical, or uncharacterized) were filtered out prior to the differential expression comparisons. Transcripts with 20 or fewer counts in any of the A-P pairs were also excluded from the analysis prior to library normalization. Lower scoring, potentially related transcripts matching a given gene from the D. melanogaster transcriptome were retained for initial differential expression comparisons but removed for clarity of presentation in subsequent analyses and volcano plots. Trimmed mean of M-values (TMM) (Robinson and Oshlack, 2010) was used for normalization and EdgeR (Robinson et al., 2010) was used to perform quasi-likelihood F-tests between A-P samples, corrected for multiple testing using FDR (Benjamini-Hochberg). Following filtering based on annotation and detection of >20 counts per paired samples, we used the following number of transcripts for differential expression comparisons: 5602 for Clogmia; 5392 for Lutzomyia; 8239 for Culex; 5802 for Aedes; 9353 for Anopheles; 5371 for Nephrotoma.

Mapping RNA-seq reads to genomic loci

Request a detailed protocol

RNA-seq reads from stage-specific transcriptomes were mapped to genomic scaffolds containing a gene of interest using TopHat RNA-seq aligner (Trapnell et al., 2009). Publicly available Anopheles stephensi transcriptomes used in this paper were: SRR515316, SRR515341, SRR514863, and SRR515304.

Data availability

Request a detailed protocol

This project was deposited at the National Center for Biotechnology Information under Bioproject ID PRJNA454000 and the reads were deposited in the Short Reads Archives under accessions SRR7132661, SRR7132662, SRR7132659, SRR7132660, SRR7132665, SRR7132666, SRR7132663 and SRR7132664 for Clogmia, SRR7134470, SRR7134469, SRR7134472, SRR7134471, SRR7134468, and SRR7134467 for Lutzomiya, SRR8729860, SRR8729859, SRR8729858, SRR8729857, SRR8729856 and SRR8729855 for Anopheles, SRR8729854, SRR8729853, SRR8729852 and SRR8729851 for Aedes, SRR8729868, SRR8729867, SRR8729870, SRR8729869, SRR8729864 and SRR8729863 for Culex and SRR8729866, SRR8729865, SRR8729872, SRR8729871, SRR8729861 and SRR8729862 for Nephrotoma. Transcript sequences are listed on the Key Resources Table.

References

  1. 1
    The genome sequence of Drosophila melanogaster
    1. MD Adams
    2. SE Celniker
    3. RA Holt
    4. CA Evans
    5. JD Gocayne
    6. PG Amanatides
    7. SE Scherer
    8. PW Li
    9. RA Hoskins
    10. RF Galle
    11. RA George
    12. SE Lewis
    13. S Richards
    14. M Ashburner
    15. SN Henderson
    16. GG Sutton
    17. JR Wortman
    18. MD Yandell
    19. Q Zhang
    20. LX Chen
    21. RC Brandon
    22. YH Rogers
    23. RG Blazej
    24. M Champe
    25. BD Pfeiffer
    26. KH Wan
    27. C Doyle
    28. EG Baxter
    29. G Helt
    30. CR Nelson
    31. GL Gabor
    32. JF Abril
    33. A Agbayani
    34. HJ An
    35. C Andrews-Pfannkoch
    36. D Baldwin
    37. RM Ballew
    38. A Basu
    39. J Baxendale
    40. L Bayraktaroglu
    41. EM Beasley
    42. KY Beeson
    43. PV Benos
    44. BP Berman
    45. D Bhandari
    46. S Bolshakov
    47. D Borkova
    48. MR Botchan
    49. J Bouck
    50. P Brokstein
    51. P Brottier
    52. KC Burtis
    53. DA Busam
    54. H Butler
    55. E Cadieu
    56. A Center
    57. I Chandra
    58. JM Cherry
    59. S Cawley
    60. C Dahlke
    61. LB Davenport
    62. P Davies
    63. B de Pablos
    64. A Delcher
    65. Z Deng
    66. AD Mays
    67. I Dew
    68. SM Dietz
    69. K Dodson
    70. LE Doup
    71. M Downes
    72. S Dugan-Rocha
    73. BC Dunkov
    74. P Dunn
    75. KJ Durbin
    76. CC Evangelista
    77. C Ferraz
    78. S Ferriera
    79. W Fleischmann
    80. C Fosler
    81. AE Gabrielian
    82. NS Garg
    83. WM Gelbart
    84. K Glasser
    85. A Glodek
    86. F Gong
    87. JH Gorrell
    88. Z Gu
    89. P Guan
    90. M Harris
    91. NL Harris
    92. D Harvey
    93. TJ Heiman
    94. JR Hernandez
    95. J Houck
    96. D Hostin
    97. KA Houston
    98. TJ Howland
    99. MH Wei
    100. C Ibegwam
    101. M Jalali
    102. F Kalush
    103. GH Karpen
    104. Z Ke
    105. JA Kennison
    106. KA Ketchum
    107. BE Kimmel
    108. CD Kodira
    109. C Kraft
    110. S Kravitz
    111. D Kulp
    112. Z Lai
    113. P Lasko
    114. Y Lei
    115. AA Levitsky
    116. J Li
    117. Z Li
    118. Y Liang
    119. X Lin
    120. X Liu
    121. B Mattei
    122. TC McIntosh
    123. MP McLeod
    124. D McPherson
    125. G Merkulov
    126. NV Milshina
    127. C Mobarry
    128. J Morris
    129. A Moshrefi
    130. SM Mount
    131. M Moy
    132. B Murphy
    133. L Murphy
    134. DM Muzny
    135. DL Nelson
    136. DR Nelson
    137. KA Nelson
    138. K Nixon
    139. DR Nusskern
    140. JM Pacleb
    141. M Palazzolo
    142. GS Pittman
    143. S Pan
    144. J Pollard
    145. V Puri
    146. MG Reese
    147. K Reinert
    148. K Remington
    149. RD Saunders
    150. F Scheeler
    151. H Shen
    152. BC Shue
    153. I Sidén-Kiamos
    154. M Simpson
    155. MP Skupski
    156. T Smith
    157. E Spier
    158. AC Spradling
    159. M Stapleton
    160. R Strong
    161. E Sun
    162. R Svirskas
    163. C Tector
    164. R Turner
    165. E Venter
    166. AH Wang
    167. X Wang
    168. ZY Wang
    169. DA Wassarman
    170. GM Weinstock
    171. J Weissenbach
    172. SM Williams
    173. T Woodage
    174. KC Worley
    175. D Wu
    176. S Yang
    177. QA Yao
    178. J Ye
    179. RF Yeh
    180. JS Zaveri
    181. M Zhan
    182. G Zhang
    183. Q Zhao
    184. L Zheng
    185. XH Zheng
    186. FN Zhong
    187. W Zhong
    188. X Zhou
    189. S Zhu
    190. X Zhu
    191. HO Smith
    192. RA Gibbs
    193. EW Myers
    194. GM Rubin
    195. JC Venter
    (2000)
    Science 287:2185–2195.
    https://doi.org/10.1126/science.287.5461.2185
  2. 2
  3. 3
  4. 4
  5. 5
    FastQC
    1. S Andrews
    (2010)
    Babraham Bioinformatics.
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
    Molecular Genetics and the Evolution of Animal Design
    1. SB Carroll
    2. JK Grenier
    3. SD Weatherbee
    (2005)
    From DNA to diversity: , Molecular Genetics and the Evolution of Animal Design, Blackwell, Oxford Press.
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
    The Development of Drosophila Melanogaster
    1. W Driever
    (1993)
    'Maternal control of anterior development in the Drosophila embryo.', The Development of Drosophila Melanogaster, Laboratory Press: Cold Spring Harbor.
  26. 26
  27. 27
    A promoter-level mammalian expression atlas
    1. AR Forrest
    2. H Kawaji
    3. M Rehli
    4. JK Baillie
    5. MJ de Hoon
    6. V Haberle
    7. T Lassmann
    8. IV Kulakovskiy
    9. M Lizio
    10. M Itoh
    11. R Andersson
    12. CJ Mungall
    13. TF Meehan
    14. S Schmeier
    15. N Bertin
    16. M Jørgensen
    17. E Dimont
    18. E Arner
    19. C Schmidl
    20. U Schaefer
    21. YA Medvedeva
    22. C Plessy
    23. M Vitezic
    24. J Severin
    25. C Semple
    26. Y Ishizu
    27. RS Young
    28. M Francescatto
    29. I Alam
    30. D Albanese
    31. GM Altschuler
    32. T Arakawa
    33. JA Archer
    34. P Arner
    35. M Babina
    36. S Rennie
    37. PJ Balwierz
    38. AG Beckhouse
    39. S Pradhan-Bhatt
    40. JA Blake
    41. A Blumenthal
    42. B Bodega
    43. A Bonetti
    44. J Briggs
    45. F Brombacher
    46. AM Burroughs
    47. A Califano
    48. CV Cannistraci
    49. D Carbajo
    50. Y Chen
    51. M Chierici
    52. Y Ciani
    53. HC Clevers
    54. E Dalla
    55. CA Davis
    56. M Detmar
    57. AD Diehl
    58. T Dohi
    59. F Drabløs
    60. AS Edge
    61. M Edinger
    62. K Ekwall
    63. M Endoh
    64. H Enomoto
    65. M Fagiolini
    66. L Fairbairn
    67. H Fang
    68. MC Farach-Carson
    69. GJ Faulkner
    70. AV Favorov
    71. ME Fisher
    72. MC Frith
    73. R Fujita
    74. S Fukuda
    75. C Furlanello
    76. M Furino
    77. J Furusawa
    78. TB Geijtenbeek
    79. AP Gibson
    80. T Gingeras
    81. D Goldowitz
    82. J Gough
    83. S Guhl
    84. R Guler
    85. S Gustincich
    86. TJ Ha
    87. M Hamaguchi
    88. M Hara
    89. M Harbers
    90. J Harshbarger
    91. A Hasegawa
    92. Y Hasegawa
    93. T Hashimoto
    94. M Herlyn
    95. KJ Hitchens
    96. SJ Ho Sui
    97. OM Hofmann
    98. I Hoof
    99. F Hori
    100. L Huminiecki
    101. K Iida
    102. T Ikawa
    103. BR Jankovic
    104. H Jia
    105. A Joshi
    106. G Jurman
    107. B Kaczkowski
    108. C Kai
    109. K Kaida
    110. A Kaiho
    111. K Kajiyama
    112. M Kanamori-Katayama
    113. AS Kasianov
    114. T Kasukawa
    115. S Katayama
    116. S Kato
    117. S Kawaguchi
    118. H Kawamoto
    119. YI Kawamura
    120. T Kawashima
    121. JS Kempfle
    122. TJ Kenna
    123. J Kere
    124. LM Khachigian
    125. T Kitamura
    126. SP Klinken
    127. AJ Knox
    128. M Kojima
    129. S Kojima
    130. N Kondo
    131. H Koseki
    132. S Koyasu
    133. S Krampitz
    134. A Kubosaki
    135. AT Kwon
    136. JF Laros
    137. W Lee
    138. A Lennartsson
    139. K Li
    140. B Lilje
    141. L Lipovich
    142. A Mackay-Sim
    143. R Manabe
    144. JC Mar
    145. B Marchand
    146. A Mathelier
    147. N Mejhert
    148. A Meynert
    149. Y Mizuno
    150. DA de Lima Morais
    151. H Morikawa
    152. M Morimoto
    153. K Moro
    154. E Motakis
    155. H Motohashi
    156. CL Mummery
    157. M Murata
    158. S Nagao-Sato
    159. Y Nakachi
    160. F Nakahara
    161. T Nakamura
    162. Y Nakamura
    163. K Nakazato
    164. E van Nimwegen
    165. N Ninomiya
    166. H Nishiyori
    167. S Noma
    168. S Noma
    169. T Noazaki
    170. S Ogishima
    171. N Ohkura
    172. H Ohimiya
    173. H Ohno
    174. M Ohshima
    175. M Okada-Hatakeyama
    176. Y Okazaki
    177. V Orlando
    178. DA Ovchinnikov
    179. A Pain
    180. R Passier
    181. M Patrikakis
    182. H Persson
    183. S Piazza
    184. JG Prendergast
    185. OJ Rackham
    186. JA Ramilowski
    187. M Rashid
    188. T Ravasi
    189. P Rizzu
    190. M Roncador
    191. S Roy
    192. MB Rye
    193. E Saijyo
    194. A Sajantila
    195. A Saka
    196. S Sakaguchi
    197. M Sakai
    198. H Sato
    199. S Savvi
    200. A Saxena
    201. C Schneider
    202. EA Schultes
    203. GG Schulze-Tanzil
    204. A Schwegmann
    205. T Sengstag
    206. G Sheng
    207. H Shimoji
    208. Y Shimoni
    209. JW Shin
    210. C Simon
    211. D Sugiyama
    212. T Sugiyama
    213. M Suzuki
    214. N Suzuki
    215. RK Swoboda
    216. PA 't Hoen
    217. M Tagami
    218. N Takahashi
    219. J Takai
    220. H Tanaka
    221. H Tatsukawa
    222. Z Tatum
    223. M Thompson
    224. H Toyodo
    225. T Toyoda
    226. E Valen
    227. M van de Wetering
    228. LM van den Berg
    229. R Verado
    230. D Vijayan
    231. IE Vorontsov
    232. WW Wasserman
    233. S Watanabe
    234. CA Wells
    235. LN Winteringham
    236. E Wolvetang
    237. EJ Wood
    238. Y Yamaguchi
    239. M Yamamoto
    240. M Yoneda
    241. Y Yonekura
    242. S Yoshida
    243. SE Zabierowski
    244. PG Zhang
    245. X Zhao
    246. S Zucchelli
    247. KM Summers
    248. H Suzuki
    249. CO Daub
    250. J Kawai
    251. P Heutink
    252. W Hide
    253. TC Freeman
    254. B Lenhard
    255. VB Bajic
    256. MS Taylor
    257. VJ Makeev
    258. A Sandelin
    259. DA Hume
    260. P Carninci
    261. Y Hayashizaki
    262. FANTOM Consortium and the RIKEN PMI and CLST (DGT)
    (2014)
    Nature 507:462–470.
    https://doi.org/10.1038/nature13182
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
    Evolution of Insects
    1. D Grimaldi
    2. MS Engel
    (2005)
    Cambridge: Cambridge University Press.
  33. 33
  34. 34
  35. 35
  36. 36
    R: a language for data analysis and graphics
    1. R Ihaka
    2. R Gentleman
    (1996)
    Journal of Computational and Graphical Statistics 5:299–314.
    https://doi.org/10.2307/1390807
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
    Genome sequencing of the winged midge, Parochlus steinenii, from the antarctic peninsula
    1. S Kim
    2. M Oh
    3. W Jung
    4. J Park
    5. H-G Choi
    6. SC Shin
    (2017)
    GigaScience, 6, 10.1093/gigascience/giw009.
  46. 46
  47. 47
    Trim galore!
    1. F Krueger
    (2012)
    Babraham Bioinformatics.
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
    Rsamtools: Binary alignment (BAM), FASTA, variant call (BCF), and tabix file import
    1. M Morgan
    2. H Pages
    3. V Obenchain
    4. N Hayden
    (2013)
    Bioconductor.
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
    Drosophila Protocols
    1. DL Stern
    2. E Sucena
    (2000)
    Preparation of larval and adult cuticles for light microscopy, Drosophila Protocols, Cold Spring Harbor, CSHL Press.
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89

Decision letter

  1. Patricia J Wittkopp
    Senior and Reviewing Editor; University of Michigan, United States
  2. Leslie Pick
    Reviewer
  3. Aleksander Popadic
    Reviewer
  4. Michael Akam
    Reviewer; University of Cambridge, United Kingdom

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Evolution of embryonic axis determinants via alternative transcription" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Patricia Wittkopp as the Reviewing and Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Leslie Pick (Reviewer #1); Aleksander Popadic (Reviewer #2); Michael Akam (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary

Yoon et al. present a study of anterior determinants in Diptera, none of which utilize the Drosophila determinant, bcd. They identify opa, CG9215 and pangolin in different species through a combination of RNAseq, in situ hybridization, microinjection and RNAi in multiple species. Shared across genes and species, they find that alternate transcripts (alternate 3' or 5' ends) function in maternal and zygotic patterning. The first three figures present experiments on the moth fly, Clogmia. The authors convincingly demonstrate that opa functions as an anterior determinant in this species, analyzing expression and function in this species. They further show differential function of maternal and zygotic transcripts, which differ in expression and in 20 aa at the N-termini. Functions of the two isoforms are differentiated by RNAi, as well as ectopic injections, showing both loss and gain of function for this gene. The authors next demonstrate that opa coding sequences from other species are capable of functioning as anterior determinants in Clogmia. Next, the authors compare Clogmia opa to that of the sand fly Lutzomyia, finding alternate 5' and 3' UTRs in this species but no difference in protein coding regions of a maternal and zygotic transcript. Together, these results suggest that cis-regulatory evolution rather than protein evolution was the driver of opa taking on a role in anterior patterning. The authors next examine several mosquito species, in which opa is not maternally deposited (Figures 4 and 5). Rather, RNAseq for Culex identified CG9125 as an anteriorly localized gene that, when tested by RNAi, also appears to function as an anterior determinant. This gene also is differentially expressed and functions in Aedes mosquitoes. However, this gene was not detected as a potential anterior determinant in Anopheles mosquitoes and crane flies. Here, RNAseq identified pangolin as an anteriorly localized transcript. In all cases, alternate 5' ends were identified for maternal and zygotic transcripts. The paper also documents which of these species show posteriorly localised transcripts of the genes known to be involved in germ line specification. They identify such transcripts in all but the midge Clogmia, which appears not to localise any of the known germ cell determinants before blastoderm formation. This result is surprising, and another important finding of the paper. It perhaps deserves more prominence in the Abstract.

This is an impressive paper building on the established technical and conceptual expertise of the Schmidt-Ott group in working with axis specification in lower dipteran embryos. It extends work previously published in Science (Klomp et al., 2015), to generate remarkable further results. The study includes species of medical importance (Aedes, Anopheles, Lutzomyia) and work on a taxonomically significant group of basal dipterans, the crane flies, that have not previously been used for embryonic manipulation, to our knowledge. RNAseq analysis in bisected embryos was successful in identifying differentially localized gene products in both anterior and posterior regions of the embryo and led to the identification of novel anterior determinants in these species. The successful use of this approach is valuable for the field. Further, the authors present high quality in situ hybridization results in multiple species and, importantly, follow up on expression analysis with functional studies using both RNAi and injection of mRNA. These experiments appear to have been done rigorously and the figures are of very high quality. The data in Figure 2 particularly impressive.

Essential revisions

1) There was consensus among the reviewers that although the authors emphasize the theme of alternative transcripts, another key result from these experiments is the range of genes that can function as an anterior determinant in different species. The reviewers found this to be the more interesting and better supported conclusion of the work. As one reviewer wrote: The case for using these data as an evidence of AT is much less convincing, and it would need to be documented by rigorous testing. In addition, there is inconsistency in experimental design and over-reaching writing that detracts from the otherwise solid study. What the authors have been able to show, without any question, is that different proteins have been recruited to the anterior pole of the embryo to provide the anterior determination in different dipterans. But, this is not the same as documenting that this is due to alternative transcription. For example, in the best worked out species (Clogmia), the authors show that both maternal and zygotic opa transcripts can generate the same phenotype (double-headed larva), and consequently have the same function. In addition, the additional injections of mutated opa mRNA variants (Figure 3B) show that the obvious difference (additional 20aa in 5' end of zygotic transcript) has no effect on determining the anterior end. Surprisingly, it is the loss of 3'end sequence that has an effect. However, a closer inspection of the sequence alignment in Figure 1 supplemental shows that these regions are identical in both transcripts – hence the conundrum of explaining the difference in function. The only clue is provided in the Discussion "All anterior determinants that we report in this study contain either 5' or 3' UTR sequence that is not shared with the corresponding zygotic isoforms." But the authors do not provide any evidence in supplemental material to support this claim. If that information exists, can't that information be used to generate opa variants that can test the functional significance of these sequences? These types of experiments are required to generate evidence of alternative transcription. The paper suggests that in most cases the maternally expressed transcript is specific and likely newly evolved for this role. This is on the basis that (with one exception) the maternal transcripts are not expressed during the later stages of embryogenesis that have been examined. However, no data are shown to rule out the possibility that the maternal promoter is also expressed and functional at other life stages – for example, in the adult nervous system. It would be desirable to rule out this possibility, particularly if the authors want to stress the idea that these alternative transcripts really are novel inventions, and not simply the redeployment of an already established transcript isoform to a new role during oogenesis. The paper is written to strongly emphasise the fact that each of these novel anterior determinants is encoded by an alternative transcript form, and argues that this may be a common way for genes to acquire novel functions.

The claim about generality of AT as a mechanism and its significance is presented in the title, Abstract, Introduction, and Discussion, so there should be much stronger evidence in support of this claim. To show that AT is indeed responsible for the observed anterior axis determination the authors would have to commit to and perform rigorous experiments to show the differences in function between different transcripts, but these experiments would likely require more than two months to perform. We therefore encourage the authors to refocus the manuscript on the diversity of anterior determinants, removing prominent claims about alternative transcripts in the title and Abstract, at least. By their very nature as localised transcripts, these anterior determinants must contain specific localisation signals embedded in the RNA. This requirement may significantly increase the probability that such determinants evolve through alternative transcription, which allows novel DNA sequence to be expressed as RNA. It remains to be seen whether this would also be true for a randomly chosen set of novel gene functions. For that reason, and given the very considerable biological interest of the observation that novel determinants have evolved so frequently within the Diptera, we feel that stressing the message of alternative transcription might not be the best way to frame the paper.

2) The number of species used here, while quite impressive, is quite confusing for those outside the very immediate field. The species tree in Figure 1 has too little detail in Figure 1 while the one in Figure 6 has too much and doesn't indicate the species used in this paper. Perhaps a small table based on phylogenetic relationships among the species used would help? Photos of the species used? I would mention these relationships when each new species is introduced. For the purposes of this paper, those relationships are more important than the biomedical relevance of the species chosen.

3) Some experimental inconsistencies/over-interpretations were also noted. Some examples include: 1) probes used to detect expression patterns of the three Cqu-CG9215 transcripts (probe C is located in a conserved, shared region and is not specific to C-transcript only; it likely detects the expression of all three transcripts); 2) in Nephrotoma the authors have identified a single pangolin transcript that was labeled as Nsu-pan mat – the presence/absence of zygotic transcript has to be explicitly confirmed and stated as such; stating that on the basis of its expression "..localized maternal pangolin transcript functioned as anterior determinant in ancestral dipteran" is misleading; 3) similarly, stating that "For example, the anterior determinant of Clogmia (Cal-OpaMat) lacks the N-terminal 20 amino acids (Figure 1—figure supplement 1), […] Such changes to the protein could have been important for adopting a function as anterior determinant." when in fact this difference was shown not to be significant (Figure 3B) is erroneous and misleading. Please correct any errors and re-check the full manuscript carefully to correct such cases.

Optional suggestion from one reviewer:

1) The discussion of germ plasm and gene expression at the posterior role is certainly of interest and evidence for inductive germ cell specification in flies would be of great interest. However, I find this information distracting, at least in its current form and placement within the paper. I have never before suggested to an author that they should remove data from a manuscript but I am thinking that these data might be better presented in a separate study.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "A Range of Conserved Genes Establish Embryo Polarity in Moth Flies and Mosquitoes via Alternative Transcription" for further consideration at eLife. Your revised article has been favorably evaluated by Patricia Wittkopp as the Reviewing and Senior Editor, and three reviewers.

The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:

We all agreed that this study presents a very impressive body of work. The most strongly supported finding is that factors specifying the anterior end of the embryo are evolving more often than anticipated, and specific transcripts that play roles in this process are identified in moth flies and mosquito species. I think that this work will have a major impact on the field of evolution and development, and I look forward to seeing it published in eLife. However, there is one very important issue left to be resolved that requires only text changes.

This issue is the same as the primary issue raised during the first round of review: the framing of the work around alternative transcription (AT) is not justified by the strength of evidence presented that the AT was in fact responsible for the functional differences observed among species. All of the cases of AT described also include a difference in expression (presence and localization of the maternal transcript). The authors seem to be convinced that this difference in expression must be due to the differences in transcript structure (presumably differences in UTRs), but they do not do any experiments to directly demonstrate this (e.g., swapping UTRs between transcripts and showing that this causes the differences in localization, or expressing the zygotic transcript with the maternal promoter and showing this does not get localized similar to the maternal transcript). I realize that these are difficult experiments to perform in the species examined, so I am not suggesting that they be done. Rather, I’m saying that the conclusions need to be modified to reflect the fact these experiments haven't been done. For example, the different transcript structures might be a neutral byproduct of different promoters used to drive maternal and zygotic transcription. Without experiments disentangling AT from the expression differences, statements like " via Alternative Transcription" in the title, which implies causation, are inappropriate. Other examples of places where the strength of the evidence for AT are overstated include:

End of Abstract: "independently evolved the function of axis determinant via alternative transcription" (same issue as with title).

Discussion section: "All three genes are subject to alternative transcription." They are also all subject to differences in expression pattern, which should also be mentioned here.

In the response, the authors write "we wish to emphasize that AT of old genes provided opportunity for evolving the anterior determinant function." The problem is that AT facilitating this evolution isn't demonstrated. So, this is a fine possibility to raise in the discussion, but not appropriate for title and main conclusion in Abstract. Indeed, the response also says "Therefore, we propose that moth fly odd-paired evolved its specific function as axis determinant via a change in expression mediated by AT (maternal expression and localization), rather than in response to protein change.". Again, proposing this model in the Discussion is fine; presenting it the take home message of the paper in the title and Abstract is not.

In the response to reviewers, response 3 lists ways in which it was demonstrated that there are alternative transcripts with different expression patterns. But, the reviewers' question here wasn't whether evidence of AT was sufficiently strong, but rather whether the evidence that this AT was responsible for the new function (presumably by altering localization of the transcript) was sufficiently strong.

In other places in the manuscript, the statements made about AT are appropriate. For example:

End of introduction (with a slight tweak): "Our results show that a range of distinct old genes function as anterior determinant in different species by localizing alternative maternal transcript isoforms at the anterior egg pole. We therefore propose that AT “might have” played an important role in the evolution of this gene function and gene regulatory networks in fly embryos."

Results section: "We therefore propose that this gene function evolved via co-option when alternative maternal transcript of moth fly odd-paired became enriched at the anterior egg pole. " Wording here makes it clear this is a hypothesis/model.

Results section: "Taken together, our results suggest that cucoid acquired the anterior determinant function via the localization of a maternal transcript isoform with an alternative 3' end." This is agnostic to whether localization or AT causes the effect.

Results section: AT for pan: "Taken together with the isoform-specific transcript localization data presented above, these RNAi results support the hypothesis that pangolin acquired the anterior determinant function via the localization of a maternal transcript isoform with an alternative 3' end. " Good because it includes both the AT and expression difference.

Discussion section: "it is possible that AT facilitates the evolution of anterior determinants by providing the UTR sequence for isoform-specific localization signals that do not interfere with other gene functions" and "Additional experiments will be needed to test whether the unique UTR sequences of anterior determinants are essential for their localization at the anterior egg pole." A clear statement of the missing evidence to support the model. Good.

I think that changing the title more substantially will improve the paper. There are other important elements to this work that are not related to AT that will likely be missed by readers with a title and Abstract focused so specifically on AT. That is, I think the current framing of the work will reduce its impact on the field because it masks other important results such as the change in germ cell specification and the role of slp and mira in embryo polarity in Clogmia, which are not related to AT. I agree with the reviewers that these findings could make their own nice paper, but I defer to the author's preference to keep them in this work. Having dedicated section headings will help keep them from getting lost. Choosing a broader title less focused on AT (combined with mentioning these findings in the Abstract) would also help readers discover these results more readily. Perhaps something like "Divergent mechanisms of embryonic patterning (or polarity) among insects" would work for a title?

Finally, we think that reorganizing the Results section a bit to streamline it would improve readability of the manuscript (see reviewer comment below). However, I recognize that this is more subjective and leave it up to the author's discretion to decide whether and how to change the manuscript in response to this feedback.

Below are some of the comments from individual reviewers that elaborate on these concerns:

1) Insistence of interpreting data as a case of AT

In author's words "[...] Specifically, we provide evidence that the odd-paired ortholog of moth flies evolved without essential protein change an additional function as anterior determinant by maternally expressing and localizing transcript with alternative first exon in the anterior egg. This point is supported by RACE experiments and transcriptome profiling (Figure 1C), transcript-specific expression patterns (Figure 1D), transcript-specific functions (Figure 2), and comparative gain of function experiments (Figure 3)."

I tried to understand the authors' rationale, especially regarding the uppercase sentence that seems to suggest that it is an alternative first exon (present in Cal-otd mat transcript) that is responsible for the new function as anterior determinant. Data in Figure 1C shows the presence of two Cal-otd transcripts (Cal-OpaMat and Cal-OpaZyg) in embryos and Figure 1D shows that these two transcripts have different expression patterns. This is followed by RNAi functional experiments that show that depletion of Cal-OpaMat results in double-abdomens, while Cal-OpaZyg knockdowns have defects in segmentation and dorsal closure (Figure 2A-B). So far, so good. Then we reach Figure 3D that beautifully illustrates that Cal-OpaMat and Cal-OpaZyg are interchangeable in their ability to function as an anterior determinant. In other words, this new function in A-P axis determination is not due to changes in the protein sequence! Instead, it is driven by temporal and spatial changes in regulation of otd expression. Most people would consider this an example of regulatory evolution, which is not associated with AT per se. On that note, it is unclear why authors imply that the first exon is responsible for the anterior determination function – this exon is absent in Cal-OpaZyg, and yet this transcript can functionally substitute for Cal-OpaMat.

2) Data presentation and logic flow

This study is rather complex, encompassing multiple species and genes and a number of different experimental approaches. The authors should keep this in mind and streamline their presentation and description of results. For example, the effects of Cal-OpaMat and Cal-OpaZyg RNAi are presented first in Figure 2A-B, to be followed by description Cal-nos expression in Figure 2A. Then, the text describes the effects of Cal-OpaMat mRNA injections in Figure 3A, to be followed by description of differential expression analysis in Lutzomyia (Figure 3B-C), then back to Clogmia and testing the effects of injections of mRNA of Cal-OpaMat and Cal-OpaZyg (Figure 3D), and so on.

A streamlined presentation of results would be greatly appreciated by general readership. This would entail keeping the current Figure 1 and text describing it, then modifying Figure 2 and 3 and reorganizing current text starting with Cal-OpaMat RNAi results (current Figure 2A bottom), followed by expression studies of selected marker genes (current Figure 2A top), and followed by results of Cal-OpaMat mRNA injections (current Figure 3A). This way, all functional experiments for Cal-OpaMat are seamlessly presented at one place. This can be followed by similarly presented results for Cal-OpaZyg, and finished with results of mRNA injections of Cal-OpaMat and Cal-OpaZyg that highlight the functional interchangeability of two transcripts.

The structure and focus of the paper as re-submitted are similar to those of the first submission, despite the consensus view of the reviewers that it might usefully be changed. I think it unwise of the authors to ignore the reviewer's advice, but I do not think this a reason to reject the paper, so long as the specific concerns of the reviewers have been adequately addressed.

The Abstract is much improved and is now fine.

The structure of the Introduction remains not to my taste, but it is OK.

The new subheadings are useful, and new paragraphs providing clarification are generally helpful.

The handling of the germ cell data in a separate section is acceptable, though reviewer 1's suggestion to publish it elsewhere seemed to me to have merit.

https://doi.org/10.7554/eLife.46711.038

Author response

Essential revisions

1) There was consensus among the reviewers that although the authors emphasize the theme of alternative transcripts, another key result from these experiments is the range of genes that can function as an anterior determinant in different species. The reviewers found this to be the more interesting and better supported conclusion of the work. As one reviewer wrote: The case for using these data as an evidence of AT is much less convincing, and it would need to be documented by rigorous testing. In addition, there is inconsistency in experimental design and over-reaching writing that detracts from the otherwise solid study. What the authors have been able to show, without any question, is that different proteins have been recruited to the anterior pole of the embryo to provide the anterior determination in different dipterans. But, this is not the same as documenting that this is due to alternative transcription.

We agree that the range of genes that can function as an anterior determinant in different species is an interesting result of our study. However, our study also provides insight into the mechanism by which old genes evolve the anterior determinant function, and we would like to emphasize both. Specifically, we provide evidence that the odd-paired ortholog of moth flies evolved without essential protein changean additional function as anterior determinant by maternally expressing and localizing transcript with alternative first exon in the anterior egg. This point is supported by RACE experiments and transcriptome profiling (Figure 1C), transcript-specific expression patterns (Figure 1D), transcript-specific functions (Figure 2), and comparative gain of function experiments (Figure 3). Additionally, in Culex, only one of three alternative cucoid (CG1925) transcript isoforms with alternative last exon appears to be maternally expressed and localized (Figure 4B, C), and is therefore a plausible candidate of this gene’s anterior determinant function. Finally, in Anopheles, a pangolin transcript isoform with alternative last exon is maternally expressed and localized, and specifically required as anterior determinant (Figure 6B-D). The literature on AT is large but we are not aware of any comparative in vivostudy that better documents the new function of an alternative transcript isoform than this case. Therefore, we wish to emphasize that AT of old genes provided opportunity for evolving the anterior determinant function.

This is not the same as claiming that the anterior determinant function evolved “due to alternative transcription”, which on its own does not necessarily result in localized gene activity at the anterior egg pole. We realize that this difference was not made sufficiently clear in the original manuscript. To clarify this issue and to better weigh our results, we modified the title of the manuscript and carefully revised all sections of the manuscript, including the summaries provided in the Abstract, at the end of the Introduction, and at the beginning of the Discussion (see highlighted text in the comparison of the original and the revised manuscript texts).

Importantly, in the Results section, we added several subheadings and rationale to better define our goals in each species. In the revised version, results in Culex and Aedes are presented in separate figures (Figure 4 and Figure 5) because these two species serve slightly different purposes. Moreover, we moved the Nephrotoma results after the Anopheles data and clarify our specific goal with this species. Our goal with Nephrotoma has been to test whether anterior-localized maternal pangolin transcript is an old dipteran heritage. This was confirmed. We did not conduct a detailed analysis of alternative pangolin transcripts in this species because an assembled genome sequence is not available and because the purpose for including this species in the analysis was to test whether pangolin preceded panish as the anterior determinant gene.

For example, in the best worked out species (Clogmia), the authors show that both maternal and zygotic opa transcripts can generate the same phenotype (double-headed larva), and consequently have the same function. In addition, the additional injections of mutated opa mRNA variants (Figure 3B) show that the obvious difference (additional 20aa in 5' end of zygotic transcript) has no effect on determining the anterior end. Surprisingly, it is the loss of 3'end sequence that has an effect. However, a closer inspection of the sequence alignment in Figure 1 supplemental shows that these regions are identical in both transcripts – hence the conundrum of explaining the difference in function.

We revised the Results section to clarify our message. In the moth fly section, we provide evidence that the C-terminal sequence is important for Cal-Opa’s function as anterior determinant but this sequence could be important for any other function of Odd-paired as well. More surprisingly, we found that large N-terminal truncations do not preclude its role as anterior determinant (Figure 3D). In agreement with this observation, we propose that the natural occurrence of the N-terminal truncation in Cal-OpaMatmay not have played an important role in evolving the anterior determinant function. This hypothesis is supported by three additional lines:

· The zygotic ORF can function as anterior determinant if the corresponding transcript is presented in the pole region of very early embryos.

· The odd-paired ORFs of Drosophila and Chironomus can induce head development in Clogmia, if the corresponding transcript is presented in the pole region of very early embryos.

· The N-terminal truncation is not conserved in Lutzomyia, and the untruncated ORF of Llo-opaMat can induce head development in Clogmia, if the corresponding transcript is presented in the pole region of very early embryos.

Therefore, we propose that moth fly odd-paired evolved its specific function as axis determinant via a change in expression mediated by AT (maternal expression and localization), rather than in response to protein change. This is a very important point because it provides insight into the mechanism by which moth fly odd-paired evolved its function as anterior determinant.

To put this in context, we would like to point out that a large body of work has been conducted to better understand how an axis determinant, such as bicoid, acquired its function (e.g., Datta et al., 2017; Liu et al., 2018). This work has been conducted under the premise that protein changes enabled Bicoid’s unique function as axis determinant, but this premise remains contentious (see last paragraph in the Discussion section of Liu et al., 2018). Our results in moth flies provide proof-of-concept for an alternative mechanism by which genes can evolve the anterior determinant function.

The only clue is provided in the Discussion "All anterior determinants that we report in this study contain either 5' or 3' UTR sequence that is not shared with the corresponding zygotic isoforms." But the authors do not provide any evidence in supplemental material to support this claim. If that information exists, can't that information be used to generate opa variants that can test the functional significance of these sequences? These types of experiments are required to generate evidence of alternative transcription.

Please also refer to response above. Based on our RACE, RNA-seq, and RNA in situ hybridization results, Cal-opa (Figure 1C, D), cucoid (Figure 4B, C) and Aga-pangolin (Figure 6B, C) are subject to alternative transcription. Information on non-overlapping UTR sequences is included in these figures and all sequences have been made publicly available (see accession numbers under Data availability).

In the case of cucoid, only probe C detected localized maternal transcript. This probe targets a region that is shared by all three cucoid transcripts and therefore, on its own, cannot establish isoform-specific transcription. However, probes specific to the two longer transcript variants (cucoidAand cucoidB; including the variant with complete ORF) only detected zygotic expression, indicating that those transcripts are not localized at the anterior pole of the egg. We therefore infer that of the three identified cucoid isoforms, only the very short very short cucoidC isoform is localized. Directly studying the expression of this isoform is challenging due to its short unique sequence (121 nucleotides). This rationale is explained in the main text in the paragraph summarizing our results in Culex.

The paper suggests that in most cases the maternally expressed transcript is specific and likely newly evolved for this role. This is on the basis that (with one exception) the maternal transcripts are not expressed during the later stages of embryogenesis that have been examined. However, no data are shown to rule out the possibility that the maternal promoter is also expressed and functional at other life stages – for example, in the adult nervous system. It would be desirable to rule out this possibility, particularly if the authors want to stress the idea that these alternative transcripts really are novel inventions, and not simply the redeployment of an already established transcript isoform to a new role during oogenesis.

We do not know if the localized isoforms evolved specifically for their role as anterior determinant. Additional RACE experiments in Clogmia failed to identify Cal-OpaMattranscript in other tissues, including adult flies, provided that ovarian tissue was removed. However, it is conceivable that our experiments failed to detect transcript that was expressed at low level or in few cells.

In any case, it seems likely that the maternally expressed transcript isoforms are older than their ability to localize tightly at the anterior pole and to function as anterior determinant. In the revised manuscript, we emphasize that maternally expressed transcripts with alternative 5’ or 3’ end provided opportunity for evolving the anterior determinant function via transcript localization and co-option, irrespective of the evolutionary age and potential other uses of these transcript isoforms in other cell types.

The paper is written to emphasise strongly the fact that each of these novel anterior determinants is encoded by an alternative transcript form, and argues that this may be a common way for genes to acquire novel functions.

The claim about generality of AT as a mechanism and its significance is presented in the title, Abstract, Introduction, and Discussion, so there should be much stronger evidence in support of this claim. To show that AT is indeed responsible for the observed anterior axis determination the authors would have to commit to and perform rigorous experiments to show the differences in function between different transcripts, but these experiments would likely require more than two months to perform. We therefore encourage the authors to refocus the manuscript on the diversity of anterior determinants, removing prominent claims about alternative transcripts in the title and Abstract, at least.

Please refer to our first response above.

By their very nature as localised transcripts, these anterior determinants must contain specific localisation signals embedded in the RNA. This requirement may significantly increase the probability that such determinants evolve through alternative transcription, which allows novel DNA sequence to be expressed as RNA.

We agree and have made this point at the end of the first paragraph of the Discussion section. The development of a suitable assay to map the transcript localization signal of Cal-opa is something we pursue but is not trivial in this species and beyond the goal of the present study.

It remains to be seen whether this would also be true for a randomly chosen set of novel gene functions. For that reason, and given the very considerable biological interest of the observation that novel determinants have evolved so frequently within the Diptera, we feel that stressing the message of alternative transcription might not be the best way to frame the paper.

Please refer to our first and second response above.

2) The number of species used here, while quite impressive, is quite confusing for those outside the very immediate field. The species tree in Figure 1 has too little detail in Figure 1 while the one in Figure 6 has too much and doesn't indicate the species used in this paper. Perhaps a small table based on phylogenetic relationships among the species used would help? Photos of the species used? I would mention these relationships when each new species is introduced. For the purposes of this paper, those relationships are more important than the biomedical relevance of the species chosen.

To address this issue, we made changes to the relevant figures (Figure 1A and Figure 7) and clarified the phylogenetic position of each species in the main text.

3) Some experimental inconsistencies/over-interpretations were also noted. Some examples include: 1) probes used to detect expression patterns of the three Cqu-CG9215 transcripts (probe C is located in a conserved, shared region and is not specific to C-transcript only; it likely detects the expression of all three transcripts);

This is correct. Probe C detects all three transcripts. However, probe C is the only probe that detected localized maternal expression of this gene and probes specific to the two longer transcript variants only detected zygotic expression, indicating that those transcripts are not localized at the anterior pole of the egg. Please refer to our third response above for additional details.

2) in Nephrotoma the authors have identified a single pangolin transcript that was labeled as Nsu-pan mat – the presence/absence of zygotic transcript has to be explicitly confirmed and stated as such; stating that on the basis of its expression "localized maternal pangolin transcript functioned as anterior determinant in ancestral dipteran" is misleading;

See also our first response above. We changed the labeling to Nsu-pan and revised the conclusion: “Taken together with our Anopheles data, our results in Nephrotoma suggest that ancestral dipteran insects localized maternal pangolin transcript in the anterior egg pole, where this transcript may have functioned as anterior determinant.”

3) similarly, stating that "For example, the anterior determinant of Clogmia (Cal-OpaMat) lacks the N-terminal 20 amino acids (Figure 1—figure supplement 1),.……. Such changes to the protein could have been important for adopting a function as anterior determinant." when in fact this difference was shown not to be significant (Figure 3B) is erroneous and misleading. Please correct any errors and re-check the full manuscript carefully to correct such cases.

This quote is presented out of context. We present alternative hypotheses. To avoid misunderstanding, we slightly modified the relevant paragraph (second paragraph of the Discussion).

Optional suggestion from one reviewer:

1) The discussion of germ plasm and gene expression at the posterior role is certainly of interest and evidence for inductive germ cell specification in flies would be of great interest. However, I find this information distracting, at least in its current form and placement within the paper. I have never before suggested to an author that they should remove data from a manuscript but I am thinking that these data might be better presented in a separate study.

We considered this possibility before submitting our manuscript. We decided against it because the question of a potential loss of the maternal germ plasm is raised by our profiling data. The loss of maternal germ plasm in Clogmia is supported by the duplication of nos-positive cells in double abdomens and adds confidence in the transcript localization data (Figure 1B). To address the reviewer concern, we now present these data under a separate subheading. This change gives readers the option to skip this section.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

[…] This issue is the same as the primary issue raised during the first round of review: the framing of the work around alternative transcription (AT) is not justified by the strength of evidence presented that the AT was in fact responsible for the functional differences observed among species. All of the cases of AT described also include a difference in expression (presence and localization of the maternal transcript). The authors seem to be convinced that this difference in expression must be due to the differences in transcript structure (presumably differences in UTRs), but they do not do any experiments to directly demonstrate this (e.g., swapping UTRs between transcripts and showing that this causes the differences in localization, or expressing the zygotic transcript with the maternal promoter and showing this does not get localized similar to the maternal transcript). I realize that these are difficult experiments to perform in the species examined, so I am not suggesting that they be done. Rather, I’m saying that the conclusions need to be modified to reflect the fact these experiments haven't been done. For example, the different transcript structures might be a neutral byproduct of different promoters used to drive maternal and zygotic transcription. Without experiments disentangling AT from the expression differences, statements like " via Alternative Transcription" in the title, which implies causation, are inappropriate. Other examples of places where the strength of the evidence for AT are overstated include:

End of Abstract: "independently evolved the function of axis determinant via alternative transcription" (same issue as with title).

We actually agree with the reviewers on this point. Maternal expression and anterior transcript localization (or activity localization) seem to be key for evolving the anterior determinant function. However, whether the localization signal or maternal expression came first (or together), and whether the localization signal is confined to transcript-specific sequence of the maternal isoform, may vary from case to case.

AT can accommodate the change in expression for evolving the anterior determinant function (maternal plus localized activity) by providing a promoter for maternal expression and/or by providing sequence for evolving a strong localization signal de novo, or for strengthening a more diffuse pre-existing localization signal. In each case, AT allows to minimize interference with pre-existing gene regulation and function when a new anterior determinant evolves. But this is not to say that the localization signals of anterior determinants must be confined to transcript-specific sequence of the maternal isoform.

In this context, we would like to point out that the transcripts of many pair-rule genes of Drosophila contain localization signals of variable length, and would likely be localized like bicoid if expressed maternally, because they use the same microtubule-dependent machinery (e.g., Bullock, Stauber … and Schmidt-Ott, 2004, and other work from Bullock et al.). Conversely, bicoid mRNA is localized apically like pair-rule gene transcripts when injected into the syncytial blastoderm.

To avoid being misunderstood, we removed the expression “via alternative transcription” in the title, which now reads: “Embryo polarity in moth flies and mosquitoes relies on distinct old genes with localized transcript isoforms”. Additionally, we revised the Abstract and conclude: “In conclusion, flies evolved an unexpected diversity of anterior determinants, and alternative transcript isoforms with distinct expression can adopt fundamentally distinct developmental roles.” The latter point is mainly based on our Clogmia results but seems important to us, because the neglect of alternative transcription in the evo devo literature suggests that this possibility is not widely appreciated in this field.

Discussion section: "All three genes are subject to alternative transcription." They are also all subject to differences in expression pattern, which should also be mentioned here.

The sentence appears in the first paragraph of the Introduction and was changed to: “All three genes not only localize their maternal transcript at the anterior egg pole; they also are subject to alternative transcription, which allows a single gene to generate multiple transcript isoforms with distinct 5’ and 3’ ends through the use of alternative promoters (alternative transcription initiation) and polyadenylation signals (alternative transcription termination).”

The additional explanation was necessary, because we shifted the section on alternative transcription from the Introduction to the Discussion.

In the response, the authors write "we wish to emphasize that AT of old genes provided opportunity for evolving the anterior determinant function." The problem is that AT facilitating this evolution isn't demonstrated. So, this is a fine possibility to raise in the discussion, but not appropriate for title and main conclusion in Abstract. Indeed, the response also says "Therefore, we propose that moth fly odd-paired evolved its specific function as axis determinant via a change in expression mediated by AT (maternal expression and localization), rather than in response to protein change." Again, proposing this model in the discussion is fine; presenting it the take home message of the paper in the title and Abstract is not.

We moved the introductory paragraphs on alternative transcription, in a condensed form, to the Discussion section.

In the response to reviewers, response above lists ways in which it was demonstrated that there are alternative transcripts with different expression patterns. But, the reviewers' question here wasn't whether evidence of AT was sufficiently strong, but rather whether the evidence that this AT was responsible for the new function (presumably by altering localization of the transcript) was sufficiently strong.

We do not wish to claim that AT per se was responsible for the new function, but AT could have facilitated the evolution of localization signals and/or maternal expression without interfering with pre-existing gene regulation/function (as discussed under response above).

In other places in the manuscript, the statements made about AT are appropriate. For example:

End of introduction (with a slight tweak): "Our results show that a range of distinct old genes function as anterior determinant in different species by localizing alternative maternal transcript isoforms at the anterior egg pole. We therefore propose that AT “might have” played an important role in the evolution of this gene function and gene regulatory networks in fly embryos."

The end of the Introduction now concludes with: “Our results reveal three distinct old genes that evolved anterior determinants by localizing an alternative maternal transcript isoform at the anterior egg pole of the respective species. Therefore, alternative transcription might have played an important role in the evolution of this gene function and gene regulatory networks in fly embryos.”

Results section: "We therefore propose that this gene function evolved via co-option when alternative maternal transcript of moth fly odd-paired became enriched at the anterior egg pole. " Wording here makes it clear this is a hypothesis / model.

Results section: "Taken together, our results suggest that cucoid acquired the anterior determinant function via the localization of a maternal transcript isoform with an alternative 3' end." This is agnostic to whether localization or AT causes the effect.

Results section: AT for pan: "Taken together with the isoform-specific transcript localization data presented above, these RNAi results support the hypothesis that pangolin acquired the anterior determinant function via the localization of a maternal transcript isoform with an alternative 3' end. " Good because it includes both the AT and expression difference.

Discussion section: "it is possible that AT facilitates the evolution of anterior determinants by providing the UTR sequence for isoform-specific localization signals that do not interfere with other gene functions" and "Additional experiments will be needed to test whether the unique UTR sequences of anterior determinants are essential for their localization at the anterior egg pole." A clear statement of the missing evidence to support the model. Good.

Thank you for this helpful feedback.

I think that changing the title more substantially will improve the paper. There are other important elements to this work that are not related to AT that will likely be missed by readers with a title and Abstract focused so specifically on AT. That is, I think the current framing of the work will reduce its impact on the field because it masks other important results such as the change in germ cell specification and the role of slp and mira in embryo polarity in Clogmia, which are not related to AT. I agree with the reviewers that these findings could make their own nice paper, but I defer to the author's preference to keep them in this work. Having dedicated section headings will help keep them from getting lost.

We added the following sentence in the Abstract: “Additionally, Clogmia lost maternal germ plasm, which contributes to embryo polarity in fruit flies (Drosophila).” In the Results section, we discuss these data at the end of the Clogmia section under the sub-heading: “Cal-OpaMat suppresses zygotic germ cell specification at the anterior pole and Clogmia lacks maternal germ plasm”.

Choosing a broader title less focused on AT (combined with mentioning these findings in the Abstract) would also help readers discover these results more readily. Perhaps something like "Divergent mechanisms of embryonic patterning (or polarity) among insects" would work for a title?

As mentioned above, we revised the title: “Embryo polarity in moth flies and mosquitoes relies on distinct old genes with localized transcript isoforms”. We hope this title is acceptable. It focuses on facts that we wish to stress but does not infer causality. The title that you suggest would apply equally well to several previous studies on axis specification in Tribolium, Nasonia, and Chironomus, and would fail to specify what is new about the present study. Our study is the first to show that the anterior determinant function can evolve via change in expression, only.

Finally, we think that reorganizing the Results section a bit to streamline it would improve readability of the manuscript (see reviewer comment below). However, I recognize that this is more subjective and leave it up to the author's discretion to decide whether and how to change the manuscript in response to this feedback.

We essentially followed the reviewer suggestions (2). Specifically, we removed the paragraphs on AT in the Introduction to the last section of the Discussion. We wish to discuss our results in the broader context of this literature because, to our knowledge, there is a lack of well documented examples in which alternative transcripts of a gene have taken on clearly distinct developmental roles.

Importantly, we also reorganized the Result section, keeping the Clogmia data together, as suggested by the reviewer. Accordingly, some main figure compositions, and the numbering of some supplementary figures, have changed in the revised manuscript. In the revised manuscript, the Clogmia section ends with the loss of maternal germ plasm in this species. We think that it is important to include these data, not only because the volcano plot raises this issue, but also because germ plasm has been implicated in axis specification (e.g., Nos-dependent maternal Hb gradient in Drosophila embryos). To clarify the rationale for including this section we made slight changes to this section and added two references that established the role of the maternal Hb gradient in axis specification in Drosophila (Tautz, 1988 and Struhl et al., 1992).

We did not expand the section of sloppy-paired and miranda transcripts in Clogmia, because the localization of these transcripts does not seem to be essential for axis specification (see gain of function experiments with Cal-opa), and because their localization is not conserved in the other moth fly, Lutzomyia, unlike the localization of odd-paired transcript.

Below are some of the comments from individual reviewers that elaborate on these concerns:

1) Insistence of interpreting data as a case of AT

In author's words "[…] Specifically, we provide evidence that the odd-paired ortholog of moth flies evolved without essential protein change an additional function as anterior determinant by maternally expressing and localizing transcript with alternative first exon in the anterior egg. This point is supported by RACE experiments and transcriptome profiling (Figure 1C), transcript-specific expression patterns (Figure 1D), transcript-specific functions (Figure 2), and comparative gain of function experiments (Figure 3)."

I tried to understand the authors' rationale, especially regarding the uppercase sentence that seems to suggest that it is an alternative first exon (present in Cal-otd mat transcript) that is responsible for the new function as anterior determinant. Data in Figure 1C shows the presence of two Cal-otd transcripts (Cal-OpaMatand Cal-OpaZyg) in embryos and Figure 1D shows that these two transcripts have different expression patterns. This is followed by RNAi functional experiments that show that depletion of Cal-OpaMatresults in double-abdomens, while Cal-OpaZyg knockdowns have defects in segmentation and dorsal closure (Figure 2A-B). So far, so good. Then we reach Figure 3D that beautifully illustrates that Cal-OpaMatand Cal-OpaZyg are interchangeable in their ability to function as an anterior determinant. In other words, this new function in A-P axis determination is not due to changes in the protein sequence! Instead, it is driven by temporal and spatial changes in regulation of otd expression. Most people would consider this an example of regulatory evolution, which is not associated with AT per se.

We do indeed propose that regulatory evolution was key. Maternal expression and transcript localization (gene activity localization) had to be achieved for odd-paired to adopt the role of anterior determinant. In the case Cal-opa, the maternal promoter resulted from AT, and we suspect that the Cal-OpaMat -specific 5’UTR (also a result of AT) provided opportunity for evolving a transcript-specific localization signal after maternal expression. Alternatively, the localization signal was already in place (anywhere in the Cal-opa transcript) and evolved before maternal expression. A combination of both models is also possible. The links of AT to transcript localization can be manifold, as outlined under response one above, and probably provide yet another example of opportunistic evolution. What we wish to make clear is that AT is a common theme in the evolution of anterior determinants but its specific use varies case by case.

On that note, it is unclear why authors imply that the first exon is responsible for the anterior determination function – this exon is absent in Cal-OpaZyg, and yet this transcript can functionally substitute for Cal-OpaMat.

In the gain-of-function experiments, we tested mRNAs with heterologous UTRs provided by the vector, i.e., only the open reading frames of these transcripts were compared under the same artificial “localization” conditions (mRNA injection at the posterior pole). The distinct open reading frames of Cal-OpaMat and Cal-OpaZyg were functionally indistinguishable in our assay, indicating that the alternative transcription start site and/or unique 5’UTR of Cal-OpaMat (both a result of AT) were key for evolving the anterior determinant function of odd-paired in moth flies.

2) Data presentation and logic flow

This study is rather complex, encompassing multiple species and genes and a number of different experimental approaches. The authors should keep this in mind and streamline their presentation and description of results. For example, the effects of Cal-OpaMatand Cal-OpaZyg RNAi are presented first in Figure 2A-B, to be followed by description Cal-nos expression in Figure 2A. Then, the text describes the effects of Cal-OpaMatmRNA injections in Figure 3A, to be followed by description of differential expression analysis in Lutzomyia (Figure 3B-C), then back to Clogmia and testing the effects of injections of mRNA of Cal-OpaMatand Cal-OpaZyg (Figure 3D), and so on.

A streamlined presentation of results would be greatly appreciated by general readership. This would entail keeping the current Figure 1 and text describing it, then modifying Figure 2 and 3 and reorganizing current text starting with Cal-OpaMatRNAi results (current Figure 2A bottom), followed by expression studies of selected marker genes (current Figure 2A top), and followed by results of Cal-OpaMatmRNA injections (current Figure 3A). This way, all functional experiments for Cal-OpaMatare seamlessly presented at one place. This can be followed by similarly presented results for Cal-OpaZyg, and finished with results of mRNA injections of Cal-OpaMatand Cal-OpaZyg that highlight the functional interchangeability of two transcripts.

The structure and focus of the paper as re-submitted are similar to those of the first submission, despite the consensus view of the reviewers that it might usefully be changed. I think it unwise of the authors to ignore the reviewer's advice, but I do not think this a reason to reject the paper, so long as the specific concerns of the reviewers have been adequately addressed.

The Abstract is much improved and is now fine.

The structure of the Introduction remains not to my taste, but it is OK.

The new subheadings are useful, and new paragraphs providing clarification are generally helpful.

The handling of the germ cell data in a separate section is acceptable, though reviewer 1's suggestion to publish it elsewhere seemed to me to have merit.

We are grateful for these comments and implemented them as described under response one above.

https://doi.org/10.7554/eLife.46711.039

Article and author information

Author details

  1. Yoseop Yoon

    Department of Organismal Biology and Anatomy, University of Chicago, Chicago, United States
    Contribution
    Conceptualization, Formal analysis, Funding acquisition, Investigation, Visualization, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6062-0979
  2. Jeff Klomp

    Department of Organismal Biology and Anatomy, University of Chicago, Chicago, United States
    Present address
    University of North Carolina, Lineberger Comprehensive Cancer Center, Chapel Hill, United States
    Contribution
    Conceptualization, Formal analysis, Investigation, Visualization, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  3. Ines Martin-Martin

    Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, Rockville, United States
    Contribution
    Formal analysis, Investigation, Visualization
    Competing interests
    No competing interests declared
  4. Frank Criscione

    Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, Rockville, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  5. Eric Calvo

    Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, Rockville, United States
    Contribution
    Supervision
    Competing interests
    No competing interests declared
  6. Jose Ribeiro

    Laboratory of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases, Rockville, United States
    Contribution
    Resources, Formal analysis, Supervision, Funding acquisition
    Competing interests
    No competing interests declared
  7. Urs Schmidt-Ott

    Department of Organismal Biology and Anatomy, University of Chicago, Chicago, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Writing—original draft, Project administration, Writing—review and editing
    For correspondence
    uschmid@uchicago.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1351-9472

Funding

National Science Foundation (IOS-1355057)

  • Urs Schmidt-Ott

National Institute of General Medical Sciences (R01 GM127366-01A1)

  • Urs Schmidt-Ott

National Center for Advancing Translational Sciences (UL1 TR000430)

  • Urs Schmidt-Ott

University of Chicago (Institutional fund)

  • Urs Schmidt-Ott

National Institute of Allergy and Infectious Diseases (Intramural Program)

  • Jose Ribeiro

University of Chicago (Henry Hinds Funds for Graduate Student Research in Evolutionary Biology)

  • Yoseop Yoon

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Chun Wai Kwan, Claudia Vacca, and Nicole Horio for technical assistance, Arthur Forer (York University, Canada) for the Nephrotoma culture, Robert Harrell and Channa Aluvihare (Insect Transformation Facility, University of Maryland, MD) for shipping blood-fed mosquitoes, Vanessa Macias and Anthony James (University of California at Irvine, CA) for Aedes and Culex reagents, Molly Duman Scheel (Indiana University, IN) for logistic support, and Edwin L Ferguson (University of Chicago, IL) and M Feder (University of Chicago, IL) for laboratory equipment. EL Ferguson provided detailed comments on a manuscript draft. This work was supported by funds from the National Science Foundation (IOS-1355057), the National Institute of General Medical Science (5R01GM127366-02), the University of Chicago, and the National Center for Advancing Translational Sciences of the National Institutes of Health (UL1 TR000430) to U S-O, and the Intramural Program of the National Institute of Allergy and Infectious Diseases to J R YY was the recipient of an award of University of Chicago Henry Hinds Funds for Graduate Student Research in Evolutionary Biology. Transcriptomic data are available at the National Center for Biotechnology Information Sequence Read Archive (Bioproject ID PRJNA454000). This work utilized the computational resources of the NIH HPC Biowulf cluster.

Senior and Reviewing Editor

  1. Patricia J Wittkopp, University of Michigan, United States

Reviewers

  1. Leslie Pick
  2. Aleksander Popadic
  3. Michael Akam, University of Cambridge, United Kingdom

Publication history

  1. Received: March 9, 2019
  2. Accepted: September 6, 2019
  3. Version of Record published: October 8, 2019 (version 1)

Copyright

© 2019, Yoon et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 750
    Page views
  • 66
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)